Overview

Brief Summary

Biology

Individuals of this solitary-living species only come together to mate, during which a 'train' of several males may follow a single female hoping to mate with her (2) (4). The short-beaked echidna is one of a small group of egg-laying mammals known as monotremes (2). About three weeks after mating, a single leathery-skinned egg is laid into a pouch on the female's abdomen, which is then incubated for a further ten days before it hatches (5) (6). After hatching, the young remain in their mother's pouch until they are around 45 to 55 days old, after which time they are left in a burrow while the mother is foraging (5) (6). Juveniles continue to suckle until they are weaned at about six months old, at which time they are fully independent (5) (6). Echidnas both in the wild and in captivity have been known to live up to 50 years (6). During the warmer months, echidnas tend to be nocturnal and to avoid the heat. At higher elevations, in more temperate areas, and during winter they are more diurnal, foraging around dusk or during the day (1) (4). The short-beaked echidna's diet consists of a large variety of invertebrates, including ants, beetles, spiders, worms, insect eggs and termites, which are lapped up with the long, mobile tongue (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Despite its name, this spine-covered animal has a relatively elongate, slender snout (3) (4). The spines are usually yellow with black tips but can be entirely yellow (3), and provide excellent defence against predators (4). Insulation is provided by a covering of fur between the spines, which ranges in colour from honey to a dark reddish-brown and even black. This fur is thicker and longer in the Tasmanian subspecies (T. a. setosus) than in those of the warmer mainland areas, often covering the spines almost completely. This echidna is adapted for very rapid digging, having short limbs and powerful claws, with the hind claws elongated and curved backwards (4). All short-beaked echidnas possess spurs on their hind feet (5), however, unlike the platypus (another monotreme), these spurs lack venom (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widespread in Australia, including Tasmania and a number of offshore islands, and also occurs in south-eastern New Guinea (Indonesia and Papua New Guinea) and the Markham valley. The subspecies Tachyglossus aculeatus multiaculeatus is endemic to Kangaroo Island, South Australia (Maxwell et al. 1996). The species has an altitudinal range of sea level to 1,675 m asl (New Guinea) and up to the highest peak in Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tachyglossus aculeatus is the most widely distributed extant monotreme. Subspecies of T. aculeatus are distributed throughout southern and eastern New Guinea, mainland Australia, Kangaroo Island, and Tasmania. This range includes large portions of the three countries of Australia, Indonesia, and Papua New Guinea.

Biogeographic Regions: australian (Native )

  • 1991. Tachyglossus aculeatus. Pp. xviii-xix, 2-3 in R Strahan, ed. The Australian Museum Complete Book of Australian Mammals. New South Whales: Cornstalk Publishing.
  • Aplin, K., C. Dickman, L. Salas, K. Helgen. 2008. Tachyglossus aculeatus. 2008 IUCN Redlist of Threatened Species. Accessed November 15, 2008 at www.iucnredlist.org.
  • Groves, C. 2005. Tachyglossus aculeatus. Pp. 1-2 in D Wilson, D Reeder, eds. Mammal Species of the World: A Taxonomic Reference, Vol. 1. Washington: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found throughout Australia, including Tasmania, as well as Papua New Guinea (1). There have also been reports from the island of Salawati, Indonesia, but this has yet to be confirmed (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Short-beaked echidnas are medium-sized mammals ranging in length from about 30 to 40 cm and in weight from about 2 to 7 kg. Depending on the subspecies and location, males or females may be larger. Short-beaked echidna spines are one of their most distinguishing characteristics. These spines cover the entire dorsal surface, including a small tail. Fur is also present and may be even longer than the spines in some subspecies. Tachyglossus aculeatus lacks external pinnae and teeth but does have hard pads in the back of the mouth. Short-beaked echidnas possess several adaptations to their foraging habits including tubular snouts, long sticky tongues, and front paws for digging. Males have non-venomous spurs on the ankles of their hind legs and females have pouches on their undersides. Both males and females have a cloaca through which feces, urine, and, in females, eggs pass. Males have penises they extend through the cloaca during mating. Short-beaked echidnas, and other monotremes, have low metabolic rates and low body temperatures, which may be related to such factors as diet and environmental variation. Short-beaked echidnas have larger brains than would be expected for their body mass. The cerebral cortex, in particular, is large and highly convoluted.

Range mass: 2 to 7 kg.

Range length: 30 to 45 cm.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 2.327 W.

  • Riek, A. 2008. Relationship between metabolic rate and body weight in mammals: effect of the study. Journal of Zoology, 276: 187-194.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in various open woodland types, savanna and semi-arid and arid areas, and rainforest (e.g., Queensland Wet Tropics). It is also found in agricultural areas. The female lays a single egg, which hatches after about ten days (Augee 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Short-beaked echidnas thrive in a variety of habitats including open woodlands, savanna, agricultural areas, semi-arid, and arid regions. Both coastal and highland areas in New Guinea are home to Tachyglossus aculeatus, along with a range of ecosystems in Australia from mild coastal regions to above snowline. Short-beaked echidnas have a broad altitudinal range from sea level to at least 1,675 meters.

Range elevation: 0 to 1,675 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: agricultural

  • Nicol, S., N. Anderson. 2007. The history of an egg-laying mammal, the echidna (Tachyglossus aculeatus). Ecoscience, 14: 275-285.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The short-beaked echidna occupies a variety of habitats, from semi-arid to snowy alpine areas (6), including meadows, heathlands, woodlands, forests and Australian desert (1) (3) (4). This species normally shelters in rotten logs, tree roots, stumps, caves or burrows (self-dug or previously abandoned), or under bushes (4) (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Adult short-beaked echidnas eat ants, termites, and other invertebrates. They make foraging pits by disturbing the soil when looking for food, and they prefer foraging under the canopies of large trees. Their long snouts and sticky tongues reflect their specialized diet. Short-beaked echidnas dig into ant and termite nests with their front paws and poke their long, sticky tongue into nest crevices and grinds insects with its tooth pads. Their foraging habits make separating soil from food difficult. Thus, much of their feces consists of soil.

Animal Foods: insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The foraging pits short-beaked echidnas create become resource traps and affect soil biogeochemistry. Tachyglossus aculeatus may be important in maintaining proper nutrient circulation through small-scale patchiness in semi-arid regions.

Ecosystem Impact: creates habitat; soil aeration

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation is not a major threat to short-beaked echidnas, even though feral cats, pigs, dingoes, and goannas are occasional predators. Animal predators are mostly a threat to young in burrows and to subadults. Adults escape predation by hiding beneath rocks or logs, or digging into the ground until only the spiny back is exposed. Short-beaked echidnas can also curl up to protect their undersides. Despite the minimal defense of many hibernaculum materials, predation on hibernating individuals does not seem to be a problem. After introduced predators, the biggest influence on T. aculeatus mortality is the threat of motor vehicles. Over-hunting by humans may become a problem in some areas of New Guinea.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Short-beaked echidnas sense other echidnas predominantly through smell. Recent findings suggest feces piles act as an important intra-specific form of communication.

Communication Channels: chemical

Other Communication Modes: scent marks

  • Elridge, D., A. Mensing. 2007. Foraging pits of the short-beaked echidna (Tachyglossus aculeatus) as small-scale patches in a semi-arid Australian woodland. Soil Biology & Biochemistry, 39: 1055-1065.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest recorded lifespan for Tachyglossus aculeatus is 50 years in captivity. There are anecdotal accounts of wild individuals living as long as 45 years. There is no doubt this species is particularly long-lived, especially for its size. A lifespan of 50 years is 3.7 times longer than would be expected based on echidna body size. Other long-lived mammals have been observed to have peroxidation-resistant membrane composition, which describes the ratio between polyunsaturates and monounsaturates in membrane lipids. Short-beaked echidna membranes were found to have lower polyunsaturate and higher monounsaturate levels than expected. This composition indicates peroxiclation-resistant cellular membranes in T. aculeatus. Lifespan is also associated with the production of free radicals, which is proportional to metabolic rate. Short-beaked echidnas have notably low metabolic rates, with the exception of times of arousal from torpor. During these arousal periods, metabolic rates increase by up to nine times that of basal metabolic rates and free radical production is high. Therefore, T. aculeatus is thought to have stress resistance that contributes to a long lifespan.  A large and complexly-structured brain may be involved with longevity in T. aculeatus. Such brain characteristics are often correlated with life history traits like slow maturation and single births in other mammals. These traits, in turn, correlate with a long lifespan.

