Ornithorhynchus anatinus — Details

Duck-billed Platypus learn more about names for this taxon

EOL is scheduled for maintenance on Thursday, June 20 between 8:00 and 10:00 AM EDT.
During this time you may find changes in EOL's performance and availability.

Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Taxonomy

The platypus was described scientifically for the first time by Dr George Shaw (1751-1813), who named it Platypus anatinus. Platypus is an anglicised Greek word meaning flat foot, probably referring to the web on its feet. Unfortunately this name had already been applied to a genus of beetles, so it had to be changed. Ornithorhynchus (bird-snout) replaced it, but the species name anatinus (duck-like) remained the same.The original specimen described by Shaw is currently stored with our research collections.

Morphology
No other animal on Earth looks quite like the platypus. The most distinctive feature is the bill, which is not hard like the bill of a duck but soft and pliable. It is well supplied with nerves and is used by the animal to locate food and to find its way around under water.Platypuses lose their deciduous juvenile teeth a short time after the young leave the nesting burrows. They are replaced by horny pads made of keratin.

Built for swimming and digging
Platypuses are covered with dense, waterproof fur, except on their feet and bill. They have a streamlined shape, short limbs and propels themselves through the water using alternate kicks of their webbed front limbs. These webs of the forefeet are folded back when the animal is walking or burrowing to expose strong claws.Behind the bill on either side of the head are 2 grooves that house the ear openings and the eyes which close when the platypus dives. The nostrils are on top of the bill, not far back from the tip.The skeleton is streamlined but heavy enough to support large muscles for swimming and digging.

Other key features
Each of the males’ rear legs bears a horny spur on the ankle of about 1.5cm in length. This hollow spur is connected to a venom gland in the upper leg.The tail consists mainly of fatty tissue and acts as a fat storage area.Interestingly, the platypus skeleton shows reptilian and marsupial features:
  • Between the collar bone and the sternum the platypus has a distinctively T-shape bone called the interclavicle, which is also found in modern reptiles.
  • Like marsupials, the platypus has two epipubic bones attached to its pelvic girdle.
  • The legs are splayed rather like those of reptiles but they rotate in their sockets like those of mammals. (Grant, 2007)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

No other animal on Earth looks quite like the platypus, with its mixture of reptilian and mammalian features.The most distinctive feature is the bill, which is not hard like the bill of a duck but soft and pliable. It is well supplied with nerves and is used by the animal to locate food and to find its way around under water.Although known to have had several fossil relatives, Ornithorhynchus anatinus is the only living species of platypus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

During the hours of daylight, the platypus remains in an individual, oval-shaped burrow, dug three to eight metres into an earth bank (8). Emerging at dusk, it spends most of the night foraging in shallow water for bottom-dwelling invertebrates, such as crustaceans, worms and molluscs and the larvae of freshwater insects (3) (8). Throughout the 20 to 40 second dives, the platypus probes the muddy bottom with its highly sensitive bill, aided by an array of electro-receptors capable of detecting the small muscle activity of prey (3) (6) (7) (8). Although platypus home ranges often overlap, these solitary animals generally only come together to mate (7) (8). Breeding occurs from late winter to spring, with mating taking place in the water (3) (8). Around 21 days after mating, the female lays from one to three, leathery-shelled eggs in an elaborate nesting burrow, up to 30 metres long and comprised of multiple chambers (6) (7) (8). The tiny, naked young hatch after an incubation period of just 10 days, but remain in the burrow for three to four months, during which time they feed on milk sucked from the fur around the female's mammary glands (3) (6) (8). Emerging from the burrow in summer, the young enter the water and begin to feed on the benthic organisms on which the adults thrive (3). In the wild the platypus may live for up to 20 years (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

So seemingly incongruous was the appearance of platypus specimens shipped to England at the end of the 18th century, that many observers assumed it was the fraudulent work of a skilled taxidermist (3) (4) (5). Even after the specimens were found to be authentic, it was sometime before scientists concluded that the 'amphibious mole' was in fact a mammal, albeit the most evolutionary distinct mammal alive (3) (5) (6). The distinctive features that make the platypus so instantly recognisable are its duck-like bill, dense, waterproof fur, webbed feet, and broad, flattened tail (3) (7) (8). The plush pelage that covers its stream-lined body is deep brown above, and silvery grey to yellow underneath (3) (6) (8). The limbs are extremely short, with the heavily webbed front-feet providing propulsion through water, while the hind-feet act more like rudders (3). In male platypuses, the rear ankles are equipped with a horny spur connected by a duct to venom gland, which is used to inflict wounds on natural predators and other males (3) (7) (8). Although, the characteristic muzzle of the platypus resembles that of a duck, it is actually soft and rubbery, and contains no true teeth (3) (6) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Size:
Platypus head and body length averages 40-60cm from tip of bill to end of tail.Body weight:
  • Males: 800-3000g
  • Females: 600-1700g (Grant, 2007)


Life expectancy:
Platypuses are long-lived animals. They can live up to:
  • 20 years in captivity
  • 21 years in the wild


Lactation:
From May until July, the mammary glands each consist of a small structure, only about 1cm in length, under the skin on the female’s abdomen. Towards the end of this period the glands begin to enlarge and develop into large fan-like structures which occupy much of the ventral abdominal surface of the body and may even extend up towards the back.Lactation lasts from 3 to 4 months and sometimes over 4 months in captivity (Grant, 2007).Platypus milk is pink-white. Biochemical analysis of the milk has shown it to be very rich, containing more total solids than that of many other mammals. Platypus milk has high concentrations of iron, necessary for the formation of haemoglobin in red blood cells (Grant, 2007).

Spurs and Venom:
Platypus males have a pair of spurs. Each spur:
  • is hollow
  • is attached by a duct to a venom gland
  • is made of keratin
  • sits on a small nub of bone in the ankle region
A spur does not develop in the female platypus. However, a spur sheath of around 2mm is present in the ankle region for 8-10 months after emergence.Venom is sometimes seen exuding as drops from the tips of the spurs of male platypuses, especially during the breeding season when the venom glands are enlarged.The venom:
  • is clear and slightly sticky
  • consists of a complex mixture of molecules, including protein and peptides. Not all of the components have been identified and the functions of those which have been studied are not yet well understood.
The predominant symptoms attributed to the venom are:
  • excruciating pain
  • long-lasting tenderness and sensitivity (Grant, 2007)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Platypus is endemic to Australia, where it is dependent on rivers, streams, and bodies of freshwater. It is present in eastern Queensland and New South Wales, in eastern, central, and south-western Victoria, throughout Tasmania, and on King Island. An introduced population is established at the western end of Kangaroo Island (Carrick et al. 2008). Its occurrence is reasonably continuous within some catchments, but discontinuous in others (e.g., the Bega River catchment in New South Wales; Lunney et al. 1998), and in many catchments its actual distribution is poorly known. In Victoria, fewer than 200 individuals occupy the Wimmera-Avon River basin (distributed over an area of >2,400,000 ha), and the species appears to have recently become extinct in the neighbouring Avoca River basin (Australian Platypus Conservancy, unpublished data) (T. Grant, S. Munks, F. Carrick, and M. Serena pers. comm.). The species now appears to be extinct also from its former range in the Adelaide Hills and Mount Lofty Ranges in South Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The geographic range of Ornithorhynchus anatinus is restricted to the wetter regions of eastern Australia and Tasmania.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The platypus is endemic to Australia, where it occurs in eastern Queensland and New South Wales, eastern, central and south-western Victoria, and throughout Tasmania. In addition there is an introduced population on Kangaroo Island, South Australia (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Duck-billed platypuses are one of three species of monotremes. These species are unique among mammals in that they retain the ancestral characteristic of egg laying. They have a cloaca through which eggs are laid and both liquid and solid waste is eliminated. Duck-billed platypuses are stream-lined and elongated, they have fur ranging from medium brown to dark brown on the dorsal side and brown to silver-gray on the ventral side. They have bills that closely resemble those of ducks, and flat and broad tails resembling those of beavers (Grant and Temple-Smith, 1998). Two nostrils are located on top of their bills and their eyes and ears are on either side of their heads. They have short limbs, naked soles, webbed forefeet and partially-webbed hind feet. Each foot contains five digits each consisting of a broad nail for the forefeet and sharp claws for the hind feet. Males are generally larger than females, and have two venom glands attached to spurs on their hind legs. Females have mammary glands but no nipples. The young have milk teeth while the adults have grinding plates. The young are smaller than adults in size.  There is a significant reduction in body fat after winter for both young and adults (Pasitschniak-Arts and Marinelli, 1998).

Range mass: 0.8 to 2.5 kg.

Average mass: 1.52 kg.

Range length: 390 to 600 mm.

Average length: 465 mm.

