Overview

Brief Summary

Biology

The common brushtail possum is largely nocturnal and arboreal, and is an agile climber (2) (3) (4), although it may also travel along the ground (3) (6). The diet varies depending on the location, but typically includes leaves, flowers, shoots, fruits and seeds, as well as insects, birds' eggs and occasionally other small animals, such as young birds. The common brushtail possum is mainly solitary, maintaining spacing between individuals using a mixture of scent-marking, vocalisations and agonistic encounters. One of the most vocal groups of marsupials, brushtail possums communicate with a range of calls, including clicks, grunts, hisses, alarm chatters, guttural coughs, and screeching (2) (3) (4). Breeding may occur at any time of year, particularly in northern Australia, but usually peaks in spring (September to November) and autumn (March to May) in other areas. In some areas, females may give birth in both seasons. The female common brushtail possum usually gives birth to a single young, after a gestation period of 16 to 18 days (2) (3) (4). Measuring just 1.5 centimetres at birth, and weighing a mere 2 grams (5), the tiny newborn climbs, unaided, through the female's fur and into the pouch, where it attaches to one of two teats, remaining inside the pouch for a further four to five months. The young common brushtail possum is then left in the den or rides on the female's back until around seven to nine months old (2) (3). Females begin to breed at around a year old, and males by the end of the second year (2) (3) (4), with young females usually establishing a home range adjacent to that of the adult female, while young males disperse further afield (3) (7). Lifespan may be up to 13 years in the wild (2) (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Brushtail possums are the most abundant, widely distributed and frequently encountered of all Australian marsupials (4) (5). As its name suggests, the common brushtail possum has a rather bushy tail, which is prehensile at the tip and has a naked patch on the underside, helping it to grip branches (2) (3) (4). The foreclaws are sharp and the hind foot bears an opposable, clawless first toe which gives a good grasp (3) (4). The second and third toes are fused, with a long, split claw, used in grooming (3). The fur of the common brushtail possum is thick and woolly (2) (5), and quite variable in colour, ranging from silvery-grey, to brown, black, red or cream, lighter on the underparts, and with a brown to black tail (2) (3) (4) (6). The ears are large and pointed, and there are dark patches on the muzzle (3). A number of subspecies are recognised, based on variations in colour and body size, with individuals in Tasmania generally being the largest, with dense, often black coats, and particularly bushy tails (2) (3) (4). The male common brushtail possum is generally larger than the female, and the male's coat usually blends to reddish across the shoulders. The female common brushtail possum has a well-developed, forward-opening pouch (2) (4) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Trichosurus vulpecula has the widest distribution of any Australian mammal. It can be found throughout most of Australia and Tasmania. It also thrives in New Zealand, where it was introduced in 1840.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

The Common Brushtail Possum is endemic to Australia where it is widespread. It ranges over much of northern, eastern, and south-western Australia. It occurs as scattered populations in the arid central part of the country. It is also present on the island of Tasmania and a number of offshore islands (e.g., Barrow, Kangaroo, and the Bass Strait Islands) (Kerle and How 2008). There is a large, introduced population in New Zealand (not mapped) (Kerle and How 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The common brushtail possum is widespread throughout Australia, and is also found on Tasmania and a number of other offshore islands, including Barrow Island and Kangaroo Island. The species has also been introduced to New Zealand, where it is now widespread (1) (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Body Length: 320-580 mm

Tail Length: 240-350 mm

Trichosurus vulpecula has large eyes and tall rounded ears. Its fur is short but dense, and its tail is typically long and is covered in long bushy fur. In some subspecies, the fur on the tail is the same length as on the rest of the body.

Throughout its range, there is considerable variation in the coat color of Trichosurus vulpecula. Color seems to vary according to habitat, and several subspecies have been identified.

Three of the subspecies are typically grey in color: T.v. vulpecula is found throughout southern Australia; T.v. arnhemensis is found in the northern tropical regions of Australia; and T.v. eburacensis is found in Cape York. T.v. johnsoni is found in eastern Queensland, and is typically red in color. The subspecies T.v. fuliginosus, which is found in Tasmania, has black coat coloration.

