Overview

Brief Summary

Biology

The distinct triple-tracks of the southern marsupial mole, created by the hind feet and the hard tail swinging from side to side are most often found following rain (8), but it is not clear whether the mole emerges from under the sand more often after rain or whether the tracks are simply more obvious (7) (8). Burrowing just 10 cm beneath the surface, the mole travels fairly short distances pushing with the horny nose, scooping with the forefeet and throwing up the sand with the hind feet. The tunnels collapse behind the mole as it travels and it surfaces fairly frequently, propelling itself with its hind feet across the sand (5) (8). Reported separately as both diurnal and nocturnal, the southern marsupial mole appears to be quite active, pursuing prey including ant pupae, scarab beetle larvae, sawfly larvae, moth larvae and adult beetles with fervour (6) (5). The southern marsupial mole also never needs to drink, obtaining the water it needs from its food (6). Little is known about the reproductive habits of the southern marsupial mole, but it is thought to breed around November, producing one or two young (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Although no more related to placental moles than to any other placental mammal, the southern marsupial mole has a remarkably similar body form as a result of its burrowing lifestyle (5). The thick and powerful body is neatly adapted for moving around under the sand, with fused neck bones (vertebrae) for greater rigidity, a horny shield on the nose (2), and oversized flat claws on the third and fourth digits of the short forelimbs for digging (6). The southern marsupial mole spends much of its time in the dark under the sand and many of its features reflect this. The pouch opens to the rear to prevent sand entering during burrowing, the eyes are vestigial, the ear openings are well hidden under the fur and the nostrils are small and slit-like (5). The fur is silky and iridescent, with a creamy to dark gold colour (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Itjaritjari, or Southern Marsupial Mole, is known from the central deserts of the Northern Territory, Western Australia, South Australia, Australia. Both it and Notoryctes caurinus have been recorded in the vicinity of Warburton and may be sympatric there (Benshemesh 2004). All specimens north of Warburton and west of the Northern Territory border have been identified as N. caurinus. In addition, both species may be found in the Tanami Desert, however, this is unclear (Benshemesh 2004). Recent technique of cutting trenches in sand dunes to reveal burrows has extended the known distribution into the Simpson Desert.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Southern marsupial moles (Notoryctes typhlops) inhabit central Australian deserts along the borders of South Australia, West Australia, and Northern Territory.

Biogeographic Regions: australian (Native )

  • Nowak, R. 1999. Walker's Mammals Of The World. Baltimore: Johns Hopkins University Press.
  • Northern Territory Government Department of Naturan Resources, Environment and the Arts. Southern Marsupial Mole- Itjaritjari. Australia: Australian Government. 2006. Accessed March 31, 2011 at http://www.nt.gov.au/nreta/wildlife/animals/threatened/pdf/mammals/southern_marsupial_mole_vu.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The southern marsupial mole is found in the central deserts of southern Northern Territory, northern and east-central Western Australia and western South Australia (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Southern marsupial moles range from 13 to 15.5 cm in total length, with masses ranging from 30 to 60 g. Their short tail ranges from 2 to 2.5 cm in length. Sexual dimorphism has not been reported in this species. Their fur grows in bunches and is silky and short. Fur color varies regionally across their geographic range from creamy white to reddish brown, perhaps because the fur picks up colors from the soil in which the animals burrow.

Notoryctes typhlops lacks eyes and an optic nerve; only small black vestigial buds beneath the surface of the skin remain of the eyes. No external ears or ear pinnae exist and each external auditory meatus consists of a small hole surrounded by a dense covering of fur. Nostrils are reduced to tiny vertical slits and are located directly below the horny, keratinous shield that overlies the rostrum. Limbs are short with digits three and four having large, flattened, shovel-like claws. Both males and females have a backwards facing pouch, and that of females is better developed and contains two nipples. Dental formulas appear to vary among individuals as MacDonald (2009) lists the dental formula as I4/3, C1/1, P2/3, M4/4=44, whereas Benshemesh and Johnson (2003) report a dental formula of I4/4, C1/1, P3/3, M4/4=48. Their teeth are poorly rooted with incisors, canines and premolars being blunt. Upper molars are more developed and zalambdodont.