Average basal metabolic rate: 468 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; venomous

Sexual Dimorphism: male larger; ornamentation

Average basal metabolic rate: 1.931 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Platypus is restricted to streams and suitable freshwater bodies, including some shallow water storage lakes and ponds (Carrick et al. 2008). Its food is almost exclusively benthic macroinvertebrates and so the species is water-dependent. Platypuses are largely solitary, and when not foraging in water they normally occupy a resting or nesting burrow in earth banks, although some individuals have been found resting in accumulated stream debris or in low dense vegetation. The species is seldom observed moving on land in mainland Australia, but is frequently seen out of the water in Tasmania, where its predator, the fox (Vulpes vulpes), has been introduced only relatively recently (T. Grant, S. Munks, F. Carrick, and M. Serena pers. comm.). The breeding season varies widely depending on location. Females produce one to three eggs annually, but usually two (Carrick et al. 2008). Platypuses are long-lived animals (up to 20 years in the wild).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Duck-billed platypuses inhabit rivers, lagoons, and streams (Pasitschniak-Artsand Marinelli, 1998). They prefer areas with steep banks that contain roots, overhanging vegetation, reeds, and logs (Grant and Temple-Smith, 1998). The rivers and streams are usually less than 5 meters in depth (Grant and Temple-Smith, 1998). There have been records of them living in aquatic habitats at elevations above 1000 meters (Grant and Temple-Smith, 1998).

Range elevation: 1000 (high) m.

Range depth: 5 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial ; freshwater

Terrestrial Biomes: mountains

Aquatic Biomes: lakes and ponds; rivers and streams

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found mainly in streams and rivers with earth banks suitable for burrows, but also occurs in lakes and farm dams (3) (6) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Duck-billed platypuses eat primarily aquatic invertebrates in streams and lakes (Grant and Tempple-Smith, 1998). They also eat shrimp, fish eggs, and small fish (Pasitschniak-Arts and Marinelli, 1998).

Animal Foods: fish; eggs; mollusks; aquatic or marine worms; aquatic crustaceans

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Vertebrate Associates on Kangaroo Island, Australia

The most notable mammal present on Kangaroo Island is the endemic Kangaroo Island Kangaroo (Macropus fuliginosus fuliginosus), the icon for whom the island was named upon European discovery in 1802. A smaller marsupial present on the island is the Tammar Wallaby (Macropus eugenii). An endemic dasyurid is the Critically Endangered Kangaroo Island Dunnart (Sminthopsis aitkeni), which is found only in the west of the island in Eucalyptus remota/E. cosmophylla open low mallee, E. baxteri low woodland or E. baxteri/E. remota low open woodland. The Common Brush-tailed Possum (Trichosurus vulpecula) is a widespread folivore native to Australia.

Monotremes are also represented on the island. There is also an introduced population of the Duck-billed Platypus (Ornithorhynchus anatinus) in the western part of the island in Flinders Chase National Park. The Short-beaked Echidna (Tachyglossus aculeatus) is also found moderately widespread on Kangaroo Island.

Chiroptera species on Kangaroo Island include the Yellow-bellied Pouched Bat (Saccolaimus flaviventris), which species is rather widespread in Australia and also occurs in Papua New Guinea. Australia's largest molossid, the White-striped Free-tail Bat (Tadarida australis) is found on Kangaroo Island. Another bat found on the island is the Southern Forest Bat (Eptesicus regulus), a species endemic to southern Australia (including Tasmania).

Several anuran species are found on Kangaroo island: Brown Tree Frog (Litoria ewingii), Spotted Marsh Frog (Limnodynastes tasmaniensis), Painted Spadefoot Frog (Neobatrachus pictus), Brown Toadlet (Pseudophryne bibroni) and Brown Froglet (Crinia signifera).

The Heath Monitor (Varanus rosenbergi ) is a lizard that grows up to a metre in length, preying on smaller reptiles, juvenile birds and eggs; it is frequently observed on warmer days basking in the sunlight or scavenging on roadkill. The Black Tiger Snake (Notechis ater) is found on Kangaroo Island. Another reptile particularly associated with this locale is the Kangaroo Island Copperhead (Austrelaps labialis).

The Glossy Black Cockatoo (Calyptorhynchus lathami) is found on the island, especially in the western part, where its preferred food, fruit of the Drooping Sheoak, is abundant. The Kangaroo Island Emu (Dromaius baudinianus) became extinct during the 1820s from over-hunting and habitat destruction due to burning.

Marine mammals that are observed on the island include the Australian Sea Lion (Neophoca cinerea) and New Zealand Fur Seal (Arctocephalus forsteri), each species of which is native to Kangaroo Island, and abundant at Admiral's Arch as well as at Seal Bay.

Kangaroo Island is not so adversely impacted by alien species grazers as parts of the mainland. No rabbit species are present on the island, and introduced (but escaped) Domestic Goats (Capra hircus) and pigs (Sus scrofa) have generated only minor issues. However, a Koala (Phascolarctos cinereus) population introduced to the island in the 1920s has caused significant damage to certain woodland communities, especially to Manna Gum trees.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Ecosystem Roles

There is little information about how duck-billed platypuses affect their ecosystem. However, especially by foraging on aquatic invertebrates, they play an integral role in the food webs of the streams, rivers, and billabongs in which they are found.

Ecosystem Impact: parasite

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of duck-billed platypuses include foxes, humans, and dogs (Grant and Temple-Smith, 1998). Others are snakes, birds of prey, feral cats, and large eels (Pasitschniak-Arts and Marinelli, 1998).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Distribution ecology

Distribution
The platypus is endemic to Australia, where it is dependent on rivers, streams, and bodies of freshwater. It is present:
  • in eastern Queensland and New South Wales
  • in eastern, central, and south-western Victoria
  • throughout Tasmania
  • on King Island
  • at the western end of Kangaroo Island, where an introduced population is established (Carrick et al., 2008)
Its occurrence is reasonably continuous within some catchments but discontinuous in others, such as the Bega River catchment in New South Wales (Lunney et al., 1998). In many catchments its actual distribution is poorly known. In Victoria, fewer than 200 individuals occupy the Wimmera-Avon River basin (distributed over an area of more than 2,400,000 hectares), and the species appears to have recently become extinct in the neighbouring Avoca River basin (unpublished data from the Australian Platypus Conservancy and personal communication from T. Grant, S. Munks, F. Carrick, and M. Serena). The species also appears to be extinct from its former range in the Adelaide Hills and Mount Lofty Ranges in South Australia (IUCN, 2009).

Habitat
The platypus is restricted to streams and suitable freshwater bodies, including some shallow water storage lakes and ponds (Carrick et al., 2008). When not foraging in water, the animals normally occupy a resting or nesting burrow in earth banks, although some individuals have been found resting in accumulated stream debris or in low dense vegetation. The species is seldom observed moving on land in mainland Australia, but is frequently seen out of the water in Tasmania.

Trophic Strategy
The platypus feeds almost exclusively on benthic invertebrates, especially insect larvae, but also:
  • crayfish
  • snails
  • tadpoles
  • worms
  • small fish
(Nowak, 1999)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Duck-billed platypuses make some sounds, but their role in communication hasn't been defined yet (Pasitschniak-Arts and Marinelli, 1998).

Communication Channels: tactile ; acoustic

Other Communication Modes: vibrations

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Behaviour
Platypuses are largely solitary. When not foraging, individuals normally spend most daylight hours tucked up inside an earth burrow in the bank of a creek, river or pond (Grant, 2007). Some individuals have been found resting in accumulated stream debris or in low, dense vegetation (IUCN, 2009). While foraging in water, the platypus stores food in its cheek pouches which lie beside the horny grinding pads in the mouth. This food is then masticated once it rests on the surface (Grant, 2007).

Associations


Parasitic animals
Platypuses are known to carry a number of parasitic animals in the wild, including their own unique species of tick, Ixodes ornithorhynchi. This tick is thought to transmit the protozoan blood parasite Theileria ornithorhynchi but this is usually regarded as harmless, normally infecting only a low percentage of the red blood cells.

Fungal infection
Platypuses suffer from a fungal infection (Mucor amphibiorum) found in amphibians of mainland Australia. To date, this infection has only tentatively been reported in a few mainland platypuses but in parts of Tasmania it has resulted in a condition that causes severe skin ulcers. It can invade other tissues, including lungs, and has led to mortalities in certain populations (Grant, 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little information on the longevity of duck-billed platypuses. They can live up to 12 years in the wild.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: captivity:
17.0 years.

Average lifespan

Status: wild:
17.0 years.

Average lifespan

Status: captivity:
17.0 years.