In all subspecies, the underside is lighter in color. A scent gland located on the chest is used to mark territories. The reddish secretions from this gland give the fur around it a brown or reddish appearance. Like most marsupials, the females have a small, forward opening pouch that is used in reproduction.

Range mass: 1200 to 4500 g.

Average basal metabolic rate: 3.8 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a largely arboreal, nocturnal species, that is generally found in dry eucalypt forests and woodlands. Large populations of this species can be found in pine plantations and suburban and urban areas (Kerle and How 2008). It breeds year round in some areas, in others it will breed in one or two seasons. Females begin breeding at about one year of age and a single young is born after a getstation period of 16 to 18 days; it has a pouch life of four to five months (Kerle and How 2008).

This species is commercially harvested in Tasmania. On Kangaroo Island, it is treated as a pest species (to humans and other threatened species) and there are removal permits. It is major a pest species in pine plantations in Australia where it can do considerable damage, and acts as a host of bovine tuberculosis in New Zealand (Kerle and How 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichosurus vulpecula usually resides in forested or woodland areas. These habitats vary greatly throughout its range. In Tasmania, Trichosurus vulpecula can be found throughout the rainforests and dry woodlands that cover over 60% of the area. In the Australian northwest, it prefers eucalyptus forests and mangroves. In southern Australia, they also reside in wooded areas, but are sometimes found living a semi-terrestrial life where they den in rock crevasses and termite mounds (Smith et al,(49)1984). In New Zealand, Trichosurus vulpecula can be found in most forested areas.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species occupies a wide range of habitats, including rainforest, woodland, dry eucalypt forest, pine plantations, semiarid areas and even urban gardens and parks (1) (2) (3) (4). Although generally found in forest habitats, it may also inhabit treeless areas (2) (5). The common brushtail possum shelters by day in a den, which may be located in a tree hollow, log, dense undergrowth, cave, animal burrow, or even in the roof-space of a house (2) (3) (5)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Trichosurus vulpecula typically eats leaves, shoots, and flowers. Researchers have noted its great ability to adapt to a number of dietary resources including a large number of highly toxic flowers and leaves. Throughout most of its range, it prefers to feed on Eucalyptus flowers, but will eat from a number of various trees and shrubs. In addition, it eats clovers, grasses, garden fruits and turnips.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Vertebrate Associates on Kangaroo Island, Australia

The Common Brush-tailed Possum (Trichosurus vulpecula) is a widespread folivore native to Australia, and specifically found on Kangaroo Island, among other locales in Australia. Perhaps the most notable mammal associate on the island is the Kangaroo Island endemic  Kangaroo (Macropus fuliginosus fuliginosus), the icon for whom the island was named upon European discovery in 1802. A smaller marsupial present on the island is the Tammar Wallaby (Macropus eugenii). An endemic dasyurid is the Critically Endangered Kangaroo Island Dunnart (Sminthopsis aitkeni), which is found only in the west of the island in Eucalyptus remota/E. cosmophylla open low mallee, E. baxteri low woodland or E. baxteri/E. remota low open woodland.

Monotremes are also represented on the island. There is also an introduced population of the Duck-billed Platypus (Ornithorhynchus anatinus) in the western part of the island in Flinders Chase National Park. The Short-beaked Echidna (Tachyglossus aculeatus) is also found moderately widespread on Kangaroo Island.

Chiroptera species on Kangaroo Island include the Yellow-bellied Pouched Bat (Saccolaimus flaviventris), which species is rather widespread in Australia and also occurs in Papua New Guinea. Australia's largest molossid, the White-striped Free-tail Bat (Tadarida australis) is found on Kangaroo Island. Another bat found on the island is the Southern Forest Bat (Eptesicus regulus), a species endemic to southern Australia (including Tasmania).

Several anuran species are found on Kangaroo island: Brown Tree Frog (Litoria ewingii), Spotted Marsh Frog (Limnodynastes tasmaniensis), Painted Spadefoot Frog (Neobatrachus pictus), Brown Toadlet (Pseudophryne bibroni) and Brown Froglet (Crinia signifera).