Range lifespan

Status: wild:
45 (high) years.

Range lifespan

Status: captivity:
50 (high) days.

Average lifespan

Status: captivity:
50.0 years.

Average lifespan

Status: captivity:
49.4 years.

  • Hulbert, A., L. Beard, G. Grigg. 2008. The exceptional longevity of an egg-laying mammal, the short-beaked echidna (Tachyglossus aculeatus) is associated with peroxidation-resistant membrane composition. Experimental Gerontology, 43: 729-733.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 49.5 years (captivity) Observations: These are relatively long-lived animals. There are anecdotal reports of one animal living over 50 years in captivity (Ronald Nowak 1999). The record longevity, however, belongs to a 49.5 year-old female kept at Philadelphia Zoo (Richard Weigl 2005). These animals have also been reported to live up to 48 years in the wild (Michael Augee et al. 2006).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Tachyglossus aculeatus has a courtship period between June and August that can last between a few days and several weeks depending on geographic region and subspecies. Females may be pursued by one or several males during this period. Observations of multiple males following individual females have led to the term “echidna train.” Females will mate with only one male per season.

Mating System: polygynous

Gestation in Tachyglossus aculeatus lasts about 23 days, after which the female will lay a single soft-shelled egg in her pouch for incubation. Eggs hatch 10 or 11 days later. Short-beaked echidnas exhibit a long lactation stage lasting between 150 and 200 days depending on geography and subspecies. When the young leave the pouch three months later, they are covered with spines. Maturation time is lengthy. Young reach full adult size after three to five years. Hatchlings have a mass of about 0.3 kg but will grow to weigh 0.7 to 2.1 kg by weaning. Weaning mass is 28 to 48% of adult mass.

Breeding interval: Short-beaked echidnas breed once a year.

Breeding season: Mating usually occurs June through August.

Range number of offspring: 1 to 1.

Average gestation period: 23 days.

Average birth mass: 0.3 kg.

Range weaning age: 150 to 200 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; oviparous

Average birth mass: 0.379 g.

Average gestation period: 22 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
548 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
548 days.

Subspecies vary in their strategies of caring for young. Short-beaked echidnas on Kangaroo Island forage with the young in the pouch immediately post-hatching. After 45 to 55 days, mothers will deposit their young in nursery burrows, where the young will remain until weaning. Mothers return every five to ten days to nurse the young. Short-beaked echidnas in Tasmania remain in nursery burrows with the young for 25 to 35 days post-birth. Mothers then return to the burrow every three to five days to nurse. Other subspecies exhibit variations of parental care ranging between these two extremes.  Mothers do not have nipples or teats, but nurse young through pores connected to their paired mammary glands.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • 1991. Tachyglossus aculeatus. Pp. xviii-xix, 2-3 in R Strahan, ed. The Australian Museum Complete Book of Australian Mammals. New South Whales: Cornstalk Publishing.
  • Aplin, K., C. Dickman, L. Salas, K. Helgen. 2008. Tachyglossus aculeatus. 2008 IUCN Redlist of Threatened Species. Accessed November 15, 2008 at www.iucnredlist.org.
  • Nicol, S., N. Anderson. 2007. The history of an egg-laying mammal, the echidna (Tachyglossus aculeatus). Ecoscience, 14: 275-285.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Augmenting soil ventilation: short-beaked echidna
 

Burrows of short-beaked echidnas are ventilated by periodic flushing movements of the anterior part of the echidna's bodies.

       
  "Short-beaked echidnas have an impressive ability to submerge completely into soil or sand and remain there, cryptic, for long periods. This poses questions about how they manage their respiration, cut off from a free flow of gases. We measured the gradient in oxygen partial pressure (PO2) away from the snouts of buried echidnas and oxygen consumption (VO2) in five individuals under similar conditions, in two substrates with different air-filled porosities (fa). A theoretical diffusion model indicated that diffusion alone was insufficient to account for the flux of oxygen required to meet measured rates of VO2. However, it was noticed that echidnas often showed periodic movements of the anterior part of the body, as if such movements were a deliberate effort to flush the tidal air space surrounding their nostrils. These 'flushing movements' were subsequently found to temporarily increase the levels of interstitial oxygen in the soil around the head region. Flushing movements were more frequent while VO2 was higher during the burrowing process, and also in substrate with lower fa. We conclude that oxygen supply to buried echidnas is maintained by diffusion through the soil augmented by periodic flushing movements, which ventilate the tidal airspace that surrounds the nostrils." (Waugh et al. 2006:938)
  Learn more about this functional adaptation.
  • Waugh, C. A.; Grigg, G. C.; Booth, D. T.; Beard, L. A. 2006. Respiration by buried echidnas Tachyglossus aculeatus. Journal of Experimental Biology. 209(5): 938-944.
  • Opiang, MD. 2009. Home Ranges, Movement, and Den Use in Long-Beaked Echidnas, Zaglossus Bartoni, from Papua New Guinea. Journal of Mammalogy. 90(2): 340-346.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tachyglossus aculeatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0567-06|NC_003321|Tachyglossus aculeatus| AATCGCTGACTATTTTCAACTAACCATAAAGATATTGGTACCCTCTATCTTCTATTCGGTGCATGAGCTGGCATAGCCGGCACAGCCCTC---AGTATTCTCATTCGATCCGAATTAGGCCAACCAGGCTCCCTCTTAGGTGAT---GATCAAATTTATAACGTTATCGTCACAGCCCATGCATTTGTTATGATTTTTTTCATAGTTATGCCAATCATAATCGGAGGTTTTGGTAACTGATTGGTCCCCCTAATG---ATTGGGGCTCCAGATATAGCATTCCCACGAATAAACAATATGAGTTTCTGGCTTTTACCCCCTTCATTTCTCCTACTCCTAGTTTCCTCCACAGTAGAAGCAGGCGCAGGAACTGGCTGAACCGTCTATCCACCCCTAGCAGGCAACCTAGCCCATGCTGGAGCCTCAGTAGACCTG---GCTATTTTTTCCCTTCACCTAGCTGGAGTTTCCTCTATCCTAGGGGCTATTAACTTTATTACCACAATCATTAACATGAAACCTCCTGCAATATCCCAATATCAAACACCCCTGTTCGTCTGATCAGTACTAGTTACAGCTGTCCTTCTCCTTTTATCACTCCCCGTCCTTGCGGCA---GGCATTACCATACTTCTCACTGACCGAAATCTTAATACAACTTTCTTTGACCCAGCAGGGGGTGGAGATCCTATTTTATATCAACACCTGTTCTGATTTTTTGGACACCCTGAAGTCTATATCTTAATCTTACCAGGCTTTGGAATTATCTCTCATATTGTTACTTACTACTCAGGAAAAAAA---GAACCATTCGGGTATATAGGAATAGTTTGAGCTATGATATCCATCGGATTTTTAGGTTTCATCGTATGGGCTCACCACATATTTACAGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tachyglossus aculeatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aplin, K., Dickman, C., Salas, L. & Helgen, K.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, large population, occurrence in a number of protected areas, lack of major threats, and because it is not thought to be in decline.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