Average lifespan

Status: captivity:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.6 years (captivity) Observations: One captive specimen was at least 22.6 years old when it died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male duck-billed platypuses initiate most mating interactions but successful mating relies entirely on the willingness of females. Mating is seasonal and varies with population. Male and female platypuses touch as they swim past each other. The male grabs the tail of the female with his bill and if the female is unwilling, she will try to escape by swimming through logs and other obstacles until she is set free. However, if she is willing, she will stay near the male and will allow him to grab her tail again if he dropped it. The male then curls his body around the female, his tail underneath her to one side of her tail. Then he moves forward and bites the hair on her shoulder with his bill. Other details of the mating patterns of platypuses are mainly unknown due to their secretive, aquatic nature. There is a higher proportion of spur wounds in males than females, which may be explained by aggressive encounters between males during mating season.

Mating System: polygynous

Duck-billed platypuses are one of the three mammal species that lay eggs. There is little available information on breeding, estimated gestation periods are 27 days and incubation periods are 10 days. Lactation lasts three to four months. Most juvenile females do not begin to breed until they are four years old (Grant and Temple-Smith, 1998).

Breeding interval: Duck-billed platypuses probably breed once each year.

Breeding season: Duck-billed platypuses breed in late winter or autumn.

Range number of offspring: 1 to 3.

Range weaning age: 3 to 4 months.

Range age at sexual or reproductive maturity (female): 2 (low) years.

Range age at sexual or reproductive maturity (male): 1.5 (low) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; oviparous

Average gestation period: 17 days.

Average number of offspring: 2.

Female duck-billed platypuses build burrows in which to protect and nurse their young. During the incubation period, the female platypus will incubate eggs by pressing the egg to her belly with her tail. The incubation period usually lasts for 6 to 10 days. Duck-billed platypuses generally lay two to three eggs.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding season
The platypus breeding season varies widely depending on location. Mating is thought to occur:
  • from July to October in mainland Australia
  • as late as February in Tasmania (Grant, 2007)


Reproductive system:
  • Both sexes have a structure called a cloaca - a single external opening into which the reproductive, excretory and digestive systems open.
  • In the female platypus only the left ovary is functional.
  • The male testicles are inside the abdomen, rather than in an external scrotum (Grant, 2007).


Sex determination:
  • Platypuses have multiple sex chromosomes with some homology to the bird Z chromosome.
  • Males have 5 X and 5 Y chromosomes, which form a chain at meiosis and segregate into 5 X and 5 Y sperm.
  • Sex determination and sex chromosome dosage compensation remain unclear (Warren et al., 2008).


Egg production
It took 93 years from when platypuses were discovered to get scientific proof that they were oviparous (meaning that they lay eggs) (Griffiths, 1978). Females produce 1-3 eggs annually, usually 2 (Carrick et al., 2008).After fertilisation the first shell layer is laid down and the egg passes down the oviduct into the uterus where second and third layers of the shell, secreted by glands in the walls of the uterus, are added.The uterus also supplies nutrients to the egg, facilitating a size increase to about 14mm in diameter and 17mm in length by the time it is laid.Incubation time is unknown but is possibly 10 days (Grant, 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Evolution
The platypus is placed with the echidnas in the Order called Monotremata (meaning 'single hole' because of the common external opening for urogenital and digestive systems). Traditionally, the Monotremata are considered to belong to a subclass Prototheria, which diverged from the therapsid line to the Theria and subsequently split into the marsupials and eutherians (Placentalia). The divergence of monotremes and therians falls into the large gap in the amniote phylogeny between:
  • the eutherian radiation about 90 million years ago
  • the divergence of sauropsid lineage around 315 million years ago
Estimates of the monotreme-theria divergence time range between 160 and 210 million years ago, recently estimated from fossil and molecular data (Warren et al., 2008).Although known to have had several fossil relatives, Ornithorhynchus anatinus is the only living species of platypus.

Genetics
The platypus genome, as well as the animal, is an amalgam of ancestral reptilian and derived mammalian characteristics. The platypus karyotype comprises 52 chromosomes in both sexes, with a few large and many small chromosomes, reminiscent of reptilian macro- and microchromosomes.The Ornithorhynchus anatinus whole-genome shotgun project has been deposited in DDBJ/EMBL/GenBank under the project accession AAPN00000000 (Warren et al., 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

In yet another unusual characteristic of the Platypus, sex determination does not arise from a simple combination of one X and one Y chromosome. Grutzner et al (2004) demonstrate that the platypus has five male-specific chromosomes (Y chromosomes) and five X chromosomes present in one copy in males but in two copies in females (X chromosomes). At meiosis these ten chromosomes form an alternating pattern XYXYXYXYXY and XXXXXXXXXX to then segregate into sex determining sperm each with 5X or 5Y chromosomes.

  • Grützner, F., Rens, W., Tsend-Ayush, E., El-Mogharbel, N., O’Brien, P. C. M., Jones, R. C., Ferguson-Smith, M. A., et al. (2004). In the platypus a meiotic chain of ten sex chromosomes shares genes with the bird Z and mammal X chromosomes. Nature, 432(7019), 913-7. Macmillian Magazines Ltd. doi:10.1038/nature03021
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Alan Couch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Ornithorhynchus anatinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACCGCTGACTATTTTCAACTAATCATAAAGATATCGGAACCTTGTATCTTCTATTTGGTGCATGAGCTGGTATAGCCGGCACAGCCCTTAGTATCCTAATTCGATCTGAATTAGGTCAACCCGGTTCATTATTAGGAGAT---GATCAAATCTATAATGTTATTGTTACAGCCCATGCATTTGTAATAATCTTTTTTATAGTAATGCCCATTATAATTGGTGGTTTTGGTAACTGATTGGTTCCTTTAATAATTGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATGAGCTTTTGACTTTTACCTCCCTCATTTCTCTTACTTTTAGTTTCTTCCACAGTAGAAGCTGGGGCAGGGACAGGCTGAACTGTGTACCCTCCCTTAGCAGGTAACTTAGCCCATGCCGGAGCTTCAGTAGATCTAGCCATTTTTTCTTTACATCTGGCTGGAGTCTCTTCTATTCTAGGGGCAATCAACTTCATTACAACAATTATTAATATGAAGCCACCTGCAATATCACAATACCAGACGCCTCTATTCGTTTGATCAGTCTTAATTACAGCTGTTCTTCTCCTTCTATCCCTTCCTGTTCTTGCAGCAGGTATTACCATGCTCCTGACCGATCGTAATCTCAACACAACTTTCTTTGATCCTGCTGGGGGAGGTGACCCTATCTTATACCAACACTTATTCTGATTTTTTGGTCACCCTGAGGTATATATTTTAATCTTGCCTGGCTTTGGAATTATTTCTCACATTGTCACTTATTACTCAGGTAAAAAAGAACCATTTGGCTATATAGGGATAGTTTGAGCTATAATATCAATTGGATTTTTAGGTTTTATTGTATGAGCCCACCACATATTTACAGTTGGTATAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ornithorhynchus anatinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lunney, D., Dickman, C., Copley, P., Grant, T., Munks, S., Carrick, F., Serena, M. & Ellis, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. There are, however, insufficient data at the catchment and local levels to predict population trends reliably in the long term.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Duck-billed platypuses are currently protected by the Australian government (Pasitschniak-Arts and Marinelli, 1998). Populations are considered healthy and they are not listed as a species of concern on global conservation lists.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation status
Ornithorhynchus anatinus is listed as Least Concern on the IUCN Red List of Threatened Species because:
  • it has a wide distribution
  • it has a presumed large population
  • it is unlikely to be declining at a rate that justifies listing it in a threatened category
However, long term population trends cannot be predicted reliably from the catchment and local level data currently available.

Legislation
The platypus is protected by legislation in the Australian Capital Territory and in every state in which it occurs. This means that platypuses:
  • cannot be captured or killed, except for scientific research (and special permits and ethics approval are needed first)
  • can be kept only in licensed zoos or sanctuaries