The Heath Monitor (Varanus rosenbergi ) is a lizard that grows up to a metre in length, preying on smaller reptiles, juvenile birds and eggs; it is frequently observed on warmer days basking in the sunlight or scavenging on roadkill. The Black Tiger Snake (Notechis ater) is found on Kangaroo Island. Another reptile particularly associated with this locale is the Kangaroo Island Copperhead (Austrelaps labialis).

The Glossy Black Cockatoo (Calyptorhynchus lathami) is found on the island, especially in the western part, where its preferred food, fruit of the Drooping Sheoak, is abundant. The Kangaroo Island Emu (Dromaius baudinianus) became extinct during the 1820s from over-hunting and habitat destruction due to burning.

Marine mammals that are observed on the island include the Australian Sea Lion (Neophoca cinerea) and New Zealand Fur Seal (Arctocephalus forsteri), each species of which is native to Kangaroo Island, and abundant at Admiral's Arch as well as at Seal Bay.

Kangaroo Island is not so adversely impacted by alien species grazers as parts of the mainland. No rabbit species are present on the island, and introduced (but escaped) Domestic Goats (Capra hircus) and pigs (Sus scrofa) have generated only minor issues. However, a Koala (Phascolarctos cinereus) population introduced to the island in the 1920s has caused significant damage to certain woodland communities, especially to Manna Gum trees.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
13.0 years.

Average lifespan

Status: wild:
13.0 years.

Average lifespan

Status: captivity:
14.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.9 years (captivity) Observations: Only 25% of individuals survive to live a second year. Compared to other species of the same genus, development appears to be faster in these animals (Ronald Nowak 1999). One captive specimen lived for 15.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

There are typically two breeding seasons for Trichosurus vulpecula throughout the year. It is rare for a female to give birth twice in one year however. The highest number of births occur in the fall, with fewer occurring in the spring. Some populations of the subspecies T.v. arnhemensis are known to breed continuously throughout the year.

The females' estrous cycle lasts for about 25 days. The gestation period is around 18 days, and a single young emerges from the pouch in about 4 months. The young are typically weaned by about 6 months, and disperse anytime between 8 and 18 months. Females can reproduce by about 12 months of age, and males typically reach sexual maturity by age 2. They have an average life span of 7 years in the wild. (One Trichosurus vulpecula survived in captivity for over 14 years.)

The mortality rate for Trichosurus vulpecula is 75% in individuals around 1 year of age. That number drops considerably as the young mature and, in adult Trichosurus vulpecula, the mortality rate is only around 20%.

Average birth mass: 0.279 g.