As of 2008, the IUCN listed Tachyglossus aculeatus as a species of Least Concern. Short-beaked echidnas have a broad distribution, a large total population with a stable trend, and are tolerant of many habitat types. They occur in protected areas and appear to lack major threats. The IUCN did suggest monitoring the number of T. aculeatus killed on major tourist roads.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Least Concern (LR/lc) on the IUCN Red List 2007 (1). Subspecies: Tachyglossus aculeatus multiaculeatus (Kangaroo Island echidna) is classified as Lower Risk / Near Threatened (LR/nt); T. a. aculeatus (Southern Australia echidna) and T. a. setosus (Tasmanian echidna) are classified as Lower Risk / Least Concern (LR/lc); T. a. lawesi (New Guinea echidna), T. a. acanthion (Central Australia echidna) and T. a. ineptus (Western Australia echidna) have not yet been classified by the IUCN (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It can be a locally common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There appear to be no major threats to the species over most of its range. It is threatened by overhunting for food in parts of New Guinea, and there may be some localized declines. Although not a threat, they are used for ceremonial purposes throughout their range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The short-beaked echidna is considered relatively common because it is widespread. Since European settlement and the associated threats of land clearance, road mortality and competition and predation by introduced species, it has disappeared from parts of its range (1) (7). One subspecies, the Kangaroo Island echidna (T. a. multiaculeatus), is classified as Near Threatened (LR/nt), because of increasing tourist activity in its restricted island range (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in two protected areas on New Guinea and presumably is present in many protected areas in Australia. There is a need to monitor numbers of animals killed along selected sections of main tourist roads. Most likely there are adequate protected areas in Australia already in place for this species, however, in Papua New Guinea (where less than 2% of the land is protected) none of the protected areas are large enough (other than Crater Mountain Wildlife Reserve) to contain a viable population of this species (L. Salas pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

No conservation measures are in place for the short-beaked echidna, although records of road-killed animals along main roads are monitored (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because short-beaked echidnas can live in agricultural areas, they may disrupt fields and gardens while foraging.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Short-beaked echidnas are hunted for food and for ceremonial purposes, especially in New Guinea. They maintain small-scale patchiness, which is an important ecosystem service that keeps semi-arid regions functioning properly. Their diet of ants, termites, and other invertebrates may contribute to the control of these species.

Positive Impacts: food ; body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Short-beaked echidna

The short-beaked echidna (Tachyglossus aculeatus), also known as the spiny anteater because of its diet of ants and termites, is one of four living species of echidna and the only member of the genus Tachyglossus. The short-beaked echidna is covered in fur and spines, and has a distinctive snout and a specialized tongue, which it uses to catch its prey at a great speed. Like the other extant monotremes, the short-beaked echidna lays eggs; the monotremes are the only group of mammals to do so.

This echidna has extremely strong front limbs and claws due to its mechanical advantage, which allows it to burrow quickly with great power. As it needs to be able to survive underground, it has a great tolerance to high levels of carbon dioxide and a lack of oxygen. It has no weapons or fighting ability, and repels predators by curling into a ball and deterring opponent with its spines. The echidna lacks the ability to sweat and cannot deal with heat well, so it tends to avoid daytime activity in hot weather; it can swim if needed. The snout has mechanical and electroreceptors that help it to detect what is around it.

During the winter, it goes into deep torpor and hibernation to save energy and reduce metabolism, before emerging, as the temperature increases, to breed. Female echidnas only lay one egg a year, and the mating period is the only time the otherwise solitary animals meet one another; the male has no further contact with the female after mating. After the young are born, they are only the size of a grape, but grow rapidly on the mothers' milk, which is very rich in nutrients. After a period, they are too large and spiky to stay in the pouch, and after around six months they leave the burrow and have no more contact with their mothers.

The species is found throughout Australia, where it is the most widespread native mammal, and in coastal and highland regions of southwestern New Guinea, where it is known as the mungwe in the Daribi and Chimbu languages.[3] It is not threatened with extinction, but human activities, such as hunting, habitat destruction, and the introduction of foreign predatory species and parasites, have reduced the distribution of the short-beaked echidna in Australia. Attempts to breed the echidna in captivity have not been successful to date, with none reaching maturity. However, as the echidna can survive merely by foraging dead logs for ants and termites, it can survive in environments with restricted resources.

Contents

Taxonomy and naming

The short-beaked echidna was first described by George Shaw in 1792. He named the species Myrmecophaga aculeata, thinking it might be related to the South American anteater. Since Shaw first described the species, its name has undergone four revisions: from M. aculeata to Ornithorhynchus hystrix, Echidna hystrix, Echidna aculeata and finally, Tachyglossus aculeatus.[4][5] The name Tachyglossus means "quick tongue",[4] in reference to the speed with which the echidna uses its tongue to catch ants and termites,[4] and aculeatus means "spiny" or "equipped with spines".[4]

The short-beaked echidna is the only member of its genus,[6] sharing the family Tachyglossidae with the extant species of the genus Zaglossus that occur in New Guinea.[7] Zaglossus species, which include the western long-beaked, Sir David's long-beaked and eastern long-beaked echidnas,[8] are all significantly larger than T. aculeatus, and their diets consist mostly of worms and grubs rather than ants and termites.[9] Species of the Tachyglossidae are egg-laying mammals; together with the related family Ornithorhynchidae, they are the only extant monotremes in the world.[10]

The five subspecies of the short-beaked echidna are each found in different geographical locations. The subspecies also differ from one another in their hairiness, spine length and width, and the size of the grooming claws on their hind feet.[11]

The earliest fossils of the short-beaked echidna date back around 15 million years ago to the Pleistocene era, and the oldest specimens were found in caves in South Australia, often with fossils of the long-beaked echidna from the same period. The ancient short-beaked echidnas are considered to be identical to their contemporary descendants apart from the fact that the ancestors are around 10% smaller.[10][13] This "post-Pleistocene dwarfing" affects many Australian mammals.[10] Part of the last radiation of monotreme mammals, echidnas are believed to have evolutionally diverged from the platypus around 65 million years ago, between the Cretacious and Tertiary periods.[10] However, the echidna's pre-Pleistocene heritage has not been traced yet, and the lack of teeth on the fossils found thus far have made it impossible to use dental evidence.[14]

The short-beaked echidna was commonly called the spiny anteater in older books, though this term has fallen out of fashion since the echidna bears no relation to the true anteaters. It has a variety of names in the indigenous languages of the regions where it is found. The Noongar people from southwestern Western Australia call it the nyingarn. In Central Australia southwest of Alice Springs, the Pitjantjatjara term is tjilkamata or tjirili, from the word tjiri for spike of porcupine grass (Triodia irritans). The word can also mean slowpoke.[15] In central Cape York Peninsula, it is called (minha) kekoywa in Pakanh, where minha is a qualifier meaning 'meat' or 'animal', (inh-)ekorak in Uw Oykangand and (inh-)egorag in Uw Olkola, where inh- is a qualifier meaning 'meat' or 'animal'.[16] In the highland regions of southwestern New Guinea, it is known as the mungwe in the Daribi and Chimbu languages.[3]

Description

Spines and fur of an echidna

Short-beaked echidnas are typically 30 to 45 centimetres (12 to 18 in) in length, have a 75-millimetre (3 in) snout, and weigh between 2 and 5 kilograms (4.4 and 11 lb).[17] However, the Tasmanian subspecies, T. a. setosus, is smaller than its Australian mainland counterparts.[18] Because the neck is not externally visible, the head and body appear to merge together.[19] The earholes are on either side of the head,[19] with no external pinnae.[19] The eyes are small, approximately a 9 mm (0.4 in)-diameter sphere and at the base of the wedge-shaped snout.[20] The nostrils and the mouth are at the distal end of the snout;[19] the mouth of the Short-beaked Echidna cannot open wider than 5 mm (0.2 in).[21] The body of the Short-beaked Echidna is, with the exception of the underside, face and legs, covered with cream-coloured spines. The spines, which may be up to 50 mm (2 in) long, are modified hairs,[22] mostly made of keratin.[23] Insulation is provided by fur between the spines, which ranges in colour from honey to a dark reddish-brown and even black; the underside and short tail are also covered in fur.[22] Colouration of the fur and spines varies with geographic location. The echidna's fur may be infested with what is said to be the world's largest flea, Bradiopsylla echidnae, which is about 4 mm (0.16 in) long.[22]