Threats
  • Habitat disruption caused by dams, irrigation projects and pollution.
  • Predation by foxes and occasionally birds of prey, crocodiles and large fresh water fish species.
  • Starvation and/or heat stress in dispersing juveniles and/or adults during droughts.
  • Human activities, especially drowning in illegal nets and traps and becoming entangled in discarded fishing line, plastic and other rubbish.
  • Mucor fungal disease in Tasmania
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a common species. Its overall distribution appears to be little changed from its historical distribution (except in South Australia). However, many local populations are known to have declined or disappeared within the last few decades, and in general there is a surprising lack of knowledge about its abundance (T. Grant, S. Munks, F. Carrick, and M. Serena pers. comm.). Specifically, there are insufficient data at the catchment and local levels to predict population trends reliably in the long term.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Currently, the predominant threat to the species on the mainland is reduction in stream and river flows due to recent successive droughts, stream regulation, and extraction of water for agricultural, domestic, and industrial supplies. It is also at risk from the opposite extremes associated with climate change – extensive flooding both in space and time associated with recent tropical cyclones that have resulted in increased mortality and all but eliminated recruitment in 2006 over a substantial part of the species’ northern range. Habitat modification due to bank erosion and stream sedimentation (as a result of poor land management practices in agriculture, forestry, and urbanization) are also of great concern. In the case of urban streams, Platypus populations may be adversely affected both by poor water quality (in the form of suspended solids and nutrient enrichment) and contamination of sediment by heavy metals (Serena and Pettigrove 2005). Accidental drowning in nets and traps set for fish and crustaceans has the potential to impact Platypus distribution and abundance in all parts of its range, especially in small streams where populations may be critically small.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although the platypus was hunted intensively for its fur until the early 20th century, its population has recovered well and is now thought to be fairly abundant (1) (6). However, owing to the species' specialised habitat requirements, it is seen as being increasingly vulnerable to the effects of habitat change (3) (8). In particular, one of the major concerns is the impact of reduced stream and river flow, resulting from prolonged periods of drought and the industrial and domestic extraction of water. Paradoxically, excessive flooding in the past has also been responsible for increased mortality and a decline in the number of young being born. In parts of its range, accidental drowning in nets and traps set for fish and crustaceans is a further problem (1) (6). There are also growing concerns about the potential impact of a fungal disease, Mucormycosis, currently restricted to Tasmania. Platypuses that become infected with the disease develop ulcers on their body that can lead to death, due to secondary infection and an inability to control body temperature. It is not yet known what impact the disease is having on the abundance and distribution of the Tasmanian platypus population (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation of the Platypus is limited to its listing as a legally protected species in all states in which it occurs and its incidental inclusion in some national parks and reserves. Legislation prohibiting or controlling problematic fishing activities has been enacted in New South Wales and Victoria, but regulations concerning illegal netting and trapping are often poorly enforced. The most widespread field monitoring program for the species is in Victoria (Australian Platypus Conservancy). There are also a few system-specific studies in other states and community-based reporting of anecdotal occurrences of the species to a variety of institutional and private databases. Still more information about population numbers and monitoring are crucial, especially for a long-lived species such as the Platypus where a lack of recruitment can be masked until a dramatic population crash occurs as adults reach the end of their lifespan.

Population studies of fragmented populations should be a research priority, together with studies to help verify the current distribution and baseline population parameters in areas where the species has declined (Grant and Temple-Smith 2003). Once the Platypus becomes extinct in a river system, the likelihood of its re-colonising that system without human intervention is minimal (T. Grant, S. Munks, F. Carrick, and M. Serena pers. comm.). One reintroduction program is underway in a single fire-affected stream in Victoria (Australian Platypus Conservancy).

Some populations of Platypuses have exhibited antibodies to Leptospirosis, probably transmitted via cattle, but no clinical symptoms have been observed. Mortality from an ulcerative dermatitis caused by Mucor fungus, however, has been recorded in at least one river system in Tasmania. There is currently no active investigation of this disease, which should be a research priority both in that state and on the mainland where the fungus is also found (T. Grant, S. Munks, F. Carrick, and M. Serena pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The platypus is legally protected in all the states in which it occurs and populations are found in several protected national parks and reserves. Furthermore, fishing regulations, including the use of nets with larger mesh sizes, have helped to reduce the number of accidental deaths. In the absence of a reliable data, it is vital that research is carried out to determine baseline platypus population levels and trends (1) (6). This is to be supported by further research into platypus biology and the effects of human activities on the species, which will be used to inform conservation strategies (6). In addition, given the current threat of the spread of Mucormycosis, research into the fungal disease is also considered a huge priority (1) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Duck-billed platypuses eat trout (Salmonidae), which are considered a food source for humans. However, trout streams are not privately-owned in Australia so the effect of platypus predation on trouts is neither widely noticed nor regulated. They can harm humans with their venomous spurs if provoked (Grant and Temple-Smith, 1998).

Negative Impacts: injures humans (venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Duck-billed platypus skins were harvested by fur traders to make hats, slippers, and rugs. Harvesting was ended by a law passed in 1912 that protected platypuses from being hunted (Grant and Temple-Smith, 1998).

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Platypus

The platypus (Ornithorhynchus anatinus) is a semiaquatic mammal endemic to eastern Australia, including Tasmania. Together with the four species of echidna, it is one of the five extant species of monotremes, the only mammals that lay eggs instead of giving birth. It is the sole living representative of its family (Ornithorhynchidae) and genus (Ornithorhynchus), though a number of related species have been found in the fossil record.

The unusual appearance of this egg-laying, duck-billed, beaver-tailed, otter-footed mammal baffled European naturalists when they first encountered it, with some considering it an elaborate fraud. It is one of the few venomous mammals, the male platypus having a spur on the hind foot that delivers a venom capable of causing severe pain to humans. The unique features of the platypus make it an important subject in the study of evolutionary biology and a recognisable and iconic symbol of Australia; it has appeared as a mascot at national events and is featured on the reverse of its 20-cent coin. The platypus is the animal emblem of the state of New South Wales.[3]

Until the early 20th century, it was hunted for its fur, but it is now protected throughout its range. Although captive breeding programmes have had only limited success and the platypus is vulnerable to the effects of pollution, it is not under any immediate threat.

Contents

Taxonomy and etymology[edit]

When the platypus was first encountered by Europeans in 1798, a pelt and sketch were sent back to Great Britain by Captain John Hunter, the second Governor of New South Wales.[4] British scientists' initial hunch was that the attributes were a hoax.[5] George Shaw, who produced the first description of the animal in the Naturalist's Miscellany in 1799, stated it was impossible not to entertain doubts as to its genuine nature, and Robert Knox believed it might have been produced by some Asian taxidermist.[5] It was thought that somebody had sewn a duck's beak onto the body of a beaver-like animal. Shaw even took a pair of scissors to the dried skin to check for stitches.[6]

The common name "platypus" is the latinisation of the Greek word πλατύπους (platupous), "flat-footed",[7] from πλατύς (platus), "broad, wide, flat"[8] and πούς (pous), "foot".[9][10] Shaw assigned it as a Linnaean genus name when he initially described it, but the term was quickly discovered to belong already to the wood-boring ambrosia beetle (genus Platypus).[11] It was independently described as Ornithorhynchus paradoxus by Johann Blumenbach in 1800 (from a specimen given to him by Sir Joseph Banks)[12] and following the rules of priority of nomenclature, it was later officially recognised as Ornithorhynchus anatinus.[11] The scientific name Ornithorhynchus anatinus is derived from ορνιθόρυγχος (ornithorhynkhos), which literally means "bird snout" in Greek; and anatinus, which means "duck-like" in Latin.

There is no universally agreed plural of "platypus" in the English language. Scientists generally use "platypuses" or simply "platypus". Colloquially, the term "platypi" is also used for the plural, although this is technically incorrect and a form of pseudo-Latin;[6] the correct Greek plural would be "platypodes". Early British settlers called it by many names, such as watermole, duckbill, and duckmole.[6] The name "platypus" is often prefixed with the adjective "duck-billed" to form duck-billed platypus, despite there being only one species of platypus.[13]

Description[edit]

The body and the broad, flat tail of the platypus are covered with dense, brown fur that traps a layer of insulating air to keep the animal warm.[6][11] The fur is waterproof, and the texture is akin to that of a mole.[14] The platypus uses its tail for storage of fat reserves (an adaptation also found in animals such as the Tasmanian devil[15] and fat-tailed sheep). It has webbed feet and a large, rubbery snout; these features appear closer to those of a duck than to those of any known mammal. The webbing is more significant on the front feet and is folded back when walking on land.[11] Unlike a bird's beak (in which the upper and lower parts separate to reveal the mouth), the snout of the platypus is a sensory organ with the mouth on the underside. The nostrils are located on the dorsal surface of the snout, while the eyes and ears are located in a groove set just back from it; this groove is closed when swimming.[11] Platypuses have been heard to emit a low growl when disturbed and a range of other vocalisations have been reported in captive specimens.[6]

A colour print of platypuses from 1863

Weight varies considerably from 0.7 to 2.4 kg (1.5 to 5.3 lb), with males being larger than females; males average 50 cm (20 in) in total length, while females average 43 cm (17 in),[11] with substantial variation in average size from one region to another, and this pattern does not seem to follow any particular climatic rule and may be due to other environmental factors, such as predation and human encroachment.[16]

The platypus has an average body temperature of about 32°C (90°F) rather than the 37°C (99°F) typical of placental mammals.[17] Research suggests this has been a gradual adaptation to harsh environmental conditions on the part of the small number of surviving monotreme species rather than a historical characteristic of monotremes.[18][19]

Modern platypus young have three-cusped molars, which they lose before or just after leaving the breeding burrow;[20][21] adults have heavily keratinised pads in their place.[11] The platypus jaw is constructed differently from that of other mammals, and the jaw-opening muscle is different.[11] As in all true mammals, the tiny bones that conduct sound in the middle ear are fully incorporated into the skull, rather than lying in the jaw as in cynodonts and other premammalian synapsids. However, the external opening of the ear still lies at the base of the jaw.[11] The platypus has extra bones in the shoulder girdle, including an interclavicle, which is not found in other mammals.[11] It has a reptilian gait, with the legs on the sides of the body, rather than underneath.[11] When on land, it engages in knuckle-walking to protect the webbing between its toes.[22]

Venom[edit]

The calcaneus spur found on the male's hind limb is used to deliver venom.