Average gestation period: 17 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
315 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trichosurus vulpecula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTACCCGTTGATTATTCTCAACTAACCATAAAGATATTGGTACATTATACCTTATCTTTGGTGCTTGAGCAGGAATAACAGGCACCGCTCTAAGTCTATTAATTCGCGCAGAACTTGGTCAACCAGGAACTCTTATTGGCGATGATCAAATCTACAATGTAATTGTAACTGCACATGCATTCATCATAATCTTCTTCATAGTCATACCAATTATAATTGGAGGGTTCGGTAACTGACTAGTCCCCCTAATAATTGGCGCACCAGATATAGCCTTTCCCCGAATAAATAATATAAGTTTCTGACTATTACCACCATCTTTCCTACTTTTACTAGCATCATCAGCAGTAGAAGCTGGAGCAGGAACTGGATGAACCGTCTATCCACCTTTAGCAGGTAATCTAGCACATGCAGGCGCCTCTGTAGACCTAACTATCTTTTCATTACATTTAGCAGGAATCTCATCCATCCTAGGAGCCATCAACTTCATTACTACAATTATCAATATGAAACCACCAGCCCTTTCACAATACCAAACACCACTATTCGTCTGATCAGTTATAATTACTGCCGTTTTACTTCTTCTATCACTTCCAGTATTAGCAGCAGGTATTACTATACTTTTAACAGATCGAAACTTAAATACTACATTTTTTGACCCGGCAGGAGGAGGAGACCCAATCCTATATCAACACTTATTCTGATTTTTTGGACATCCAGAAGTATATATTCTTATTTTACCAGGATTTGGTATAATTTCACACATCGTAACATACTACTCTGGCAAAAAAGAACCATTTGGCTACATAGGAATAGTATGAGCTATAATATCTATTGGATTCCTAGGATTTATTGTTTGAGCCCACCACATATTTACAGTAGGACTCGATGTAGACACCCGAGCTTATTTCACCTCAGCCACCATAATCATTGCTATTCCAACCGGGGTAAAAGTTTTCAGTTGACTCGCCACACTTCATGGAGGAAACATCAAATGATCACCTGCTATACTTTGAGCCTTAGGATTTATTTTCCTTTTTACAATCGGAGGTCTTACAGGAATCGTATTAGCCAACTCATCCCTAGACATCGTTCTTCACGATACCTATTATGTAGTAGCCCACTTCCATTATGTACTATCTATAGGAGCCGTATTTGCTATCATAGGCGGCTTTGTCCATTGATTCCCACTATTCACAGGATATATACTAAATGACTTATGAGCAAAAATCCATTTCTCCATTATATTTGTTGGAGTAAACATAACATTCTTCCCTCAACATTTTCTTGGCCTATCCGGAATACCACGACGATACTCAGACTACCCAGATGCCTATACAATATGAAACGTAATTTCATCTATTGGCTCGTTTATTTCACTAACAGCCGTCATCCTTATAGTATTCACCATCTGAGAAGCCTTCGCATCTAAACGAGAGGTAGCTTCAGTGGAACTTACAACAACTAATCTTGAATGACTTTATGGTTGTCCTCCACCTTACCACACATTTGAACAACCAGTATTCGTTAAATCCCAATTATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trichosurus vulpecula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Morris, K., Woinarski, J., Friend, T., Foulkes, J., Kerle, A. & Ellis, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although once hunted extensively for their fur in Australia, Trichosurus vulpecula is now protected. In Tasmania, this species is partially protected, but there is an annual hunting season. In addition, landowners in Tasmania can obtain Crop Protection Permits in order to help control the damage done by these agricultural pests. Trichosurus vulpecula has thrived extensively in New Zealand, where it was introduced. There are no restrictions on hunting this species in New Zealand, and even with the thousands of animals that are killed each year, the population does not seem to be declining.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species can be locally abundant, particularly in south-eastern Australia, Tasmania, and Kangaroo Island. In many other areas it has declined drastically, especially in arid and semi-arid Australia.

It is generally sparse and declining in monsoonal northern Australia. In South Australia it is only common on the offshore islands and in metropolitan areas. Populations on the western plains of New South Wales are restricted to riverine habitat. In the iron bark forest of the Brigalow belt bioregion of New South Wales, there has been 90% decline in the last 15 years.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species. Predation by introduced dingoes, cats, and foxes, as well as by native pythons can impact populations where the species is rare. Changed fire regimes in South Australia and the Northern Territory adversely affect Common Brushtail Possums, especially with the decline of large trees.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In some areas the common brushtail possum is considered a pest species, causing damage to pine plantations and to regenerating eucalypt forest, as well as to flowers, fruit trees and buildings. It may also carry diseases such as bovine tuberculosis. The species has long been harvested for its valuable fur, although commercial hunting is now restricted to Tasmania (1) (2) (4). There are also removal permits in place on Kangaroo Island, where the common brushtail possum is considered a pest species and a threat to other vulnerable wildlife (1). The species was introduced to New Zealand in the mid-1800s for its fur, where it has thrived despite attempts to control its numbers, and is thought to have potentially damaging effects on native vegetation (2) (4). Despite facing no major threats, the common brushtail possum has declined drastically in some areas, particularly in arid and semiarid areas of Australia (1) (4), and is now considered endangered in the Northern Territory (3) (8). The main causes of these declines are believed to be predation by dingoes, cats and foxes, as well as habitat fragmentation, the loss of suitable denning sites, and changed fire regimes in some areas (1) (6) (8) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in many protected areas. Fox control is crucial in semi-arid and arid areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The common brushtail possum is not currently considered threatened as it still has a wide distribution, large population, is present in many protected areas, and is able to adapt well to human settlements (1) (2). Conservation measures recommended for the more vulnerable populations include fox control, provision of nest boxes, and population monitoring (1) (6) (8) (9). In Tasmania, a management programme is in place for the species, which aims to maintain viable populations of the common brushtail possum across its range, while managing the species as an ecologically sustainable resource, and trying to reduce economic losses and damage to natural ecosystems (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Throughout its range, Trichosurus vulpecula is a major agricultural pest. It has caused severe damage to eucalyptus and pine forests, as well as destroying peoples' gardens. In addition, Trichosurus vulpecula is a known carrier of bovine tuberculosis which is highly contagious.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Tasmania exports fur and meat of Trichosurus vulpecula to China and Taiwan every year. In New Zealand a bustling fur industry exports hundreds of thousands of pelts each year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common brushtail possum