Range mass: 30 to 60 g.

Range length: 13 to 14.5 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • MacDonald, D. 2009. The Encyclopedia of Mammals. Oxford: Oxford University Press.
  • Benshemesh, J., K. Johnson. 2003. Biology and conservation of marsupial moles (notoryctes). Pp. 464-474 in M Jones, C Dickman, M Archer, eds. Predators with pouches : the biology of carnivorous marsupials. Collingwood, VIC: CSIRO Publishing.
  • Howe, D. 1975. Observations on a captive marsupial mole, Notoryctes typhlops. Australian Mammalogy, 1/4: 361-365.
  • Strahan, R. 1995. The mammals of Australia. Chatswood, N.S.W: Reed Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a fossorial species; it burrows within sand dunes, interdunal flats, and in sandy soils along river flats. It occasionally emerges onto the surface, especially after rain (Maxwell et al. 1996). The species remains largely underground. This species is not able to travel large distances across hard ground, thus continuous areas of suitable habitat are likely important (Benshemesh 2004). The diet of this species consists primarily of ants (and their eggs) and termites (Langford and Pavey 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Precise habitat preferences of southern marsupial moles is not well defined, as most records and sightings are scattered or based on second-hand Aboriginal accounts. They inhabit temperate deserts and are most commonly found burrowing in sandy dunes that have dense vegetation. These animals seek out habitats with abundant shrubs and grasses, including sandy plains and old river flats. They prefer areas of soft sand and are unable to cross hard-packed sand or loamy soil.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune

  • Northern Territory Department of Infrastructure, Planning and Environment. National recovery plan for marsupial moles (Notoryctes typhlops and N. caurinus), 2005–2010. Alice Springs NT, Australia: Australian Government. 2004. Accessed March 13, 2011 at http://www.environment.gov.au/biodiversity/threatened/publications/pubs/marsupial-moles.pdf.
  • Corbett, L. 1975. Geographical distribution and habitat of the Marsupial Mole, Notoryctes typhlops. Australian Mammalogy, 1: 375-378.
  • Johnson, K., D. Walton. 1989. Fauna of Australia Volume 1B. Australia: AGPS Canberra. Accessed March 31, 2011 at http://www.environment.gov.au/biodiversity/abrs/publications/fauna-of-australia/pubs/volume1b/23-ind.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This species inhabits sand dunes and sandy soils along rivers (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Notoryctes typhlops is an insectivore. Based on gut contents, preferred forage consists of ants and ant eggs from the genus Iridomyrmex and the subfamily Myrmeciinae. Ants belonging to Rhytidoponera and Camponotus are also consumed. Termites, burrowing sawfly larvae, and several species of nematode are occasionally found in the gut contents of N. typhlops along with small reptiles and seeds. It has been suggested that seeds are only consumed as a result of feeding in underground ant nests. In captivity, eggs, earthworms, ant pupae, fly larvae, and beetle larvae have been used with limited success to feed these animals.

Southern marsupial moles are not well adapted for feeding on larger prey items, which are difficult for them to manipulate with their shovel-like claws. Small larvae are held down with the forelimbs, and some prey items are squeezed with the forelimbs before being eaten, presumably to make them softer. Larger prey are either lapped up or not consumed. Above-ground feeding has been observed, however, prey is often taken underground to be eaten.