While both male and female platypuses are born with ankle spurs, only the male's spurs produce a cocktail of venom,[23][24][25] composed largely of defensin-like proteins (DLPs), three of which are unique to the platypus.[26] The DLPs are produced by the immune system of the platypus. Although powerful enough to kill smaller animals such as dogs, the venom is not lethal to humans, but the pain is so excruciating, the victim may be incapacitated.[26][27] Oedema rapidly develops around the wound and gradually spreads throughout the affected limb. Information obtained from case histories and anecdotal evidence indicates the pain develops into a long-lasting hyperalgesia (a heightened sensitivity to pain) that persists for days or even months.[28][29] Venom is produced in the crural glands of the male, which are kidney-shaped alveolar glands connected by a thin-walled duct to a calcaneus spur on each hind limb. The female platypus, in common with echidnas, has rudimentary spur buds which do not develop (dropping off before the end of their first year) and lack functional crural glands.[11]

The venom appears to have a different function from those produced by nonmammalian species; its effects are not life-threatening to humans, but nevertheless powerful enough to seriously impair the victim. Since only males produce venom and production rises during the breeding season, it may be used as an offensive weapon to assert dominance during this period.[26]

Electrolocation[edit]

Platypus (Ornithorhynchus anatinus)

Monotremes (for the other species, see Echidna) are the only mammals (apart from at least one species of dolphin)[30] known to have a sense of electroreception: they locate their prey in part by detecting electric fields generated by muscular contractions. The platypus' electroreception is the most sensitive of any monotreme.[31][32]

The electroreceptors are located in rostrocaudal rows in the skin of the bill, while mechanoreceptors (which detect touch) are uniformly distributed across the bill. The electrosensory area of the cerebral cortex is contained within the tactile somatosensory area, and some cortical cells receive input from both electroreceptors and mechanoreceptors, suggesting a close association between the tactile and electric senses. Both electroreceptors and mechanoreceptors in the bill dominate the somatotopic map of the platypus brain, in the same way human hands dominate the Penfield homunculus map.[33][34]

The platypus can determine the direction of an electric source, perhaps by comparing differences in signal strength across the sheet of electroreceptors. This would explain the characteristic side-to-side motion of the animal's head while hunting. The cortical convergence of electrosensory and tactile inputs suggests a mechanism for determining the distance of prey items which, when they move, emit both electrical signals and mechanical pressure pulses; the difference between the times of arrival of the two signals would allow computation of distance.[32]

The platypus feeds by neither sight nor smell,[35] closing its eyes, ears, and nose each time it dives.[36] Rather, when it digs in the bottom of streams with its bill, its electroreceptors detect tiny electrical currents generated by muscular contractions of its prey, so enabling it to distinguish between animate and inanimate objects, which continuously stimulate its mechanoreceptors.[32] Experiments have shown the platypus will even react to an "artificial shrimp" if a small electrical current is passed through it.[37]

Eyes[edit]

Recent studies say that the eyes of the platypus could possibly be highly similar to those of Pacific hagfish or Northern Hemisphere lampreys than to those of most tetrapods. Also it contains double cones, which most mammals do not have.[38]

Although the platypus' eyes are small and not used under water, several features indicate that vision played an important role in its ancestors. The corneal surface and the adjacent surface of the lens is flat while the posterior surface of the lens is steeply curved, similar to the eyes of other aquatic mammals such otters and sea-lions. A temporal (ear side) concentration of retinal ganglion cells, important for binocular vision, indicates a role in predation, while the accompanying visual acuity is insufficient for such activities. Furthermore, this limited acuity is matched by a low cortical magnification, a small lateral geniculate nucleus and a large optic tectum, suggesting that the visual midbrain plays a more important role than the visual cortex like in some rodents. These features suggest that the platypus has adapted to an aquatic and nocturnal lifestyle, developing its electrosensory system at the cost of its visual system; an evolutionary process paralleled by the small number of electroreceptors in the short-beaked echidna, who dwells in dry environments, whilst the long-beaked echidna, who lives in moist environments, is intermediate between the other two monotremes.[33]

Ecology and behaviour[edit]

Dentition, as illustrated in Knight's Sketches in Natural History
The platypus is very difficult to spot even on the surface of a river.
Platypus swimming
Swimming underwater at Sydney Aquarium, Australia

The platypus is semiaquatic, inhabiting small streams and rivers over an extensive range from the cold highlands of Tasmania and the Australian Alps to the tropical rainforests of coastal Queensland as far north as the base of the Cape York Peninsula.[39] Inland, its distribution is not well known; it is extinct in South Australia (apart from an introduced population on Kangaroo Island)[40] and is no longer found in the main part of the Murray-Darling Basin, possibly due to the declining water quality brought about by extensive land clearing and irrigation schemes.[41] Along the coastal river systems, its distribution is unpredictable; it appears to be absent from some relatively healthy rivers, and yet maintains a presence in others that are quite degraded (the lower Maribyrnong, for example).[42]

In captivity, platypuses have survived to 17 years of age, and wild specimens have been recaptured when 11 years old. Mortality rates for adults in the wild appear to be low.[11] Natural predators include snakes, water rats, goannas, hawks, owls, and eagles. Low platypus numbers in northern Australia are possibly due to predation by crocodiles.[43] The introduction of red foxes in 1845 for hunting may have had some impact on its numbers on the mainland.[16] The platypus is generally regarded as nocturnal and crepuscular, but individuals are also active during the day, particularly when the sky is overcast.[44][45] Its habitat bridges rivers and the riparian zone for both a food supply of prey species, and banks where it can dig resting and nesting burrows.[45] It may have a range of up to 7 km (4.3 mi), with a male's home range overlapping those of three or four females.[46]

The platypus is an excellent swimmer and spends much of its time in the water foraging for food. When swimming, it can be distinguished from other Australian mammals by the absence of visible ears.[47] Uniquely among mammals, it propels itself when swimming by an alternate rowing motion of the front feet; although all four feet of the platypus are webbed, the hind feet (which are held against the body) do not assist in propulsion, but are used for steering in combination with the tail.[48] The species is endothermic, maintaining its body temperature at about 32°C (90°F), lower than most mammals, even while foraging for hours in water below 5°C (41°F).[11]

Dives normally last around 30 seconds, but can last longer, although few exceed the estimated aerobic limit of 40 seconds. Recovery at the surface between dives commonly takes from 10 to 20 seconds.[49][50] The platypus is a carnivore: it feeds on annelid worms, insect larvae, freshwater shrimps, and yabbies (freshwater crayfish) that it digs out of the riverbed with its snout or catches while swimming. It uses cheek-pouches to carry prey to the surface, where it is eaten.[47] The platypus needs to eat about 20% of its own weight each day, which requires it to spend an average of 12 hours daily looking for food.[49] When not in the water, the platypus retires to a short, straight resting burrow of oval cross-section, nearly always in the riverbank not far above water level, and often hidden under a protective tangle of roots.[47]

The average sleep time of a platypus is said to be as long as 14 hours per day, possibly because it eats crustaceans which provide a high level of calories.[51]

Reproduction[edit]

When the platypus was first encountered by European naturalists, they were divided over whether the female laid eggs. This was not confirmed until 1884, when W. H. Caldwell was sent to Australia, where, after extensive searching assisted by a team of 150 Aborigines, he managed to discover a few eggs.[11][26] Mindful of the high cost per word, Caldwell famously but tersely wired London, "Monotremes oviparous, ovum meroblastic." That is, monotremes lay eggs, and the eggs are similar to those of reptiles in that only part of the egg divides as it develops.