The limbs of the short-beaked echidna are adapted for rapid digging: they are short and have strong claws.[22] These strong and stout limbs allow it to tear apart large logs and move paving stones, and one has been recorded moving a 13.5 kilograms (30 lb) stone; there has also been a report of a captive echidna moving a refrigerator in the home of a scientist around the room.[24] The power of the limbs are based on strong musculature, particularly around the shoulder and torso area.[25] The mechanical advantage of its arm is greater than that of humans, as its biceps connect the shoulder to forearm at a point further down than for humans,[26] and the chunky humerus allows for larger areas for more muscle to form.[27]

The claws on the hind feet are elongated and curve backward to enable cleaning and grooming between the spines. Like the Platypus, the Echidna has a low body temperature—between 30 and 32 °C (86 and 90 °F)—but, unlike the Platypus, which shows no evidence of torpor or hibernation, the body temperature of the Echidna may fall as low as 5 °C (41 °F).[28] The Echidna does not pant or sweat[29] and normally seeks shelter in hot conditions.[30] Despite the inability to sweat, echidnas still lose water as they exhale. The snout is believed to be crucial in restricting this loss to sustainable levels, through a bony labyrinth that has a refrigerator effect and helps to condense water vapour in the breath.[31] The echidna does not have highly concentrated urine, and around half of the estimated daily water loss of 120 grams (4.2 oz) occurs in this manner, while most of the rest is through the skin and respiratory system.[32] Most of this is replenished by its substantial eating of termites—one laboratory study reported it would ingest around 147 grams (5.2 oz) a day, most of which was water.[32] This can be supplemented by drinking water if available, or licking morning dew from flora.[33]

In autumn and winter the echidna shows periods of torpor or deep hibernation.[34] Because of the low body temperature, it becomes sluggish in very hot and very cold weather.[31]

Like all monotremes, it has one orifice,[35] known as the cloaca, for the passage of faeces, urine and reproductive products.[34] The male has internal testes, no external scrotum and a highly unusual penis with four knobs on the tip.[36] The gestating female develops a pouch on its underside, where it raises its young.[37]

A short-beaked echidna curled into a ball, the snout is visible on the right.

The musculature of the short-beaked echidna has a number of unusual aspects. The panniculus carnosus is an enormous muscle, just beneath the skin, covers the entire body. By contraction of various parts of the panniculus carnosus, the short-beaked echidna can change shape, the most characteristic shape change being achieved by rolling itself into a ball when threatened, so protecting its belly and presenting a defensive array of sharp spines. It has one of the shortest spinal cords of any mammal, extending only as far as the thorax.[38] Whereas the human spinal cord ends at the first or second lumbar vertebra, for the echidna it occurs at the seventh thoracic vertebra.[39] The shorter spinal cord is thought to allow it the flexibility to wrap into a ball.[39]

The musculature of the face, jaw and tongue is specialised to allow the echidna to feed. The tongue is the animal's sole means of catching prey, and can protrude up to 180 mm (7 in) outside the snout.[17] The snout's shape, resembling a double wedge, gives it a significant mechanical advantage in generating a large moment, and therefore makes it efficient for digging to reach prey or to build a shelter.[40] The tongue is sticky because of the presence of glycoprotein-rich mucous, which both lubricates movement in and out of the snout and helps to catch ants and termites, which adhere to it. Protrusion of the tongue is achieved by contracting circular muscles that change the shape of the tongue and force it forwards and contracting two genioglossal muscles attached to the caudal end of the tongue and to the mandible. The protruded tongue is stiffened by the rapid flow of blood, allowing it to penetrate wood and soil. Retraction requires the contraction of two internal longitudinal muscles, known as the sternoglossi. When the tongue is retracted, the prey is caught on backward-facing keratinous "teeth", located along the roof of the buccal cavity, allowing the animal both to capture and grind food.[21][41] The tongue moves with great speed, and has been measured to move in and out of the snout 100 times a minute.[17][42] This is partly achieved through the elasticity of the tongue and the conversion of elastic potential energy into kinetic energy.[41] The tongue is very flexible, particularly at the end, allowing it to bend in U-turns and catch insects attempting to flee in their twisty nests or mounds.[43] The tongue also has an ability to avoid picking up splinters while foraging in logs; the reason for this ability is unknown.[41] It can eat quickly; a specimen of around 3 kilograms (6.6 lb) can ingest 200 grams (7.1 oz) of termites in ten minutes.[44]

The echidna has a stomach that is quite apart from other mammals. It is devoid of secretory glands and has cornified stratified epithelium, which resembles horny skin.[44] Unlike other mammals, which typically have highly acidic stomachs, the Echidna has low levels of acidity, almost neutral with pH in the 6.2–7.4 range.[44] The stomach is elastic and the gastric peristalsis grinds dirt particulates and shredded insects together. The digestion occurs in the small intestine, which is around 3.4 metres (11 ft) in length. The insect exoskeletons and dirt are not digested and ejected in the waste.[44]

Numerous physiological adaptations aid the lifestyle of the short-beaked echidna. Because the animal burrows, it must tolerate very high levels of carbon dioxide in inspired air, and will voluntarily remain in situations where carbon dioxide concentrations are high. It can dig up to a metre into the ground to retrieve ants or evade predators, and can survive with low oxygen when the area is engulfed by bushfires. The echidna can also dive underwater, an ability that can help it to survive sudden floods.[33] During these situations, the heart rate drops to around 12 beats per minute, around one fifth of the rate at rest. This process is believed to save oxygen for the heart and brain, which are the most sensitive to such a shortage, and laboratory testing has revealed its cardiovascular system is similar to that of the seal.[33]

The echidna's optical system is an uncommon hybrid of both mammalian and reptilian characteristics. The cartilaginous layer beneath the scleral layer of the eyeball is similar to that of reptiles and avians.[20] The small cornea's surface is keratinised and hardened, possibly an evolution to protect it from chemicals secreted by preyed insects or self-impalement when it rolls itself up, something that has been observed.[45] The echidna has the flattest lens of any animal, giving it the longest focal length. This similarity to primates and humans allows it to see distant objects clearly.[46] Unlike placental mammals, including humans, the echidna does not have a ciliary muscle to distort the geometry of the lens and thereby change the focal length and allow objects at different distances to be viewed clearly; the whole eye is believed to distort so the distance between the lens and screen instead changes to allow focusing.[46] The visual ability of an echidna is not great, and it is not known whether it can perceive colour; however, it can distinguish between black and white, and horizontal and vertical stripes. Eyesight is not a crucial factor in the animal's ability to survive, as blind echidnas are able to live healthily.[47]

Its ear is sensitive to low-frequency sound, which may be ideal for detecting sounds emitted by termites and ants underground.[48] The pinnae are obscured and covered by hair, so opponents can not grab them in an attack, and prey or foreign material cannot enter, although ticks are known to reside there.[49] The ear has a macula which is very large compared to other animals. It is used as a gravity sensor to orient the echidna. The large size is speculated to be due to importance of burrowing downwards for an echidna.[50]

The leathery snout is keratinised and covered in mechano- and thermoreceptors, which provide information about the surrounding environment.[48][51] These nerves protrude through microscopic holes at the end of the snout.[52] It also has mucous glands on the end of the snout that act as electroreceptors. It can detect electric fields of 1.8 mV/cm—1,000 times more sensitive than humans—and dig up buried batteries.[53] Echidnaa have a series of push rods protruding from their snouts. These are columns of flattened, spinous cells, with roughly an average diameter of 50 micrometres and a length of 300 micrometres. The number of push rods per square millimetre of skin is estimated to be 30 to 40.[54] Longitudinal waves are believed to be picked up and transmitted through the rods, acting as mechanical sensors, to allow prey detection.[55]

The short-beaked echidna has a well-developed olfactory system, which may be used to detect mates and prey. It has a highly sensitive optic nerve, and has been shown to have visual discrimination and spatial memory comparable to those of a rat.[56] The brain and central nervous system have been extensively studied for evolutionary comparison with placental mammals, particularly with its fellow monotreme, the platypus.[57][58] The average brain volume is 25 mL, similar to a cat of approximately the same size;[59] while the platypus has a largely lissencephalic and smooth brain, the echidna has a heavily folded and fissured, gyrencephalic brain similar to humans, which is seen as a sign of a highly neurologically advanced animal.[60] The cerebral cortex is thinner, the brain cells larger and more densely packed and organised in the echidna than the platypus, suggesting evolutionary divergence must have occurred long ago.[60] Almost half of the sensory area in the brain is devoted to the snout and tongue, and the part devoted to smell is relatively large compared to other animals.[60]