The common brushtail possum (Trichosurus vulpecula, from the Greek for "furry tailed" and the Latin for "little fox", previously in the genus Phalangista[3]) is a nocturnal, semi-arboreal marsupial of the family Phalangeridae, it is native to Australia, and the second largest of the possums.

Like most possums, the common brushtail possum is nocturnal. It is mainly a folivore, but has been known to eat small mammals such as rats. In most Australian habitats, leaves of eucalyptus are a significant part of the diet but rarely the sole item eaten. The tail is prehensile and naked on its lower underside. There are four colour variations: silver-grey, brown, black, and gold.[4]

It is the Australian marsupial most often seen by city-dwellers, as it is one of few that thrive in cities, as well as a wide range of natural and human-modified environments. Around human habitations, Common Brushtails are inventive and determined foragers with a liking for fruit trees, vegetable gardens, and kitchen raids.

In New Zealand, where it was introduced in the 19th century, it is a major agricultural and conservation pest.

Description[edit]

Skeleton of common brushtail possum

The common brushtail possum has large and pointed ears. It has a bushy tail (hence its name) that is adapted to grasping branches, prehensile at the end with a hairless ventral patch.[5][6] Its forefeet have sharp claws and the first toe of each hind foot is clawless but has a strong grasp.[6] The possum grooms itself with the third and fourth toes which are fused together.[6] The common brushtail possum has a thick and woolly pelage that ranges in colour depending on the subspecies. Colour patterns tend to be silver-gray, brown, black, red or cream. The ventral areas are typically lighter and the tail is usually brown or black.[5][6] The muzzle is marked with dark patches. The common brushtail possum has a head and body length of 32–58 cm[5] with a tail length of 24–40 cm.[6] It weighs 1.2-4.5 kg.[6] Males are generally larger than females. In addition, the coat of the male tends to be reddish at the shoulders. As with most marsupials, the female brushtail possum has a forward-opening, well-developed pouch.[5] The common brushtail possum’s chest has a scent gland that emits a reddish secretion which stains that fur around it. It marks its territory with these secretions.[7]

Biology and ecology[edit]

Range and habitat[edit]

Brushtail possum in tree

The common brushtail possum is perhaps most widespread marsupial of Australia. It is found throughout the eastern and northern parts of the continent, as well as some western regions, Tasmania and a number of offshore islands, such as Kangaroo Island and Barrow Island.[8][9][10] It is also widespread in New Zealand since its introduction in 1840. The common brushtail possum can be found in a variety of habitats, such as forests, semiarid areas and even cultivated or urban areas.[5][6] It is mostly a forest inhabiting species, however it is also found in treeless areas.[6] In New Zealand, possums favour broadleaf-podocarp near farmland pastures.[11] In southern beech forests and pine plantations, possums are less common.[11] Overall, brushtail possums are more densely populated in New Zealand than in their native Australia.[12] This may be because Australia has more fragmented eucalypt forests and more predators. In Australia, brushtail possums are threatened by humans, tiger quolls, dogs, foxes, cats, goannas, carpet snakes and certain owls. In New Zealand, brushtail possums are threatened only by humans and cats.[12]

Food and foraging[edit]

Dentition of a common brushtail possum

The common brushtail possum can adapt to numerous kinds of vegetation.[12] It prefers Eucalyptus leaves but will also eat flowers, shoots, fruits and seeds.[12] It may also consume animal matter such as insects, birds’ eggs and small vertebrates. Brushtail possums may eat three or four different plant species during a foraging trips, unlike some other arboreal marsupials, such as the koala and the greater glider, which focus on single species. The brushtail possum's rounded molars cannot cut Eucalyptus leaves as finely as more specialised feeders. They are more adapted to crushing their food which enables them to chew fruit or herbs more effectively. The brushtail possums’ caecum lacks internal ridges and cannot separate coarse and fine particles as efficiently as some other arboreal marsupials.[12] The brushtail possum cannot rely on Eucalyptus alone to provide sufficient nitrogen.[13] Its more generalised and mixed diet, however, does provide adequate nitrogen.[14]