Animal Foods: reptiles; insects

Plant Foods: seeds, grains, and nuts

Primary Diet: carnivore (Insectivore )

  • Winkel, K., I. Humphrey-Smith. 1988. Diet of the marsupial mole, Notoryctes typhlops (Stirling 1889) (Marsupialia: Notoryctidae). Australian Mammalogy, 11: 159-161. Accessed March 14, 2011 at http://books.google.com/books?id=WI3v4E_Xb-AC&pg=PA159&lpg=PA159&dq=%22Diet+of+the+Marsupial+Mole,+Notoryctes+typhlops+%28Stirling+1889%29+%28Marsupialia:+Notoryctidae%29&source=bl&ots=6N6nLFLhV-&sig=Ju0T9ZXpxQMqcCGlMwLttUSKCHw&hl=en&ei=nZ19TeHfLqrk0gHG4rzyAw&sa=X&oi=book_result&ct=result&resnum=5&ved=0CDkQ6AEwBA#v=onepage&q=%22Diet%20of%20the%20Marsupial%20Mole%2C%20Notoryctes%20typhlops%20%28Stirling%201889%29%20%28Marsupialia%3A%20Notoryctidae%29&f=false.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Southern marsupial moles are insectivores and may help control insect pest populations. They also aerate the soil adn increase water penetration by burrowing. It is unlikely that they are a significant prey item for other species as their remains have been found in only a small percentage of predator scat. Southern marsupial moles are host to nematode parasites in the superfamily Trichostrongyloidea.

Ecosystem Impact: soil aeration

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

No direct observations of predation on Notoryctes typhlops have been made. N. typhlops remains have been found in fecal pellets of feral cats, dingoes, and the introduced red fox. Its fossorial lifestyle likely helps them significantly reduce risk of predation. When on the surface, N. typhlops are particularly susceptible to predation by birds and snakes. The ability to absorb various colors in the soil in which they burrow likely helps camouflage them from potential predators when above ground.

Known Predators:

  • Paltridge, R. 1998. Occurrence of marsupial mole (Notoryctes typhlops) remains in the faecal pellets of cats, foxes and dingoes in the Tanami Desert. Australian Mammalogy, 20: 427-429.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Very little is known about communication in southern marsupial moles. In captivity, they have been observed making sharp squeaking sounds when held or when feeding was interrupted. Their brain is considered to be extremely simple and primitive, however, their olfactory bulbs are large and well developed, suggesting that communication and perception are primarily through olfaction.

Communication Channels: tactile ; acoustic ; chemical

Perception Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Very little in known about the lifespan of Notoryctes typhlops in the wild. Based on two records of southern marsupial moles kept in captivity, 1 animal survived for 10 weeks and the other for approximately 1 month. Both specimens may have died due to exposure to cold temperatures.

Range lifespan

Status: captivity:
2.5 (high) months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about longevity in these animals but they are expected to live at least 1.5 years in the wild (Bernhard Grzimek 1990).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is no information available regarding the mating system of southern marsupial moles.

Very little is known about reproduction in Notoryctes typhlops, as there have been no observations of reproductive behavior made in the field or in captivity. Aboriginal people claim to have never seen N. typhlops young and do not know any information about the reproduction of this species. Gestation, weaning, and age of maturity are unknown. Based on several pregnant female specimens, breeding season may take place in November. The number of young produced is not well known; however, there are examples of specimens with one or two young in their pouch.

Breeding interval: The breeding interval is not known.

Breeding season: Precise breeding season is unknown, however, pregnant females have been found in November.

Average number of offspring: 2.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); viviparous

There is no information available regarding parental care in Notoryctes typhlops.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Northern Territory Department of Infrastructure, Planning and Environment. National recovery plan for marsupial moles (Notoryctes typhlops and N. caurinus), 2005–2010. Alice Springs NT, Australia: Australian Government. 2004. Accessed March 13, 2011 at http://www.environment.gov.au/biodiversity/threatened/publications/pubs/marsupial-moles.pdf.
  • Fuller, P. 1988. Aboriginal knowledge of the mammals of the centeral deserts of Australia. Australian Wildlife Research, 15/1: 9 -39.
  • Johnson, K., D. Walton. 1989. Fauna of Australia Volume 1B. Australia: AGPS Canberra. Accessed March 31, 2011 at http://www.environment.gov.au/biodiversity/abrs/publications/fauna-of-australia/pubs/volume1b/23-ind.pdf.
  • Sterling, E. 1891. Further notes on the habits and anatomy of Notoryctes typhlops. Transactions of the Royal Society of South Australia, 14: 283–291. Accessed March 31, 2011 at http://www.samuseum.sa.gov.au/Journals/TRSSA/TRSSA_V014/TRSSA_V014_p283p991.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Notoryctes typhlops

