Overview

Distribution

Range Description

This species is largely restricted to the Vogelkop Peninsula region of Papua Province, Indonesia. It has also been recorded from the island of Salawati, Indonesia (possibly now extinct there), and it is possible that the species may be present on the islands of Batanta and Waigeo (both Indonesia, but not mapped) (Flannery 1995a,b; Helgen 2007). It ranges from near sea level to 2,500 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The long-nosed echidna is endemic to New Guinea (Gregory, 1997).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As monotremes, the long-nosed echidnas possess one body cavity for the external openings of their urinary, digestive, and reproductive organs. The species has a very short tail relative to its average body length of 450-775 mm. The core body is covered in course brown or black hair that often hides the spines covering the back. Zaglossus has a pronounced downcurved snout, which accounts for two-thirds of the length of its head. Lack of teeth in the species is compensated by rows of spikes/horny teeth-like projections on the enormous tongues of the animals. Long-nosed echidnas generally have clawed feet, the front ones important in digging for food. Within the species there is variation in the number of clawed digits on each foot. Many have claws only on the middle three of the five digits present; others have claws on each digit. The males of the species can be distinguished from the females by the presence of a spur on the inner surface of each hind leg near the foot. (Augee, 1993; Gregory, 1997; Griffiths, 1968; Walker, 1991).

Range mass: 5 to 16.5 kg.

Average basal metabolic rate: 6.493 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species ranges from tropical hill forests to upper montane forests. It has a large altitudinal range. This species lays eggs and the primary food is worms.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Long-nosed echidnas primarily inhabitate mountain forests, although some live on highly elevated alpine meadows. The species does not live along the coastal plains (Augee, 1993; Walker, 1991).

Terrestrial Biomes: rainforest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of Zaglossus bruijni consists almost exclusively of earthworms. When earthworms are eaten, they are positioned by the echidna to go front first into the snout. The powerful tongue of the long-nosed echidna protrudes a small distance and wraps around the front of the worm. While the worm is pulled into the mouth, the echidna's tongue holds the worm in place with its spikes. Termites and other insect larvae are also eaten, they may eat ants.

(Augee, 1993; Walker, 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
31.0 years.

Average lifespan

Status: captivity:
30.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 41.2 years (captivity) Observations: One captive specimen at the Toronga Zoo in Sydney was still alive at 41.2 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Little is known about reproduction in Zaglossus, although they are believed to be similar in reproductive pattern to their sister species, the short-nosed echidna (Tachyglossus aculeatus). Frequency of breeding, courtship rituals, and possible male parental care are unknown for both echidna species. It is thought that the breeding season for the long-nosed echidna is in July. A captive Z. bruijni specimen lived for a record 30 years and 8 months.

(Gregory, 1997; Walker, 1991).

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Zaglossus bruijni

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0133-06|AJ639865|Zaglossus bruijni| AATCGCTGACTGTTTTCAACTAATCATAAAGATATCGGTACCCTTTATCTTCTATTCGGTGCATGAGCTGGTATAGCCCGCACAGCCCTT---AGTATTCTCATTCGATCCGAATTAGGCCAACCAGGCTCCCTCTTGGGTGAT---GATCAAATTTATAATGTTATCGTCACAGCCCATGCATTTGTTATAATTTTTTTCATAGTTATGCCAATCATAATCGGGGGATTTGGTAATTGATTGGTCCCCCTAATA---ATTGGGGCCCCAGATATAGCATTCCCACGAATAAACAATATGAGTTTCTGGCTTTTACCCCCTTCATTTCTCCTACTCCTGGTTTCCTCCACAGTAGAAGCAGGCGCAGGGACTGGTTGAACCGTTTATCCACCCCTAGCAGGCAACCTAGCCCATGCTGGAGCCTCAGTAGACCTG---GCTATTTTTTCCCTTCACTTGGCTGGAGTTTCCTCTATCCTAGGGGCTATTAATTTTATCACCACAATCATTAACATGAAACCTCCTGCAATATCCCAATATCAAACGCCCTTATTCGTCTGATCAGTATTAGTCACAGCTGTCCTACTCCTTCTATCACTCCCCGTCCTTGCAGCA---GGCATTACTATACTTCTCACTGACCGAAACCTTAATACAACTTTCTTCGACCCGGCAGGAGGTGGAGATCCTATTTTATATCAACACCTATTCTGATTTTTTGGACACCCTGAGGTCTATATCTTGATCTTACCAGGCTTTGGAATTATCTCCCATATCGTTACTTACTATTCAGGAAAAAAA---GAACCATTCGGGTATATAGGAATAGTTTGAGCTATAATATCCATCGGGTTTTTAGGCTTCATCGTTTGGGCTCACCACATATTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Zaglossus bruijni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2acd