Brushtail possums feeding

Behaviour[edit]

Brushtail possum (brown form)

The common brushtail possum is largely arboreal and nocturnal. It has a mostly solitary lifestyle, and individuals keep their distance with scent markings (urinating) and vocalisations. Brushtail possums usually make their dens in natural places like tree hollows and caves but will also use spaces in the roofs of houses. While they sometimes share dens, brushtails normally sleep in separate dens. Individuals from New Zealand use many more den sites than those from Australia.[15] Brushtail possum compete with each other and other animals for den spaces and this contributes to their mortality. This is likely another reason why brushtail possum population densities are smaller in Australia than in New Zealand.[12] Brushtail possums are usually not aggressive towards each other and usually just stare with erect ears.[12] Brushtail possums vocalise with clicks, grunts, hisses, alarm chatters, guttural coughs and screeching.[5][6]

Reproduction and life history[edit]

Brushtail possum with young

The common brushtail possum can breed at any time of the year, but breeding tends to peak in spring, from September to November, and in autumn, from March to May, in some areas. Mating is promiscuous and random; some males can sire several young in a season while over half sire none.[12] In one Queensland population, it apparently takes the males one month of consorting with females before they can mate with them.[16] Females have a gestation period of 16–18 days, after which they give birth to single young.[5][6] A newborn brushtail possum is only 1.5 cm long and weighs only 2 g. As usual for marsupials, the newborn brushtail possum may climb, unaided, through the female’s fur and into the pouch and attach to a teat. The young develops and remains inside the mother’s pouch for another four or five months. When older, the young is left in the den or rides on its mother’s back until it is seven to nine months old.[5][6] Females reach sexual maturity when they are one year old, and males do so at the end of their second year.[5][6] Female young have a higher survival rate than their male counterparts due to establishing their home ranges closer to their mothers, while males travel farther in search of new nesting sites, encountering pre-established territories from which they may be forcibly ejected. In the Orongorongo population, female young have been found to continue to associate with their mothers after weaning, and some will inherit the prime den sites.[17] There is possible competition between mothers and daughters for dens, and daughters may be excluded from a den occupied by the mother.[18] In forests with shortages of den sites, females apparently produce more sons, which do not compete directly for den sites, while in forests with plentiful den sites, female young are greater in number.[18] Brushtail possums can live up to 13 years in the wild.[5][6]

Brushtail possum exhibiting exudative dermatitis, a condition that often results from stress associated with overcrowding, particularly in young males attempting to assert territory.

Relationship with humans[edit]

Abandoned baby possum handed to Fauna Rescue, Adelaide, South Australia
Abandoned baby possum with Fauna Rescue volunteer, Adelaide, South Australia

The common brushtail possum is considered a pest in some areas as it is known to cause damage to pine plantations, regenerating forest, flowers, fruit trees and buildings.

Australia[edit]

Its fur has been considered valuable and has been harvested. Although once hunted extensively for its fur in Australia, the common brushtail possum is now protected in mainland states, but only partially protected in Tasmania where there is an annual hunting season. In addition, Tasmania gives Crop Protection Permits to landowners whose property has been damaged.[7]

While its populations are declining in some regional areas due to habitat loss, urban populations indicate an adaptation to the presence of humans.[19] In the mainland states, possum trapping is legal when attempting to evict possums from human residences (e.g. roofs), however possums must be released after dusk within 24 hours of capture, no more than 50 metres from the trapping site. In some states e.g. Victoria, trapped possums may be taken to registered veterinarians for euthanasia.[20] In South Australia, they are fully protected and permits are required for trapping possums in human residences[21] or for keeping or rescuing sick or injured wild possums and other native animals.[22]

New Zealand[edit]