The short-beaked echidna has the largest prefrontal cortex relative to body size of any mammal,[57] taking up 50% of the cerebral cortex in comparison to 29% for humans.[61] This part of the brain in humans is though to be used for planning and analytical behaviour, leading to debate as to whether the echidna has reasoning and strategising ability.[61][62] Experiments in a simple maze and with a test on whether the animal can open a trap door to access food, and the echidna's ability to remember what it has learnt about the task for over a month, has led scientists to conclude its learning ability is similar to that of a cat or a rat.[63]

The echidna shows rapid eye movement during sleep, usually around its thermoneutral temperature of 25°C, and this effect is suppressed at other temperatures.[39] Its brain has been shown to contain a claustrum similar to that of placental mammals, so linking this structure to their common ancestor.[57][64]

Ecology and behaviour

French Island Echidna.ogg
A short-beaked echidna in French Island National Park building a defensive burrow (video 0:43s)

No systematic study of the ecology of the short-beaked echidna has been published. There have, however, been studies of several aspects of their ecological behaviour. Short-beaked echidnas live alone, and, apart from the burrow created for rearing young, they have no fixed shelter or nest site. They do not have a home territory they defend against other echidnas, but range over a wide area.[30] The range area has been observed to be between 21 and 93 ha, although one study in Kangaroo Island found the animals there covered an area between 9 and 192 ha.[30] Overall, the mean range areas across the various regions of Australia were 40–60 ha. There was no correlation between gender and range area, but a weak one with size.[30] Echidnas can share home ranges without incident, and sometimes share shelter sites if there are not enough for or each animal to have one individually.[65]

Short-beaked echidnas are typically active in the daytime, though they are ill-equipped to deal with heat because they have no sweat glands and do not pant. Therefore, in warm weather, they change their patterns of activity, becoming crepuscular or nocturnal.[66] Body temperatures above 34 °C (93 °F) are believed to be fatal, and in addition to avoiding heat, the animal adjusts its circulation to maintain a sustainable temperature by moving blood to and from the skin to increase or lower heat loss.[66] In areas where water is present, they can also swim to keep their body temperatures low.[66] The "thermoneutral zone" for the environment is around 25 °C (77 °F), at which point metabolism needed to maintain body temperature is minimized.[66] Echidnas can tolerate cold temperatures, and they hibernate during the winter both in cold regions and in regions with a more temperate climate.[67] The echidna is endothermic, and can maintain body temperatures of around 32°C.[68] It can also reduce its metabolism and heart rate and body temperature.[69] In addition to brief and light bouts of torpor throughout the year, the echidna enters periods during winter when it hibernates.[70] During periods of hibernation, the body temperature drops to as low as 4 °C (39 °F). The heart rate falls to 4–7 beats per minute—down from 50–68 at rest[33]&mdash, and the echidna can breathe as infrequently as once every three minutes,[70] 80 to 90% slower than when it is active.[33] Metabolism can drop to one-eighth of the normal rate.[71] Echidnas begin to prepare for the hibernation phase of the year between February and April, when they reduce their consumption and enter brief periods of torpor. Males begin hibernating first, while females that have reproduced start later.[71] During the period of hibernation, the animals average 13 separate bouts of torpor, which are broken up by periods of arousal lasting 1.2 days on average. These interruptions tend to coincide with warmer periods.[71] Males end their hibernation period in mid-June, while reproductive females return to full activity in July and August; nonreproductive females and immature echidnas may not end hibernation until two months later.[71] During euthermia, the body temperature can vary by 4 °C (39 °F) per day.[71] The metabolic rate is around 30% of that of placental mammals, making it the lowest energy-consuming mammal. This figure is similar to that of other animals that eat ants and termites;[72] burrowing animals also tend to have low metabolism generally.[66]

Questions have arisen as to why echidnas hibernate, as it is seemingly unnecessary for survival; they begin their hibernation period while the weather is still warm, and food is generally always plentiful.[73] One explanation of this phenomenon is echidnas want to be cautious with their energy reserves to maximize their foraging productivity. Another hypothesis is they are descended from ectothermic ancestors, but have taken to periodic endothermy for reproductive reasons, so the young can develop more quickly.[73] Supporters of this theory argue that males hibernate earlier than females because they finish their contribution to reproduction first, and they awake earlier to undergo spermatogenosis in preparation for mating, while females and young lag in their annual cycle.[73] During the hibernation period, the animals stay in entirely covered shelter.[74]

Short-beaked echidnas can live anywhere that has a good supply of food. They locate food by smell, using sensors in the tips of their snouts, and regularly feast on ants and termites.[75] This view is based on the echidna's method of shuffling around seemingly arbitrarily, and using its snout in a probing manner.[76] A study of Echidnas in New England has shown that they tend to dig up scarab beetle larvae in spring when the prey are active, but eschew this prey when it is inactive; this has been used to support the conjecture that Echidnas detect their prey using hearing.[77] Vision is not believed to be significant in hunting, as blind animals have been observed to survive in the wild.[77]

Echidnas use their strong claws to pull apart nests and rotting logs to gain access to their prey.[78] They are selective of what types of ants and termites they target because some of their would-be prey secrete repulsive liquids. They also have a preference for the eggs, pupae and winged phases of the insects.[79] Echidnas hunt most vigorously towards the end of winter and early in spring, when their fat reserves have been depleted after hibernation and/or nursing.[80] At this time of the year, ants have high body fat, and the echidna targets their mounds.[80] The animal also hunts beetles and earthworms, providing they are small enough to fit in a 5 mm gap.[80] The proportion of ants and termites in their diet depends on the availability of prey, and termites make up a larger part in drier areas where they are more plentiful.[76] However, termites are preferred, if available, as their bodies contain a smaller proportion of indigestible exoskeleton. Termites from the Rhinotermitidae family, however, are avoided due to their chemical defenses. Scarab beetle larvae are also a large part of the diet when and where available. In a study conducted in New England in New South Wales, 37% of the food intake consisted of beetle larvae, although the echidna had to squash the prey in its snout as it ingested it, due to size.[76]

Echidnas are powerful diggers, using their clawed front paws to dig out prey and create burrows for shelter. They may rapidly dig themselves into the ground if they cannot find cover when in danger.[22] They bend their belly together to shield the soft, unprotected part, and can also urinate, giving off a pungent liquid, in an attempt to deter attackers.[81] Males also have single small spurs on each rear leg that is believed to a defensive weapon that has since been lost to the evolutionary process.[82] Echidnas typically try to avoid confrontation with predators due to their lack of anatomical weaponry. Instead, they use the colour of their spines, which is similar to the vegetation of the dry Australian environment, to avoid detection. They have good hearing and tend to become stationary if sound is detected.[82]

In Australia, they are most common in forested areas where there are abundant, termite-filled, fallen logs. In agricultural areas, they are most likely to be found in uncleared scrub; they may be found in grassland, arid areas, and in the outer suburbs of the capital cities. Little is known about their distribution in New Guinea. They have been found in southern New Guinea between Merauke in the west and the Kelp Welsh River, east of Port Moresby, in the east, where they may be found in open woodland.[3]

Echidnas have the ability to swim, and have been seen cooling off near dams during high temperatures. They have also been seen crossing streams and swimming for brief periods in seas off Kangaroo Island. They swim with only the snout above water, using it as a snorkel.[82]

Reproduction

The underside of a female short-beaked echidna, the pouch which carries eggs is towards the rear of the abdomen.