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0142-06|AJ639874|Notoryctes typhlops| AACCGCTGATTATTCTCAACAAACCACAAAGACATTGGCACCTTGTACTTACTATTTGGAGCTTGAGCAGGAATAGTAGGCACTGCCCTA---AGCTTGCTAATCCGAGCAGAATTAGGTCAACCTGGAACTCTTATCGGAGAC---GACCAAATTTATAATGTAATCGTGACAGCACACGCCTTTGTAATAATCTTTTTTATAGTTATACCTATTATAATTGGGGGCTTTGGCAACTGACTGATCCCATTAATA---ATTGGAGCACCTGACATAGCCTTTCCACGAATAAACAATATAAGCTTCTGACTCCTTCCCCCTTCTTTTTTACTTCTCCTAGCCTCCTCAACCGTTGAAGCAGGTGCTGGCACTGGATGAACAGTCTACCCACCCTTAGCAGGGAACTTAGCCCATGCAGGAGCCTCCGTAGATTTA---GCAATCTTTTCGCTACACCTAGCAGGTGTATCCTCCATCCTAGGTGCTATTAACTTTATCACAACAATTATCAACATAAAACCACCAGCTATATCACAATATCAGACACCCCTGTTTGTTTGATCAGTCCTAATTACAGCCGTCCTCCTTCTCCTCTCCCTTCCTGTTTTAGCAGCT---GGAATTACAATACTATTAACAGACCGAAACCTAAATACTACATTTTTTGACCCAGCAGGTGGAGGAGACCCAATCCTCTACCAACATCTCTTCTGATTCTTTGGTCACCCTGAAGTATATATTTTAATCCTCCCTGGTTTCGGGATTATTTCTCATATCGTAACGTACTATTCTGGCAAAAAA---GAACCCTTTGGTTATATAGGCATAGTATGAGCCATAATATCTATTGGCTTCCTAGGTTTCATCGTATGAGCCCACCATATATTTACAGTTGGTCTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Notoryctes typhlops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Dickman, C., Burbidge, A., Aplin, K. & Benshemesh, J.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Data Deficient because, although it has been recorded over a relatively wide area little is known about its population numbers and threats.

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The ICUN Red List of Threatened Species classifies Notoryctes typhlops as data deficient; however, the Australian government lists it as endangered. Notoryctes typhlops faces many threats including increased predation by the red fox as well as other human-induced factors. Changed fire regimens and increased cattle farming cause declines in native plant populations, leading to reduced invertebrate populations. This limits the amount of food available for N. typhlops. The increasing presence of roads and railways is believed to limit the dispersal of southern marsupial moles. Conservation research has been ongoing since 1999 and aims to collaborate with aboriginal people and biologists to focus on gaining a better understanding of the ecology of this species.

IUCN Red List of Threatened Species: data deficient

  • Dickman, C., A. Burbidge, K. Aplin, J. Benshemesh. 2010. "Notoryctes typhlops" (On-line). IUCN Red List of Threatened Species. Accessed March 31, 2011 at http://www.iucnredlist.org/apps/redlist/details/14879/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The southern marsupial mole is listed as Endangered (EN) on the IUCN Red List 2004 (1) and is protected under the Commonwealth's Endangered Species Protection Act 1992 (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Population estimates are not available at this time, although populations are being investigated, and in most areas they do not appear to be especially sparse. They do appear to be confined to large and continuous dunefields (J. Benshemesh pers. comm.). There are new techniques that allow for easier collection of data on this species, and possibly N. caurinus as well (Benshemesh 2008; J. Benshemesh pers. comm.).