The species exhibits a single breeding season; mating occurs between June and October, with some local variation taking place between different populations across its range.[43] Historical observation, mark-and-recapture studies, and preliminary investigations of population genetics indicate the possibility of both resident and transient members of populations, and suggest a polygynous mating system.[52] Females are thought likely to become sexually mature in their second year, with breeding confirmed still to take place in animals over 9 years old.[52]

Outside the mating season, the platypus lives in a simple ground burrow, the entrance of which is about 30 cm (12 in) above the water level. After mating, the female constructs a deeper, more elaborate burrow up to 20 m (66 ft) long and blocked at intervals with plugs (which may act as a safeguard against rising waters or predators, or as a method of regulating humidity and temperature).[53] The male takes no part in caring for its young, and retreats to his year-long burrow. The female softens the ground in the burrow with dead, folded, wet leaves, and she fills the nest at the end of the tunnel with fallen leaves and reeds for bedding material. This material is dragged to the nest by tucking it underneath her curled tail.[6]

The female platypus has a pair of ovaries, but only the left one is functional.[44] The platypus' genes are a possible evolutionary link between XY and ZW sex-determination systems because they have the DMRT1 gene possessed by birds on their X chromosomes.[54] It lays one to three (usually two) small, leathery eggs (similar to those of reptiles), about 11 mm (0.43 in) in diameter and slightly rounder than bird eggs.[55] The eggs develop in utero for about 28 days, with only about 10 days of external incubation (in contrast to a chicken egg, which spends about one day in tract and 21 days externally).[44] After laying her eggs, the female curls around them. The incubation period is divided into three phases. In the first phase, the embryo has no functional organs and relies on the yolk sac for sustenance. The yolk is absorbed by the developing young.[56] During the second phase, the digits develop, and in the last phase, the egg tooth appears.[57]

The newly hatched young are vulnerable, blind, and hairless, and are fed by the mother's milk. Although possessing mammary glands, the platypus lacks teats. Instead, milk is released through pores in the skin. The milk pools in grooves on her abdomen, allowing the young to lap it up.[6][43] After they hatch, the offspring are suckled for three to four months. During incubation and weaning, the mother initially leaves the burrow only for short periods, to forage. When doing so, she creates a number of thin soil plugs along the length of the burrow, possibly to protect the young from predators; pushing past these on her return forces water from her fur and allows the burrow to remain dry.[58] After about five weeks, the mother begins to spend more time away from her young and, at around four months, the young emerge from the burrow.[43] A platypus is born with teeth, but these drop out at a very early age, leaving the horny plates with which it grinds its food.[59]

Evolution[edit]

Platypus skeleton

The platypus and other monotremes were very poorly understood, and some of the 19th century myths that grew up around them—for example, that the monotremes were "inferior" or quasireptilian—still endure.[60] In 1947, William King Gregory theorised that placental mammals and marsupials may have diverged earlier, and a subsequent branching divided the monotremes and marsupials, but later research and fossil discoveries have suggested this is incorrect.[60][61] In fact, modern monotremes are the survivors of an early branching of the mammal tree, and a later branching is thought to have led to the marsupial and placental groups.[60][62] Molecular clock and fossil dating suggest platypuses split from echidnas around 19–48 million years ago.[63]




Platypus



Echidnas



 live birth 

Marsupials


 true placenta 

Eutherians




Evolutionary relationships between the platypus and other mammals.[64]

The oldest discovered fossil of the modern platypus dates back to about 100,000 years ago, during the Quaternary period. The extinct monotremes Teinolophos and Steropodon were closely related to the modern platypus.[61] The fossilised Steropodon was discovered in New South Wales and is composed of an opalised lower jawbone with three molar teeth (whereas the adult contemporary platypus is toothless). The molar teeth were initially thought to be tribosphenic, which would have supported a variation of Gregory's theory, but later research has suggested, while they have three cusps, they evolved under a separate process.[20] The fossil is thought to be about 110 million years old, which means the platypus-like animal was alive during the Cretaceous period, making it the oldest mammal fossil found in Australia. Monotrematum sudamericanum, another fossil relative of the platypus, has been found in Argentina, indicating monotremes were present in the supercontinent of Gondwana when the continents of South America and Australia were joined via Antarctica (up to about 167 million years ago).[20][65]

Because of the early divergence from the therian mammals and the low numbers of extant monotreme species, the platypus is a frequent subject of research in evolutionary biology. In 2004, researchers at the Australian National University discovered the platypus has ten sex chromosomes, compared with two (XY) in most other mammals (for instance, a male platypus is always XYXYXYXYXY),[66] although given the XY designation of mammals, the sex chromosomes of the platypus are more similar to the ZZ/ZW sex chromosomes found in birds.[67] The platypus genome also has both reptilian and mammalian genes associated with egg fertilisation.[35][68] Since the platypus lacks the mammalian sex-determining gene SRY, the mechanism of sex determination remains unknown.[69] A draft version of the platypus genome sequence was published in Nature on 8 May, 2008, revealing both reptilian and mammalian elements, as well as two genes found previously only in birds, amphibians, and fish. More than 80% of the platypus' genes are common to the other mammals whose genomes have been sequenced.[35]

Conservation status[edit]

A depiction of a platypus from a book for children published in Germany in 1798

Except for its loss from the state of South Australia, the platypus occupies the same general distribution as it did prior to European settlement of Australia. However, local changes and fragmentation of distribution due to human modification of its habitat are documented. Its current and historical abundance, however, are less well-known and it has probably declined in numbers, although still being considered as common over most of its current range.[45] The species was extensively hunted for its fur until the early years of the 20th century and, although protected throughout Australia since 1905,[58] until about 1950 it was still at risk of drowning in the nets of inland fisheries.[41] The platypus does not appear to be in immediate danger of extinction, because conservation measures have been successful, but it could be impacted by habitat disruption caused by dams, irrigation, pollution, netting, and trapping.[2] The IUCN lists the platypus on its Red List as Least Concern.[2]

Platypuses generally suffer from few diseases in the wild; however, public concern in Tasmania is widespread about the potential impacts of a disease caused by the fungus Mucor amphibiorum. The disease (termed mucormycosis) affects only Tasmanian platypuses, and has not been observed in platypuses in mainland Australia. Affected platypuses can develop ugly skin lesions or ulcers on various parts of their bodies, including their backs, tails, and legs. Mucormycosis can kill platypuses, death arising from secondary infection and by affecting the animals' ability to maintain body temperature and forage efficiency. The Biodiversity Conservation Branch at the Department of Primary Industries and Water are collaborating with NRM north and University of Tasmania researchers to determine the impacts of the disease on Tasmanian platypuses, as well as the mechanism of transmission and current spread of the disease.[70] Until recently, the introduced red fox (Vulpes vulpes) was confined to mainland Australia, but growing evidence now indicates it is present in low numbers in Tasmania.[71]

Much of the world was introduced to the platypus in 1939 when National Geographic Magazine published an article on the platypus and the efforts to study and raise it in captivity. The latter is a difficult task, and only a few young have been successfully raised since, notably at Healesville Sanctuary in Victoria. The leading figure in these efforts was David Fleay, who established a platypusary—a simulated stream in a tank—at the Healesville Sanctuary, where breeding was successful in 1943. In 1972, he found a dead baby of about 50 days old, which had presumably been born in captivity, at his wildlife park at Burleigh Heads on the Gold Coast, Queensland.[72] Healesville repeated its success in 1998 and again in 2000 with a similar stream tank. Taronga Zoo in Sydney bred twins in 2003, and breeding was again successful there in 2006.[73]

Platypus in wildlife sanctuaries[edit]

Platypus House at Lone Pine Koala Sanctuary in Brisbane, Queensland

As of 2013, there are no platypuses in captivity outside of Australia. Three attempts were made to bring the animals to the Bronx Zoo, in 1922, 1947, and 1958; of these, only two of the three animals introduced in 1947 lived longer than eighteen months.[74] The platypus can be seen in special aquariums at the following Australian wildlife sanctuaries:

Cultural references[edit]

The platypus has been featured in the Dreamtime stories of indigenous Australians, who believed the animal was a hybrid of a duck and a water rat.[76]:57–60 According to one story, the major animal groups, the land animals, water animals and birds, all competed for the platypus to join their respective groups, but the platypus ultimately decided to not join any of them, feeling that he did not need to be part of a group to be special.[76]:83–85

The platypus has been used several times as a mascot: "Syd" the platypus was one of the three mascots chosen for the Sydney 2000 Olympics along with an echidna and a kookaburra,[77] "Expo Oz" the platypus was the mascot for World Expo 88, which was held in Brisbane in 1988,[78] and Hexley the platypus is the mascot for Apple Computer's BSD-based Darwin operating system, Mac OS X.[79] The platypus is also the mascot for the currently inactive Wenatchee Valley Venom arena football team located in Wenatchee, Washington. The Platypus Trophy was made as an award for the winner of the college rivalry between the Oregon Ducks and the Oregon State Beavers.

Big Platypus at the Australian Axeman's Hall of Fame

The platypus has also been featured in songs, such as Green Day's "Platypus (I Hate You)" and Mr. Bungle's "Platypus". It is the subject of a children's poem by Banjo Paterson,[80] and it also frequently appears as a character in children's television programmes, for example, the Platypus Family on Mister Rogers' Neighborhood, as well as Perry the Platypus on the show Phineas and Ferb, and Ovide, the star of the cartoon Ovide and the Gang.[81] An Australian series of books written by Dorothy Wall in the 1930s features Flap the Platypus as a friend of Blinky Bill.