The solitary short-beaked echidna looks for a mate between May and September;[22] the precise timing of the mating season varies with geographic location.[83] In the months before the mating season, the size of the male's testes increases by a factor of three or more before spermatogenesis occurs.[84] Both males and females give off a strong, musky odour during the mating season, by turning their cloacas inside out and wiping them on the ground, secreting a glossly liquid believed to be an aphrodisiac.[36] During courtship—observed for the first time in 1989—males locate and pursue females. Trains of up to ten males—often with the youngest and smallest male at the end of the queue[85]—may follow a single female in a courtship ritual that may last for up to four weeks; the duration of the courtship period varies with location.[17][86] During this time, they forage for food together, and the train often changes composition, as some males leave and other join the pursuit.[85] In cooler parts of their range, such as Tasmania, females may mate within a few hours of arousal from hibernation.[87]

Before mating, the male smells the female, paying particular attention to the cloaca. This process can take a few hours, and the female can reject the suitor by rolling herself into a ball.[84] After prodding and sniffing her back,[84] the male is often observed to roll the female onto her side and then assume a similar position himself so that the two animals are abdomen to abdomen, having dug a small crater to lie in. They can lie with heads facing one another, or head to rear.[88] If more than one male is in the vicinity, there may be fighting over the female.[88] Each side of the bilaterally symmetrical, rosette-like, four-headed penis [similar to that of reptiles and 7 centimetres (2.8 in) in length] is used alternately, with the other half being shut down between ejaculations. Sperm bundles of around 100 each appear to confer increased sperm motility, which may provide the potential for sperm competition between males.[88][89] This process takes between a half an hour and three hours.[88] Each mating results in the production of a single egg, and females are known to mate only once during the breeding season; each mating is successful.[90]

Fertilisation occurs in the oviduct. Gestation takes between 21 and 28 days after copulation,[91] during which time the female constructs a nursery burrow. Following the gestation period, a single, rubbery-skinned egg[17] between 13 and 17 millimetres (0.5 and 0.7 in) in diameter and 1.5 and 2.0 grams (0.053 and 0.071 oz) in weight[91] is laid from her cloaca directly into a small, backward-facing pouch that has developed on her abdomen. The egg is ovoid, leathery, soft and cream-coloured. Between laying and hatching, some females continue to forage for food, while others dig burrows and rest there until hatching.[91] Ten days after it is laid, the egg hatches within the pouch.[22][91] The embryo develops an "egg tooth" during incubation, which it uses to tear open the egg; the tooth disappears soon after hatching.[92]

Hatchlings are about 1.5 centimetres (0.6 in) long and weigh between 0.3 and 0.4 gram (0.011 and 0.014 oz).[92][93] After hatching, young echidnas are known as "puggles". Although newborns are still semitranslucent and still surrounded by the remains of the egg yolk, and the eyes are still barely developed, they already have well-defined front limbs and digits that allow them to climb on their mothers' bodies.[92] Hatchlings attach themselves to their mothers' milk areolae, specialised patches on the skin that secrete milk—monotremes lack nipples—through approximately 100–150 pores.[17][22][92] The puggles were thought to have imbibed the milk by licking the mother's skin, but this has been superseded by a belief they feed by sucking the areolae.[94]

They have been observed ingesting large amounts during each feeding period, and mothers may leave them unattended in the burrow for between five and 10 days to find food.[94] Studies of captives have shown they can ingest milk once every two or three days and then increase their mass by 20% in one milk-drinking session lasting between one and two hours.[94] Around 40% of the milk weight is converted into body mass, and as such, a high proportion of milk is converted into growth; a correlation with the growth of the puggle and its mother's size has been observed.[94] By the time the puggle is around 200 grams (7.1 oz), it is left in the burrow while the mother forages for food, and it reaches around 400 grams (14 oz) after around two months.[94] Juveniles are eventually ejected from the pouch at around two to three months of age, because of the continuing growth in the length of their spines.[22][94] During this period, the young are left in covered burrows while the mothers forage, and the young are often preyed upon.[95] Suckling gradually decreases until juveniles are weaned at about six months of age. The duration of lactation is about 200 days,[17][94] and the young leave the burrow after 180 to 205 days, usually in January or February, at which time they are around 800 and 1,300 grams (28 and 46 oz). There is no contact between the mother and young after this point.[95]

The composition of the milk secreted by the mother changes over time. At the moment of birth, the solution is dilute and contains 1.25% fat, 7.85% protein, and 2.85% carbohydrates and minerals. Mature milk has much more concentrated nutrients, with 31.0, 12.4 and 2.8% of the aforementioned nutrients, respectively.[94] Near weaning, the protein level continues to increase; this is conjectured to be due to the need for keratin synthesis for hair and spines, to provide defences against the cold weather and predators.[96]

The principal carbohydrate components of the milk are fucosyllactose and saialyllactose; it has a high iron content, which gives it a pink colour.[97] The high iron content and low levels of free lactose contrasts with other eutherian mammals. Lactose production is believed to proceed along the same lines as in the platypus.[97]

The age of sexual maturity is uncertain, but may be four to five years. A 12-year field study, published in 2003, found the short-beaked echidna reaches sexual maturity between five and 12 years of age, and that the frequency of reproduction varies from once every two years to once every six years.[93] The short-beaked echidna can live as long as 45 years in the wild,[98] and the longest-lived echidna in captivity reached 49 years of age in a zoo in Philadelphia in the US.[81] Echidnas contrast to other mammals in that their rates of reproduction and metabolism are lower, and they live longer, as though in slow motion,[81] something caused, at least in part, by their low body temperature, which rarely exceeds 33°C, even when they are not hibernating.[81]

Like its fellow monotreme the platypus, the short-beaked echidna has a system of multiple sex chromosomes, in which males have four Y chromosomes and five X chromosomes. Male individuals appear to be X1Y1X2Y2X3Y3X4Y4X5 (figure[99]), while females are X1X1X2X2X3X3X4X4X5X5. Weak identity between chromosomes results in meiotic pairing that yields only two possible genotypes of sperm, X1X2X3X4X5 or Y1Y2Y3Y4, thus preserving this complex system.[99]

Conservation status

A short-beaked echidna on the move

The short-beaked echidna is common throughout most of temperate Australia and lowland New Guinea, and is not listed as endangered.[17][22] In Australia, it remains widespread across a wide range of conditions, including urban outskirts, coastal forests and dry inland areas, and is especially widespread in Tasmania and on Kangaroo Island.[100]

The most common threats to the animal in Australia are motor vehicles and habitat destruction, which have led to localized extinctions.[100] In Australia, the number of short-beaked echidnas has been less affected by land clearance than have some other species, since they do not require a specialized habitat beyond a good supply of ants and termites.[22] As a result, they can survive in cleared land if the cut-down wood is left in the area, as the logs can be used as shelter and a source of insects. However, areas where the land has been completely cleared for single crops that can be mechanically harvested, such as wheatfields, have seen extinctions.[100] Over a decade-long period, around one-third of Echidna deaths reported to wildlife authorities in Victoria were due to motor vehicles, and the majority of wounded animals handed in were traffic accident victims.[101] Studies have shown they often choose to traverse drainage culverts under roads, so this is seen as a viable means of reducing deaths on busy roads in rural areas or national parks where the animals are more common.[101]

Despite their spines, they are preyed on by birds, the Tasmanian devil,[22] dingoes,[17] snakes, lizards, goannas, cats and foxes,[102] although almost all victims are young. Goannas are known for their digging abilities and strong sense of smell, and are believed to be have been the main predators of the echidna before the introduction of most of the other predators by European settlers.[102] Dingoes are known to kill echidnas by rolling them over onto their backs and attacking their underbellies.[100] A tracking study of a small number of echidnas on Kangaroo Island concluded goannas and cats were the main predators, although foxes—absent in Kangaroo Island—would be expected to be a major threat, also, as the echidna density in Tasmania—which is free from foxes—is higher in other parts of Australia.[102]

They were eaten by indigenous Australians and the early European settlers of Australia.[22] In contrast, hunting and eating of the echidna in New Guinea has increased over time and caused a decline in the population and distribution areas; it is now believed to have disappeared from highland areas. The killing of echidnas was a taboo in traditional culture, but since the tribespeople have become increasingly Christianised by western missionaries, hunting has increased, and the animals have been more easily tracked down due to the use of dogs.[103]