Langford and Pavey (2002) claim that the population of this species is less than 10,000 individuals, and that there is an estimated continuing decline of at least 10% within 10 years. Both Pearson and Turner (2000) and Benshemesh (2004) have questioned any decline.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Little is known about major threats to this species. It is an arid zone Critical Weight Range species (Burbidge and McKenzie 1989); around 90% of such taxa have either become extinct or have declined seriously in range and/or abundance. Operating threatening processes may include predation by foxes (which are capable of taking animals on or near the surface) and feral cats (Benshemesh 2008). It may be hunted by dingoes (there is evidence of presence in fox and dingo scat). In the past, the species was hunted by Aboriginal people. Other potential threats to this species include changed fire regimes, and habitat changes caused by the trampling of cattle and camels (Benshemesh 2004). Climate change may also be a threat to this species in the future, as projected changes in rainfall and temperature would cause changes in biota (Benshemesh 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

In the early 1900s, several thousand southern marsupial mole pelts were traded by Aboriginal people to Europeans. Little is known of the threats to the southern marsupialmole but the most obvious threat is predation by feral cats, foxes and dingoes. It is also thought that altered fire and grazing regimes have changed the abundance of prey (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in Watarrka National Park and Uluru Kata Tjuta National Park (Langford and Pavey 2002).

The Recovery Plan Objectives and Actions for this species are (Benshemesh 2004): 1) Resolve taxonomic issues; 2) Describe the distribution, abundance, and lineages; 3) Determine population trends; 4) Provide preliminary information on threat of fire, introduced predators (foxes and cats), and grazing; 5) Describe activity patterns and behaviour; 6) Obtain ecological information from Aboriginal elders; 7) Examine diet, reproduction, and general condition of surfacing animals; 8) Prepare for captive individuals brought to Desert Park; 9) Manage the recovery process with a recovery team; 10) Downlist species from endangered to a lower category of threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Scientists are working with Aboriginal people to find and study southern marsupial moles in the Northern Territory and South Australia (4) as conservation work to prevent further decline of this species depends on a greater understanding of the ecology and threats to the southern marsupial mole.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Notoryctes typhlops on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Notoryctes typhlops is rarely used as a source of food by aboriginals. Historically pelts were traded and sold for a significant amount of money, however, this rarely occurs today. Notoryctes typhlops is primarily found in areas where few humans are present, thus their potential importance to humans is limited.

Positive Impacts: food ; body parts are source of valuable material

  • 2009. "Southern Marsupial Mole (Notoryctes typhlops)" (On-line). Accessed March 14, 2011 at http://www.environment.gov.au/biodiversity/threatened/publications/south-mole.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern Marsupial Mole

The Southern Marsupial Mole (Notoryctes typhlops) is a mole-like marsupial found in the desert of southwest Australia. It is extremely adapted to a burrowing way of life. It has large, shovel-like forepaws and silky fur, which helps it move easily. The Southern Marsupial Mole also lacks complete eyes as it has little need for them. It feeds on earthworms and larvae.[3]

Contents

History of discovery

Although the Southern Marsupial Mole was probably known by aborigines for thousands of years, the first specimen examined by the scientific community was collected in 1888. Stockman W. Coulthard made the discovery on Idracowra Pastoral Lease in the Northern Territory by following some unusual prints that lead him to the animal lying under a tussock.[4] Not knowing what to do with the strange creature, he wrapped it in a kerosene soaked rag, placed it in a revolver cartridge box and forwarded it to E.C. Stirling, the Director of the South Australian Museum. Due to the poor transportation conditions of the time, the specimen reached its destination in a badly decomposed state. Hence, Stirling was unable to find any evidence of the pouch or epipubic bones and decided the creature was not a marsupial.[5]

19th century scientists believed that marsupials and eutherians had evolved from the same primitive ancestor and were looking for a living specimen that would act as the missing link. Because the marsupial mole closely resembled the golden moles of Africa, some scientists concluded that the two were related and that they had found the proof. This is of course not the case, as it became obvious by examining better preserved specimens that had a marsupial pouch.[5]