In the 1980s, the platypus was the main animal featured on promotional ads for the educational animal encyclopedia Wildlife Treasury. In the advertisement, an excited young boy exclaims: "The duck-billed platypus has feet like a duck, but it's furry! It's all in my Wildlife Treasury!"[citation needed] Platypus Man was a short-lived, 1995 sitcom aired on Fox Television and/or UPN in the United States. Fox also had an animated program called Taz-Mania, featuring the Platypus Brothers.: Daniel and Timothy.[citation needed] Since the introduction of decimal currency to Australia in 1966, the embossed image of a platypus, designed and sculpted by Stuart Devlin, has appeared on the reverse (tails) side of the 20-cent coin.[82]

The platypus is sometimes jokingly referred to as proof that God has a sense of humour (at the beginning of the film Dogma, for example; Robin Williams implied he was also stoned on marijuana at the time.[83]) It is also often used humorously (along with the camel) to describe something designed by committee. For the Star Trek: The Next Generation novel Q-Squared, the titled character claims (in private) to a disbelieving Capt. Picard he personally influenced God's decision to create/evolve the platypus. In the episode, "The Truth in the Myth" on Bones, when the team was studying a murdered victim who was supposed to be killed by the cryptic animal, chupacabra, Dr. Saroyan questions the very existence of such a creature, in which intern Vincent Nigel-Murray responded, "I'd be skeptical if you told me there was a venomous, egg-laying, duck-billed, beaver-tailed mammal, and yet the platypus, it does exist."[citation needed]

See also[edit]

Notes[edit]