Infection with the introduced parasite Spirometra erinaceieuropaei is considered fatal for the echidna. This is a waterborne infection contracted through sharing drinking areas with infected dogs, foxes, cats and dingos, which do not die from the parasite. The infection is seen as being more dangerous in drier areas, where more animals are sharing fewer bodies of water, increasing the chance of transmission.[101] The Wildlife Preservation Society of Queensland runs an Australia-wide survey, called Echidna Watch, to monitor the species in Australia. Echidnas are also known to be affected by tapeworms, protozoans and herpes-like viral infections, but there is little knowledge of how infections affect the health of the animals or the populations.[104]

Although it is considered easy to keep echidnas healthy in captivity,[105] breeding is difficult, partly due to the relatively infrequent cycle. In 2009, Perth Zoo managed to breed some captive short-beaked echidnas.[106] Until 2006, only five zoos have managed to breed a captive short-beaked echidna, but no captive-bred young have survived to maturity.[107] Of these five institutions, only one in Australia—Sydney's Taronga Zoo—managed to breed echidnas, in 1977. The other four cases occurred in the Northern Hemisphere, two in the United States and the others in western Europe. In these cases, breeding occurred six months out of phase compared to Australia, after the animals had adapted to Northern Hemisphere seasons.[107] The failure of captive breeding programs has conservation implications for the endangered species of echidna from the genus Zaglossus, and to a lesser extent for the short-beaked echidna.[107]

Cultural references

Short-beaked echidnas feature in the animistic culture of indigenous Australians, including their visual arts and stories. The species was a totem for some groups, including the Noongar people from Western Australia. Many groups have myths about the animal; one myth explains it was created when a group of hungry young men went hunting at night and stumbled across a wombat. They threw spears at the wombat, but lost sight of it in the darkness. The wombat adapted the spears for its own defence and turned into an echidna.[108] Another story tells of a greedy man who kept food from his tribe; warriors speared him and he crawled away into the bushes, where he turned into an echidna, the spears becoming his spines.

The short-beaked echidna is an iconic animal in contemporary Australia, notably appearing on the Australian five-cent coin (the smallest denomination),[109] and on a AU$200 commemorative coin released in 1992.[110] The short-beaked echidna has been included in several postal issues: it was one of four native species to appear on Australian postage stamps in 1974, when it was on the 25-cent stamp; it appeared on a 37-cent stamp in 1987, and in 1992 it was on the 35-cent stamp.[111][citation needed] The anthropomorphic echidna Millie was a mascot for the 2000 Summer Olympics.[112] Knuckles the Echidna, from the Sonic the Hedgehog series is also based on the short-beaked echidna.