In New Zealand, where they are an introduced wild species, there are no restrictions on hunting but the population seems to be stable despite the annual killing of the animals in the thousands.[7] In addition, in New Zealand (but not Australia where the disease has been eradicated) it is a host for the highly contagious bovine tuberculosis.[7] The New Zealand Department of Conservation controls possum numbers in many areas via the aerial dropping of highly toxic 1080 (sodium monofluoroacetate) laced bait.[23]

References[edit]

  1. ^ Groves, C. P. (2005). "Order Diprotodontia". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 50. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Morris, K., Woinarski, J., Friend, T., Foulkes, J., Kerle, A. & Ellis, M. (2008). Trichosurus vulpecula. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ "Define Phalangista vulpina - Source: '*'". www.hydroponicsearch.com. Retrieved 2010-03-10. 
  4. ^ "Brushtail Possum". Department of Primary Industries, Parks, Water and Environment. Retrieved 19 July 2010. 
  5. ^ a b c d e f g h i j Nowak, R.M. (1991) Walker’s Mammals of the World. The Johns Hopkins University Press, Baltimore and London.
  6. ^ a b c d e f g h i j k l m Cronin, L. (2008) Cronin’s Key Guide Australian Mammals. Allen & Unwin, Sydney.
  7. ^ a b c d Meyer, Grace (2000). "Trichosurus vulpecula (silver-gray brushtail possum)". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 9 July 2011. 
  8. ^ "Living with Possums in South Australia". City of Holdfast Bay. Retrieved 23 June 2012. 
  9. ^ "Brushtail possum". Department of Environment and Conservation. Government of Western Australia. Retrieved 23 June 2012. 
  10. ^ "Northern brush tailed possum". Australian Broadcasting Corporation. Retrieved 23 June 2012. 
  11. ^ a b Efford MG (2000) "Possum density, population structure, and dynamics". In: The Brushtail Possum. TL Montague. (ed) Chapter 5, pp. 47-66. Manaaki Whenua Press, Lincoln New Zealand.
  12. ^ a b c d e f g h H Tyndale-Biscoe. (2005) Life of Marsupials. pp. 250-58. CSIRO Publishing.
  13. ^ Wellard GA, Hume ID (1981) "Nitrogen metabolism and nitrogen requirement of the brushtail possum, Trichosurus vulpecula (Kerr)." Australian Journal of Zoology 29:147-57.
  14. ^ Harris PM, Dellow DW, Broadhurst RB, (1985) "Protein and energy requirement and deposition in the growing brushtail possum and rex rabbit". Australian Journal of Zoology 33:425-36.
  15. ^ Green WQ (1984) "A review of ecological studies relevant to management of the common brushtail possum". In Possums and Gliders. AP Smith, ID Hume pp 483-99. New South Wales: Surrey Beatty & Sons Pty Limited.
  16. ^ Winter JW (1976) The behaviour and social organisation of the brush-tail possum (Trichosurus vulpecula, Kerr) PhD Thesis, University of Queensland.
  17. ^ Brockie R. (1992) A Living New Zealand Forest. Pp. 172. Dave Bateman Auckland.
  18. ^ a b Johnson CN, Clinchy M, Taylor AC, Krebs CJ, Jarman PJ, Payne A, Ritchie EG. (2001) "Adjustment of offspring sex ratios in relation to the availability of resources for philopatric offspring in the common brushtail possum". Proceedings of the Royal Society of London B 268:2001-05.
  19. ^ Roetman, P.E.J. & Daniels, C.B. (2009): The Possum-Tail Tree: Understanding Possums through Citizen Science. Barbara Hardy Centre for Sustainable Urban Environments, University of South Australia. ISBN 978-0-646-52199-2
  20. ^ Department of Sustainability and Environment > Living with Possums in Victoria - Questions and Answers Accessed 10 July 2012.
  21. ^ Department of Environment, Water and Natural Resources > Plants and animals > Possums Accessed 10 July 2012.
  22. ^ Department of Environment, Water and Natural Resources > Plants and animals > Permits and licences Accessed 10 July 2012.
  23. ^ Green, Wren. "The use of 1080 for pest control". The use of 1080 for pest control. Animal Health Board and Department of Conservation. Retrieved 20 March 2013. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!