Taxonomy and phylogeny

Although the Notoryctidae family is poorly represented in the fossil record there is evidence of at least one distinct genus Yalkaparidon, in the early Miocene sediments in the Riversleigh deposit in northern Australia.[6]

Due to their highly specialized morphology and the fact that notoryctids share many common characteristics with other marsupials, there has been much debate surrounding their phylogeny. However, recent molecular studies indicate that notoryctids are not closely related to any of the other marsupial families and should be placed in an order of their own, Notoryctemorphia.[7][8]

Furthermore, molecular data suggests that Notoryctemorphia separated from other marsupials around 64 million years ago.[9] Although at this time South America, Antarctica and Australia were still joined the order evolved in Australia for at least 40-50 million. The Riversleigh fossil material suggests that Notoryctes was already well adapted for burrowing and probably lived in the rainforest that covered much of Australia at that time. The increase in aridity at the end of Tertiary was likely one of the key contributing factors to the development of the current highly specialized form of marsupial mole.[4] The marsupial mole had been burrowing long before the Australian deserts came into being.[10]

Morphology

The Southern Marsupial Mole is small in size, with a head and body length varying from 121 to 159 mm, a tail length of 21–26 mm and a weight of 40-70 g. The body is covered with short, dense, silky fur with a pale cream to white color often tinted by the iron oxides from the soil which gives it a reddish chestnut brown tint. It has a light brownish pink nose and mouth and no vibrissae.[11]

The cone shaped head merges directly with the body, and there is no obvious neck region. The limbs are short and powerful, and digits III and IV of the manus have large spade-like claws. The dentition varies with individuals and, because the molars have a root of only one third of the length, it has been assumed that moles cannot deal with hard food substances.[4] The dorsal surface of the rostrum and the back of the tail have no fur and the skin is heavily keratinized. There is no external evidence of the eyes, and the optic nerve is absent. It does have however a pigment layer where the eyes should be, probably a vestige of the retina. Both lachrymal glands and Jacobson's organ are well developed, and it has been suggested that the former plays a role in lubricating the nasal passages and Jacobson's organ.

The external ear openings are covered with fur and do not have a pinnae. The nostrils are small vertical slits right below the shield-like rostrum. Although the brain has been regarded as very primitive and represents the "lowliest marsupial brain", the olfactory bulbs and the rubercula olfactoria are very well developed. This seems to suggest that the olfactory sense plays an important role in the marsupial moles' life, as it would be expected for a creature living in an environment lacking visual stimuli. The middle ear seems to be adapted for the reception of low-frequency sounds.[11]

Adaptations

The Southern Marsupial Mole resembles the Namib Desert Golden Mole and other specialized fossorial animals in having a low and unstable body temperature, ranging between 15-30°C. It does not have an unusually low resting metabolic rate, and the metabolic rate of burrowing is 60 times higher than that of walking or running. Because it lives underground, where the temperature is considerably lower than at the surface, the Southern Marsupial Mole does not seem to have any special adaptations to desert life. It is not known whether it drinks water or not, but due to the infrequence of rain it is assumed that it does not.[10]

Habitat and distribution

The habitat of the Southern Marsupial Mole is not well known, and is generally based on scattered records. It has been often recorded in sandy dunes or flats, usually where spinifex is present. Its habitat seems to be restricted to areas where the sand is soft, as it cannot tunnel through harder materials.[4] Although little is known about its exact distribution, sightings, aboriginal informants and museum records indicate that it lives in the central sandy desert regions of Western Australia, northern South Australia and the Northern Territory.[12] Recent studies indicate that its habitat also includes Great Victoria and Gibson Deserts.[13]

Behavior

Due to the lack of any field studies regarding the marsupial moles, there is little known about their behavior. Observations of captive animals are limited since most of the moles do not survive more than a little over a month after capture.