See also

Cited references

  1. ^ Groves, Colin P. (16 November 2005). "Order Monotremata (pp. 1-2)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 1. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10300004. 
  2. ^ Aplin, K., Dickman, C., Salas, L. & Helgen, K. (2008). Tachyglossus aculeatus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 10 October 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b c Flannery, T. 1990. Mammals of New Guinea Robert Brown & Associates ISBN 1-86273-029-6
  4. ^ a b c d Augee, Gooden and Musser, p. 5.
  5. ^ Iredale, T. and Troughton, E. 1934. A checklist of mammals recorded from Australia. Memoirs of the Australian Museum 6: i–xii, 1–122
  6. ^ "ADW: Tachyglossus: Classification". Animaldiversity.ummz.umich.edu. http://animaldiversity.ummz.umich.edu/site/accounts/classification/Tachyglossus.html. Retrieved 2011-01-02. 
  7. ^ Augee, Gooden and Musser, pp. 5–9.
  8. ^ "ADW: Zaglossus: Classification". Animaldiversity.ummz.umich.edu. http://animaldiversity.ummz.umich.edu/site/accounts/classification/Zaglossus.html. Retrieved 2011-01-02. 
  9. ^ Augee, Gooden and Musser, pp. 7–10.
  10. ^ a b c d Augee, Gooden and Musser, p. 10.
  11. ^ a b c Augee, Gooden and Musser, pp. 6–7.
  12. ^ Griffiths, M.E. 1978. The Biology of Monotremes. Academic Press : New York ISBN 0-12-303850-2
  13. ^ Augee, Gooden and Musser, p. 16.
  14. ^ Augee, Gooden and Musser, pp. 16–17.
  15. ^ Cliff Goddard (1992). Pitjantjatjara/Yankunytjatjara To English Dictionary (2 ed.). Alice Springs, Northern Territory: Institute for Aboriginal Development. p. 152. ISBN 0-949659-64-9. 
  16. ^ Philip Hamilton (1997). "short-beaked echidna, Tachyglossus aculeatus". Australian Institute of Aboriginal and Torres Strait Islander Studies. Archived from the original on 2006-10-17. http://web.archive.org/web/20061017203041/http://www.geocities.com/Athens/Delphi/2970/echidna.htm. Retrieved 2007-06-08. 
  17. ^ a b c d e f g h i Egerton, p. 38.
  18. ^ Augee, Gooden and Musser, p. 6.
  19. ^ a b c d Augee, Gooden and Musser, p. 2.
  20. ^ a b Augee, Gooden and Musser, p. 55.
  21. ^ a b Murray, P.F. 1981. A unique jaw mechanism in the echidna, Tachglossus aculeatus (Monotremata). Australian Journal of Zoology 29: 1–5
  22. ^ a b c d e f g h i j k l m "DPIW - Short-beaked Echidna". Dpiw.tas.gov.au. 2009-08-10. http://www.dpiw.tas.gov.au/internnsf/WebPages/BHAN-5357K5?open. Retrieved 2010-05-29. 
  23. ^ Augee, Gooden and Musser, p. 35.
  24. ^ Augee, Gooden and Musser, p. 100.
  25. ^ Augee, Gooden and Musser, pp. 100–101.
  26. ^ Augee, Gooden and Musser, pp. 101–102.
  27. ^ Augee, Gooden and Musser, p. 102.
  28. ^ Dawson, T.J., Grant, T.R. and Fanning, D. 1979. Standard metabolism of monotremes and the evolution of homeothermy. Australian Journal of Zoology 27:511–515
  29. ^ Augee, Gooden and Musser, pp. 90–91.
  30. ^ a b c d Augee, Gooden and Musser, p. 91.
  31. ^ a b Augee, Gooden and Musser, pp. 114–115.
  32. ^ a b Augee, Gooden and Musser, pp. 115.
  33. ^ a b c d e Augee, Gooden and Musser, p. 116.
  34. ^ a b "Science & Nature - Wildfacts - Short-beaked echidna, common echidna, spiny anteater". BBC. 2008-07-25. http://www.bbc.co.uk/nature/wildfacts/factfiles/680.shtml. Retrieved 2010-05-29. 
  35. ^ Augee, Gooden and Musser, p. 3.
  36. ^ a b Augee, Gooden and Musser, p. 79.
  37. ^ Augee, Gooden and Musser, p. 4.
  38. ^ Hassiotis, M., Paxinos, G., and Ashwell, K.W.S. 2004. Anatomy of the central nervous system of the Australian echidna. Proceedings of the Linnean Society of New South Wales 125:287–300
  39. ^ a b c Augee, Gooden and Musser, p. 53.
  40. ^ Augee, Gooden and Musser, pp. 103–104.
  41. ^ a b c Augee, Gooden and Musser, p. 105.
  42. ^ Doran, G.A. and Baggett, H. 1970. The vascular stiffening mechanism in the tongue of the echidna (Tachyglossus aculeatus). Anatomical Record 167: 197–204
  43. ^ Augee, Gooden and Musser, p. 104.
  44. ^ a b c d Augee, Gooden and Musser, p. 106.
  45. ^ Augee, Gooden and Musser, p. 56.
  46. ^ a b Augee, Gooden and Musser, p. 57.
  47. ^ Augee, Gooden and Musser, pp. 58–59.
  48. ^ a b Iggo, A., McIntyre, A.K. & Proske, U. (1985). Responses of mechanoreceptors and thermoreceptors in skin of the snout of the echidna Tachyglossus aculeatus. Proceedings of the Royal Society of London B 223: 261–277
  49. ^ Augee, Gooden and Musser, p. 58.
  50. ^ Augee, Gooden and Musser, p. 65.
  51. ^ Augee, Gooden and Musser, p. 66.
  52. ^ Augee, Gooden and Musser, p. 68.
  53. ^ Augee, Gooden and Musser, pp. 69–70.
  54. ^ Augee, Gooden and Musser, pp. 70–71.
  55. ^ Augee, Gooden and Musser, pp. 72–75.
  56. ^ Burke, D. 2002. Win-shift and win-stay learning in the short-beaked echidna (Tachyglossus aculeatus). Animal Cognition 5:79–84
  57. ^ a b c Nicol, S.C., et al. 2000. The echidna manifests typical characteristics of rapid eye movement sleep. Neuroscience Letters 283:49–52
  58. ^ Augee, Gooden and Musser, pp. 44–48.
  59. ^ Augee, Gooden and Musser, p. 45.
  60. ^ a b c Augee, Gooden and Musser, p. 47.
  61. ^ a b Augee, Gooden and Musser, p. 48.
  62. ^ Augee, Gooden and Musser, pp. 48–50.
  63. ^ Augee, Gooden and Musser, pp. 50–51.
  64. ^ Ashwell, K.W.S., Hardman, C.D., and Paxinos, G. 2004. The claustrum is not missing from all monotreme brains. Brain Behaviour and Evolution 64:223–241 PMID 15319553
  65. ^ Augee, Gooden and Musser, pp. 91–92.
  66. ^ a b c d e Augee, Gooden and Musser, p. 114.
  67. ^ Grigg, G.C., Beard, L.A., and Augee, M.L. 1989. Hibernation in a monotreme, the echidna (Tachyglossus aculeatus). Comparative Biochemistry and Physiology. A, Comparative Physiology 92:609–612 PMID 2566425
  68. ^ Augee, Gooden and Musser, p. 112.
  69. ^ Augee, Gooden and Musser, p. 107.
  70. ^ a b Augee, Gooden and Musser, p. 108.
  71. ^ a b c d e Augee, Gooden and Musser, p. 109.
  72. ^ Augee, Gooden and Musser, p. 113.
  73. ^ a b c Augee, Gooden and Musser, p. 110.
  74. ^ Augee, Gooden and Musser, p. 111.
  75. ^ "Short-beaked Echidna - Zoo Aquarium Association". Arazpa.org.au. http://www.arazpa.org.au/Short-beaked-Echidna/default.aspx. Retrieved 2010-05-29. 
  76. ^ a b c Augee, Gooden and Musser, p. 98.
  77. ^ a b Augee, Gooden and Musser, p. 99.
  78. ^ Augee, Gooden and Musser, p. 95.
  79. ^ Augee, Gooden and Musser, pp. 96–97.
  80. ^ a b c Augee, Gooden and Musser, p. 97.
  81. ^ a b c d Augee, Gooden and Musser, p. 93.
  82. ^ a b c Augee, Gooden and Musser, p. 92.
  83. ^ Augee, Gooden and Musser, p. 77.
  84. ^ a b c Augee, Gooden and Musser, p. 80.
  85. ^ a b Augee, Gooden and Musser, p. 78.
  86. ^ Rismiller, P.D., Seymour, R.S., 1991. The echidna. Scientific American 264, 96–103.
  87. ^ Nicol, S.C., Andersen, N.A., and Jones, S.M., 2005. Seasonal variations in reproductive hormones of free-ranging echidnas (Tachyglossus aculeatus): interaction between reproduction and hibernation. General and Comparative Endocrinology 144: 204–210
  88. ^ a b c d Augee, Gooden and Musser, p. 81.
  89. ^ Johnston S.D., Smith B., Pyne M., Stenzel D., and Holt W.V. One-Sided Ejaculation of Echidna Sperm Bundles (Tachyglossus aculeatus). Am. Nat. 2007. Vol. 170, p. E000. [AN:42629 DOI:10.1086/522847]
  90. ^ Rismiller, P.D. and McKelvey, M.W. 2000. Frequency of breeding recruitment in the Short-beaked Echidna, Tachyglossus aculeatus. Journal of Mammalogy 81:1–17
  91. ^ a b c d Augee, Gooden and Musser, p. 84.
  92. ^ a b c d Augee, Gooden and Musser, p. 85.
  93. ^ a b Rismiller, P.D. and McKelvey, M.W. 2003. Body mass, age and sexual maturity in short-beaked echidnas, Tachyglossus aculeatus. Comparative Biochemistry and Physiology. A, Molecular & Integrative Physiology 136:851–865
  94. ^ a b c d e f g h Augee, Gooden and Musser, p. 86.
  95. ^ a b Augee, Gooden and Musser, p. 88.
  96. ^ Augee, Gooden and Musser, pp. 86–87.
  97. ^ a b Augee, Gooden and Musser, p. 87.
  98. ^ "Parks Victoria Fact File". Parkweb.vic.gov.au. http://www.parkweb.vic.gov.au/education/factfiles/15.htm. Retrieved 2010-05-29. [dead link]
  99. ^ a b Rens, W., et al (2007). "The multiple sex chromosomes of platypus and echidna are not completely identical and several share homology with the avian Z". Genome Biology 8 (11): R243. doi:10.1186/gb-2007-8-11-r243. PMC 2258203. PMID 18021405. http://genomebiology.com/2007/8/11/R243. 
  100. ^ a b c d Augee, Gooden and Musser, p. 120.
  101. ^ a b c Augee, Gooden and Musser, p. 121.
  102. ^ a b c Augee, Gooden and Musser, pp. 120–121.
  103. ^ Augee, Gooden and Musser, p. 119.
  104. ^ Augee, Gooden and Musser, p. 122.
  105. ^ Augee, Gooden and Musser, pp. 122–125.
  106. ^ "Baby echidnas make first appearance at Perth Zoo". Perthnow.com.au. 2009-11-04. http://www.perthnow.com.au/news/western-australia/baby-echidnas-make-first-appearance-at-perth-zoo/story-e6frg15c-1225794333104. Retrieved 2010-05-29. 
  107. ^ a b c Augee, Gooden and Musser, p. 126.
  108. ^ Robinson, R. 1966. Aboriginal Myths and Legends. Sun Books, Melbourne
  109. ^ "Five cents". Ramint.gov.au. 1966-02-14. http://www.ramint.gov.au/designs/ram-designs/5c.cfm. Retrieved 2010-05-29. 
  110. ^ http://heavymetalholdings.com.au/index_files/RAMGoldCoins.htm
  111. ^ Australia Post. "Australian Wildlife (1992)". http://www.stamps.com.au/shop/reprints/australian-wildlife-1992. Retrieved 2010-05-08. [dead link]
  112. ^ Rohrer, Finlo (2008-06-16). "How not to have an Olympic mascot nightmare". BBC News. http://news.bbc.co.uk/2/hi/uk_news/magazine/7456330.stm. Retrieved 2010-05-29. 

General references

  • Augee, M. L. and Gooden, B. A. 1993. Echidnas of Australia and New Guinea. Australian National History Press, Sydney ISBN 978-0-86840-046-4
  • Augee, M. L., Gooden, B. A. and Musser, A. 2006. Echidna : extraordinary egg-laying mammal. Collingwood, Victoria, CSIRO Publishing ISBN 0643092048
  • Augee, M. L. 1983. R. Strahan Ed. The Australian Museum Complete Book of Australian Mammals. pp. 8–9. Angus & Robertson ISBN 0-207-14454-0
  • Egerton, L. ed. 2005. Encyclopedia of Australian wildlife. Reader's Digest ISBN 1-876689-34-X
  • Griffiths, M. 1989. Tachyglossidae. pp. 407–435 in Fauna of Australia (D. W. Walton and B. J. Richardson, eds.). Mammalia, Canberra, Australian Capital Territory 1B:1–1227.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!