  1. ^ Groves, C. P. (2005). "Order Monotremata". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 2. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Lunney, D., Dickman, C., Copely, P., Grant, T., Munks, S., Carrick, F., Serena, M. & Ellis, M. (2008). Ornithorhynchus anatinus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 9 October 2008. D
  3. ^ Government of New South Wales (2008). "Symbols & Emblems of NSW". Archived from the original on 23 July, 2008. Retrieved 29-12-2008. 
  4. ^ Hall, Brian K. (March 1999). "The Paradoxical Platypus". BioScience 49 (3): 211–8. doi:10.2307/1313511. JSTOR 1313511. 
  5. ^ a b "Duck-billed Platypus". Museum of hoaxes. Retrieved 21-07-2010. 
  6. ^ a b c d e f g "Platypus facts file". Australian Platypus Conservancy. Retrieved 13-09-2006. 
  7. ^ πλατύπους, Henry George Liddell, Robert Scott, A Greek-English Lexicon, on Perseus
  8. ^ πλατύς, A Greek-English Lexicon, on Perseus
  9. ^ πούς, A Greek-English Lexicon, on Perseus
  10. ^ Liddell & Scott (1980). Greek-English Lexicon, Abridged Edition. Oxford University Press, Oxford, UK. ISBN 0-19-910207-4. 
  11. ^ a b c d e f g h i j k l m n o Grant, J.R. "Ch. 16". Fauna of Australia 1b. Australian Biological Resources Study (ABRS). Retrieved 13-09-2006. 
  12. ^ "Platypus Paradoxes". National Library of Australia. August 2001. Retrieved 2006-09-14. 
  13. ^ "The Platypus". Department of Anatomy & Physiology, University of Tasmania. 3 July, 1997. Archived from the original on 30 August, 2006. Retrieved 14-09-2006. 
  14. ^ "Platypus : Facts, Pictures : Animal Planet". Animal.discovery.com. 16 November, 2011. Retrieved 08-09-2012. 
  15. ^ Guiler, E.R. (1983). "Tasmanian Devil". In R. Strahan Ed. The Australian Museum Complete Book of Australian Mammals. Angus & Robertson. pp. 27–28. ISBN 0-207-14454-0. 
  16. ^ a b Sarah Munks and Stewart Nicol (May 1999). "Current research on the platypus, Ornithorhynchus anatinus in Tasmania: Abstracts from the 1999 'Tasmanian Platypus WORKSHOP'". University of Tasmania. Archived from the original on 30 August, 2006. Retrieved 23-10-2006. 
  17. ^ "Thermal Biology of the Platypus". Davidson College. 1999. Retrieved 14-09-2006. 
  18. ^ J.M. Watson and J.A.M. Graves (1988). "Monotreme Cell-Cycles and the Evolution of Homeothermy". Australian Journal of Zoology (CSIRO) 36 (5): 573–584. doi:10.1071/ZO9880573. 
  19. ^ Dawson, T.J.; Grant, T.R.; Fanning, D. (1979). "Standard Metabolism of Monotremes and the Evolution of Homeothermy". Australian Journal of Zoology (CSIRO) 27 (4): 511–5. doi:10.1071/ZO9790511. 
  20. ^ a b c Pascual, R.; Goin, F.J.; Balarino, L.; Udrizar Sauthier, D.E. (2002). "New data on the Paleocene monotreme Monotrematum sudamericanum, and the convergent evolution of triangulate molars" (PDF). Acta Palaeontologica Polonica 47 (3): 487–492. 
  21. ^ Hugh Race. "Living mammals are placentals (eutheria), marsupials, and monotremes". Geowords. Archived from the original on 3 September, 2006. Retrieved 19-09-2006. 
  22. ^ Fish FE, Frappell PB, Baudinette RV, MacFarlane PM (February 2001). "Energetics of terrestrial locomotion of the platypus Ornithorhynchus anatinus" (PDF). J. Exp. Biol. 204 (Pt 4): 797–803. PMID 11171362. 
  23. ^ "Australian Fauna". Australian Fauna. Retrieved 14-05-2010. 
  24. ^ "Platypus venom linked to pain relief". University of Sydney. 8 May, 2008. Retrieved 14-05-2010. 
  25. ^ "Platypus poison". Rainforest Australia. Retrieved 14-05-2010. 
  26. ^ a b c d Gerritsen, Vivienne Baillie (December 2002). "Platypus poison". Protein Spotlight (29). Retrieved 14-09-2006. 
  27. ^ Evolution of platypus venom revealed Cosmos 4 July, 2007
  28. ^ de Plater, G.M.; Milburn, P.J.; Martin, R.L. (1 March, 2001). "Venom From the Platypus, Ornithorhynchus anatinus, Induces a Calcium-Dependent Current in Cultured Dorsal Root Ganglion Cells". Journal of Neurophysiology 85 (3): 1340–5. PMID 11248005. 
  29. ^ "The venom of the platypus (Ornithorhynchus anatinus)". Retrieved 13-09-2006. 
  30. ^ Black, Richard (26 July, 2011). "Dolphin hunts with electric sense". BBC News. Retrieved 26-12-2012. 
  31. ^ Proske, Uwe; Gregory, J. E.; Iggo, A. (1998). "Sensory receptors in monotremes". Philosophical Transactions of the Royal Society of London 353 (1372): 1187–98. doi:10.1098/rstb.1998.0275. PMC 1692308. PMID 9720114. 
  32. ^ a b c Pettigrew, John D. (1999). "Electroreception in Monotremes" (PDF). The Journal of Experimental Biology 202 (Pt 10): 1447–54. PMID 10210685. 
  33. ^ a b Pettigrew, John D.; Manger, P.R.; Fine, S.L. (1998). "The sensory world of the platypus". Philosophical Transactions of the Royal Society of London 353 (1372): 1199–1210. doi:10.1098/rstb.1998.0276. PMC 1692312. PMID 9720115. 
  34. ^ Dawkins, Richard (2004). "The Duckbill's Tale". The Ancestor's Tale, A Pilgrimage to the Dawn of Life. Boston MA: Houghton Mifflin. ISBN 0-618-00583-8. 
  35. ^ a b c Warren, Wesley C.; Hillier, LW; Marshall Graves, JA; Birney, E; Ponting, CP; Grützner, F; Belov, K; Miller, W et al. (May 8, 2008). "Genome analysis of the platypus reveals unique signatures of evolution" (PDF). Nature 453 (7192): 175–183. doi:10.1038/nature06936. PMC 2803040. PMID 18464734. [Nature Podcast 08-05-2008 Lay summary]. 
  36. ^ Gregory, J.E.; Iggo, A.; McIntyre, A.K.; Proske, U. (June 1988). "Receptors in the Bill of the Platypus" (PDF). Journal of Physiology 400 (1): 349–366. 
  37. ^ Manning, A.; Dawkins, M.S. (1998). An Introduction to Animal Behaviour (5th ed.). Cambridge University Press. 
  38. ^ Zeiss, Caroline. Comparative retinal morphology of the platypus. doi:10.1002/jmor.10959. 
  39. ^ "Platypus". Department of Primary Industries and Water, Tasmania. 31 August, 2006. Retrieved 12-10-2006. 
  40. ^ "Research on Kangaroo Island". University of Adelaide. 4 July, 2006. Retrieved 23-10-2006. 
  41. ^ a b Scott, Anthony; Grant, Tom (November 1997). "Impacts of water management in the Murray-Darling Basin on the platypus (Ornithorhynchus anatinus) and the water rat (Hydromus chrysogaster)" (PDF). CSIRO Australia. Retrieved 23-10-2006. 
  42. ^ "Platypus in Country Areas". Australian Platypus Conservancy. Retrieved 23-10-2006. 
  43. ^ a b c d "Platypus". Environmental Protection Agency/Queensland Parks and Wildlife Service. 2006. Retrieved 2009-07-24. 
  44. ^ a b c Erica Cromer (14 April, 2004). "Monotreme Reproductive Biology and Behavior". Iowa State University. Retrieved 18-06-2009. 
  45. ^ a b c Grant, T.G.; Temple-Smith, P.D. (29 July, 1998). "Field biology of the platypus (Ornithorhynchus anatinus): historical and current perspectives". Philosophical Transactions: Biological Sciences (The Royal Society) 353 (1372): 1081–91. doi:10.1098/rstb.1998.0267. PMC 1692311. PMID 9720106. 
  46. ^ Gardner, J.L.; Serena, M. (1995). "Spatial-Organization and Movement Patterns of Adult Male Platypus, Ornithorhynchus-Anatinus (Monotremata, Ornithorhynchidae)". Australian Journal of Zoology (CSIRO) 43 (1): 91–103. doi:10.1071/ZO9950091. 
  47. ^ a b c "Platypus" (PDF). Parks and Wildlife Service Tasmania. February 2008. Retrieved 2009-06-18. 
  48. ^ Fish, F.E.; Baudinette, R.V.; Frappell, P.B.; Sarre, M.P. (28 July, 1997). "Energetics of Swimming by the Platypus Ornithorhynchus Anatinus: Metabolic Effort Associated with Rowing" (PDF). The Journal of Experimental Biology 200 (20): 2647–52. PMID 9359371. 
  49. ^ a b Philip Bethge (April 2002). "Energetics and foraging behaviour of the platypus" (PDF). University of Tasmania. Retrieved 2009-06-21. 
  50. ^ H. Kruuk (1993). "The Diving Behaviour of the Platypus (Ornithorhynchus anatinus) in Waters with Different Trophic Status". The Journal of Applied Ecology 30 (4): 592–598. doi:10.2307/2404239. JSTOR 2404239. 
  51. ^ Holland, Jennifer S. (July 2011). 40 Winks?National Geographic 220 (1). 
  52. ^ a b T.R. Grant, M. Griffiths and R.M.C. Leckie (1983). "Aspects of Lactation in the Platypus, Ornithorhynchus anatinus (Monotremata), in Waters of Eastern New South Wales". Australian Journal of Zoology (1983) 31 (6): 881–889. doi:10.1071/ZO9830881. 
  53. ^ Anna Bess Sorin and Phil Myers (2001). "Family Ornithorhynchidae (platypus)". University of Michigan Museum of Zoology. Retrieved 2006-10-24. 
  54. ^ Graves, Jennifer (10 March, 2006). "Sex Chromosome Specialization and Degeneration in Mammals". Cell 124 (5): 901–914. doi:10.1016/j.cell.2006.02.024. PMID 16530039.
  55. ^ R. L. Hughes and L. S. Hall (28 July, 1998). "Early development and embryology of the platypus". Philosophical Transactions of the Royal Society B: Biological Sciences (The Royal Society) 353 (1372): 1101–1114. doi:10.1098/rstb.1998.0269. PMC 1692305. PMID 9720108. 
  56. ^ "Ockhams Razor". The Puzzling Platypus. Retrieved 2006-12-02. 
  57. ^ Paul R. Manger, Leslie S. Hall, John D. Pettigrew (29 July, 1998). "The development of the external features of the platypus (Ornithorhynchus anatinus)". Philosophical Transactions: Biological Sciences (The Royal Society) 353 (1372): 1115–1125. doi:10.1098/rstb.1998.0270. PMC 1692310. PMID 9720109. 
  58. ^ a b "Egg-laying mammals" (PDF). Queensland Museum. November 2000. Archived from the original on 22 July, 2008. Retrieved 19-06-2009. 
  59. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press ISBN 0-313-33922-8.
  60. ^ a b c John A. W. Kirsch and Gregory C. Mayer (29 July, 1998). "The platypus is not a rodent: DNA hybridization, amniote phylogeny and the palimpsest theory". Philosophical Transactions: Biological Sciences 353 (1372): 1221–1237. doi:10.1098/rstb.1998.0278. PMC 1692306. PMID 9720117. 
  61. ^ a b Rauhut, O.W.M.; Martin, T.; Ortiz-Jaureguizar, E.; Puerta, P. (14 March, 2002). "The first Jurassic mammal from South America" (DOC). Nature 416 (6877): 165–8. doi:10.1038/416165a. PMID 11894091. 
  62. ^ Messer, M.; Weiss, A.S.; Shaw, D.C.; Westerman, M. (March 1998). "Evolution of the Monotremes: Phylogenetic Relationship to Marsupials and Eutherians, and Estimation of Divergence Dates Based on α-Lactalbumin Amino Acid Sequences". Journal of Mammalian Evolution (Springer Netherlands) 5 (1): 95–105. doi:10.1023/A:1020523120739. 
  63. ^ Phillips MJ, Bennett TH, Lee MS (2009). "Molecules, morphology, and ecology indicate a recent, amphibious ancestry for echidnas". Proc. Natl. Acad. Sci. U.S.A. 106 (40): 17089–94. doi:10.1073/pnas.0904649106. PMC 2761324. PMID 19805098. 
  64. ^ Lecointre G, Le Guyader H (2006) The Tree of Life: A Phylogenetic Classification. Harvard University Press.
  65. ^ Tim Folger (January 1993). "A platypus in Patagonia—Ancient life". Discover. Archived from the original on 12 October, 2007. Retrieved 2006-10-17. 
  66. ^ Selim, Jocelyn (April 25, 2005). "Sex, Ys, and Platypuses". Discover. Retrieved 07-05-2008-05. 
  67. ^ Grützner, Frank; Willem Rens, Enkhjargal Tsend-Ayush, Nisrine El-Mogharbel1, Patricia C. M. O'Brien, Russell C. Jones, Malcolm A. Ferguson-Smith & Jennifer A. Marshall Graves (December 16, 2004). "In the platypus a meiotic chain of ten sex chromosomes shares genes with the bird Z and mammal X chromosomes". Nature 432 (7019): 913–7. doi:10.1038/nature03021. PMID 15502814. 
  68. ^ "Beyond the Platypus Genome – 2008 Boden Research Conference". Reprod Fertil Dev. 21 (8): i–ix, 935–1027. 2009. 
  69. ^ "Explore the Platypus genome". Ensembl. November 2006. Retrieved 19-01-2007. [dead link]
  70. ^ "Platypus Fungal Disease". Department of Primary Industries and Water, Tasmania. 29 August, 2008. Retrieved 29-02-2008. 
  71. ^ "DPIW – Foxes in Tasmania". Dpiw.tas.gov.au. 3 May, 2010. Retrieved 14-05-2010. 
  72. ^ "David Fleay's achievements". Queensland Government. 23 November, 2003. Archived from the original on 2 October, 2006. Retrieved 13-09-2006. 
  73. ^ "Platypus". Catalyst. November 13, 2003. Retrieved 2006-09-13. 
  74. ^ Lee S. Crandall, The Management of Wild Mammals in Captivity. University of Chicago Press, 1964.
  75. ^ "Lone Pine Koala Sanctuary". Koala.net. Retrieved 08-09-2012. 
  76. ^ a b McKay, Helen F,; McLeod, Pauline E.; Jones, Francis F.; Barber, June E. (2001). Gadi Mirrabooka: Australian Aboriginal Tales from the Dreaming. Libraries Unlimited. ISBN 1563089238. 
  77. ^ "A Brief History of the Olympic and Paralympic Mascots". Beijing2008. 5 August, 2004. Retrieved 25-10-2006. 
  78. ^ "About World Expo '88". Foundation Expo '88. 1988. Retrieved 17-12-2007. 
  79. ^ "The Home of Hexley the Platypus". Retrieved 25-10-2006. 
  80. ^ Banjo Paterson (1933). "Old Man Platypus". The Animals Noah Forgot. Endeavour Press. Retrieved 04-09-2008. 
  81. ^ "Ovide and the Gang". IMDb. Retrieved 25-12-2006. 
  82. ^ "twenty cents". Royal Australian Mint. Retrieved 1-04-2013. 
  83. ^ Robin Williams - Platypus on YouTube

References[edit]

Books
Documentary
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!