Surface behavior

It sometimes wanders above the surface where traces of several animals have been found. While most evidence indicates that it does this seldom and moves just a few meters before burrowing back underground, on some occasions multiple tracks were found suggesting that one or more animals have moved above ground for several hours. According to Aboriginal sources, marsupial moles may surface at any time of day, but seem to prefer to do so after rain and in the cooler season.[4]

Captive animals have been observed to feed above ground and then return underground to sleep. Occasionally it has been recorded to suddenly "faint" on the surface without waking up for several hours until disturbed.[14]

Above the ground it moves in a sinuous fashion, using its powerful forelimbs to haul the body over the surface and its hind limbs to push forward. The forelimbs are extended forward in unison with the opposite hind limb. Moles move about the surface with frantic haste but little speed, as one observer once likened it to a "Volkswagen Beetle heaving its way through the sand".[5]

Burrowing behavior

While burrowing, the Southern Marsupial Mole does not make permanent tunnels, but the sand caves in and tunnels back-fill as the animal moves along. For this reason its burrowing style has been compared to "swimming through the sand”". The only way its tunnels can be identified is as a small oval shape of lose sand. Although it spends most of its active time 20-100 cm below the surface, tunneling horizontally or at shallow angles, it sometimes for no apparent reason turns suddenly and burrows vertically to depths of up to 2.5 meters.[15]

Although most food sources are likely to occur at depths of approximately 50 cm from the surface, the temperature of these environments varies greatly from less than 15°C during winter to over 35°C during summer. While one of the captive moles was observed shivering when the temperature dropped under 16°C, it seems probable that moles can select the temperature of their environment by burrowing at different depths.[4]

Diet

Little is known about the Southern Marsupial Mole's diet, and all information is based on the gut content of preserved animals and on observations made on captive specimens. All evidence seems to suggest that the mole is mainly insectivorous, preferring insect eggs, larvae and pupae to the adults.[16] Based on observations made on captive animals, it seems that one of the favorite food choices was beetle larvae, especially Scarabaeidae.[14] Because burrowing requires high energy expenditure it seems unlikely that the mole searches for its food in this prey impoverished environment, and suggests that it probably feeds within nests. It has been also recorded to eat adult insects, seeds and lizards. Below the desert sands of Australia, the marsupial mole searches for burrowing insects and small reptiles. Instead of building a tunnel, it "swims" through the ground, allowing the sand to collapse behind it.[4]

Social behavior

There is little known about the social and reproductive behavior of these animals, but all evidence seems to suggest that it leads a solitary life. There are no traces of large burrows where more than one individual might meet and communicate. Although it is not known how the male locates the female, it is assumed that they do so using their highly developed olfactory sense.[11]

The fact that the middle ear seems to be morphologically suited for capturing low frequency sounds, and that moles produce high pitched vocalizations when handled, indicates that this kind of sound that propagates more easily underground may be used as a form of communication.[4]

Human interactions

The Southern Marsupial Mole was known for thousands of years to the aborigines and was part of their mythology. It was associated with certain sites and dreaming trails such as Uluru and the Anangu-Pitjantjatjara Lands. Aborigines regarded the creature with sympathy, probably due to its harmless nature, and it was only eaten in hard times. Aboriginal people have good tracking skills and generally cooperate with researchers in teaching them these skills and help finding specimens. Their involvement is instrumental in gathering information about the species’ habitat and behavior.[4]

Historical records suggest that the Southern Marsupial Mole was relatively common in the late 19th century and early 20th century. There was a large trade in marsupial mole skins in the Flike River region between 1900 and 1920. Large numbers of aborigines arrived at the trading post with 5-6 pelts each for sale to trade for food and other commodities. It is estimated that hundreds to several thousand skins were traded at these meetings, and that at the time the mole was relatively common.[5]