Version
3.1

Year Assessed
2008

Assessor/s
Leary, T., Seri, L., Flannery, T., Wright, D., Hamilton, S., Helgen, K., Singadan, R., Menzies, J., Allison, A., James, R., Aplin, K., Salas, L. & Dickman, C.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Critically Endangered due to a suspected continuing population decline of at least 80% over the last three generations (i.e., the last 45-50 years) based on direct observation in parts of its range, declines in area of occupancy (reports from hunters), and actual levels of exploitation due to hunting.

History
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Listed in appendix II of CITES, Z. bruijni is categorized as vulnerable by IUCN. Hunting with trained dogs by the New Guinean people as well as loss of natural forest habitat due to farming are the primary causes for the species' endangerment. Data tabulated in 1982 indicated that only 1.6 Zaglossus existed per square kilometer of suitable habitat. If the data were accurate, about 300,000 long-nosed echidnas were in existence then, and the number has dropped since that time (Walker, 1991).

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species has not been recorded since the 1980s. It is thought to be uncommon in forest habitats that are accessible to hunting. It may be more common in inaccessible areas. The species has been hunted to local extinction in more densely populated regions of New Guinea.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
It is heavily threatened by hunting for food by local people, and also by loss of habitat through conversion of suitable areas to cultivated land. It has retreated up the mountains over time, and the montane habitat for this species is now small and isolated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix II of CITES. It has been recorded from a national park. Hunting regulations are needed to protect this species. Further field studies to identify important areas for this species are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Long-nosed echidnas can destroy gardens with their burrowing. In fact, this is seldom a problem. (Gregory, 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The meat of Zaglossus is a popular food source in New Guinea (Augee, 1993; Walker, 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western long-beaked echidna

The western long-beaked echidna (Zaglossus bruijni) is one of the four extant echidnas and one of three species of Zaglossus that occur in New Guinea. As Tachyglossus bruijni, this is the type species of Zaglossus.

The western long-beaked echidna is present in New Guinea, in regions of elevation between 1,300 and 4,000 metres (4,300 and 13,000 ft); it is absent from the southern lowlands and north coast. Its preferred habitats are alpine meadow and humid montane forests. Unlike the short-beaked echidna, which eats ants and termites, the long-beaked species eats earthworms. The long-beaked echidna is also larger than the short-beaked species, reaching up to 16.5 kilograms (36 lb); the snout is longer and turns downward; and the spines are almost indistinguishable from the long fur. It is distinguished from the other Zaglossus species by the number of claws on the fore and hind feet: three (rarely four). It is the largest extant monotreme[3].

The species is listed as endangered by the IUCN; numbers have decreased due to human activities reducing habitat and hunting. The long-beaked echidna is a delicacy, and although commercial hunting of the species has been banned by the Indonesian and Papua New Guinean governments, traditional hunting is permitted.

In February 2006, an expedition led by Conservation International reported finding a population of the mammals as part of what they described as a "lost world" of wildlife in the Foja Mountains of Papua Province, Indonesia.[4]

References

  1. ^ Groves, Colin P. (16 November 2005). "Order Monotremata (pp. 1-2)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 2. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10300017. 
  2. ^ Leary, T., Seri, L., Flannery, T., Wright, D., Hamilton, S., Helgen, K., Singadan, R., Menzies, J., Allison, A., James, R., Aplin, K., Salas, L. & Dickman, C. (2008). Zaglossus bruijnii. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as critically endangered
  3. ^ <http://rarestzoo.blogspot.com/2006/07/long-beaked-echidna.html>
  4. ^ ‘Lost World’ of wildlife found - World environment - MSNBC.com

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!