Conservation status

So little is known about the Southern Marsupial Mole that it is difficult to assess its exact distribution and how it varied over the last decades. However circumstantial evidence suggests that their numbers are dwindling. Although the decreasing acquisition rate is difficult to interpret due to the chance nature of the findings, there are reasons for concern. About 90% of medium sized marsupials in arid Australia have become threatened due to cat and fox predation. A recent study indicates that remains of marsupial moles have been found in 5% of the cats and foxes faecal pellets examined.[17] Moles are also sensitive to changes in the availability of their food caused by changing fire regimes and the impact of herbivores. The Southern Marsupial Mole is currently listed as endangered by the IUCN.[2] Efforts to protect this unique species focus on advocating for maintaining a healthy population of moles to better understand their biology and behavior, and for conducting field studies to monitor the species distribution and abundance with the help of Aborigines.[4]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 22. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b Dickman, C., Burbidge, A., Aplin, K. & Benshemesh, J. (2008). Notoryctes typhlops. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is data deficient
  3. ^ Whitfield, Philip (1998). The Simon & Schuster Encyclopedia of Animals. New York: Marshall Editions Development Limited. pp. 25. 
  4. ^ a b c d e f g h i j Benshemesh, John; Johnson, Ken (2003). Jones, Menna; Dickman, Chris; Archer, Mike. ed. Predators with pouches : the biology of carnivorous marsupials. Melbourne: CSIRO Publishing. pp. 464–474. 
  5. ^ a b c d Johnson, Ken (1991). "The mole who comes from the sun". Wildlife Australia Spring: 8–9. 
  6. ^ Gott, M. (1988). "A Tertiary marsupial mole (Marsupialia: Notoryctidae) from Riversleigh, northeastern Australia and its bearings on notoryctemorphian phylogenetics". Honours Thesis, University of Sydney, NSW. 
  7. ^ Calaby, J.H.; Corbett, LK; Sharman, GB; Johnston, PG (1974). "The Chromosomes and Systematic Position of the Marsupial Mole, Notoryctes typhlops". Australian Journal of Biological Sciences 27 (5): 529–32. PMID 4447497. 
  8. ^ Westerman, M. (1991). "Phylogenetic Relationships of the Marsupial Mole, Notoryctes typhlops (Marsupialia: Notoryctidae)". Australian Journal of Zoology 39 (5): 529–37. doi:10.1071/ZO9910529. 
  9. ^ Kirsch, J,A.W.; Springer, Mark S.; Lapointe, François-Joseph (1997). "DNA-hybridization studies of marsupials and their implications for metatherian classification". Australian Journal of Zoology 45 (3): 211–80. doi:10.1071/ZO96030. 
  10. ^ a b Thompson, Graham (2000). "Blind Diggers in the Desert". Nature Australia 26: 26–31. 
  11. ^ a b c Johnson, Ken; Walton, Dan (1987). D.W. Walton. ed. Fauna of Australia v 1B Mammalia. Canberra: Australian Government Publishing Service. pp. 591–603. 
  12. ^ "Facts Sheet - Southern Marsupial Mole". Department of the Environment, Water, Heritage and the Arts. http://www.environment.gov.au/biodiversity/threatened/publications/south-mole.html. Retrieved 2009-05-01. 
  13. ^ Pearson, David (2000). "Marsupial Moles pop up in the Great Victoria and Gibson Deserts". Australian Mammology 22: 115–119. 
  14. ^ a b Howe, D. (1973). "Observations on a captive marsupial mole, Notoryctes typhlops". Australian Mammalogy 1 (4): 361–65. 
  15. ^ K.A. Johnson (1998). Ronald Strahan. ed. The mammals of Australia. Sydney: New Holland Publishers Pty Ltd. pp. 409–11. 
  16. ^ Winkel, K. (1988). "Diet of the Marsupial Mole, Notoryctes typhlops (Stirling 1889) (Marsupialia: Notoryctidae)". Australian Mammology 11: 169–161. 
  17. ^ Paltridge, Rachel (1999). "Occurrence of the Marsupial Mole (Notoryctes typhlops) remains in the faecal pellets of cats, foxes and dingoes in the Tanami Desert, N.T". Australian Mammalogy 20: 427–9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!