Overview

Brief Summary

The eastern pygmy-possum is light-brown on top and white underneath. It is small, weighing between 15 and 43 grams and measuring 70 to 110 millimeters in head and body length. It has an almost naked, prehensile tail, big, forward-facing ears, long whiskers, and large, bulging eyes. It feeds primarily on nectar and pollen using its brush tipped tongue to collect food resources, but it does eat insects and also will eat fruits if flowers are unavailable.

Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to eastern and southeastern Australia, including the island of Tasmania (and Flinders and King Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Populations of Cercartetus nanus are found primarily in Tasmania, southeastern South Australia to southeastern Queensland, and small surrounding islands. On the mainland of Australia, C. nanus inhabits primarily the coastal areas of the southeast. (Turner 1983)

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The adults have a body and head length of 75-100 mm. The tail is relatively long tail for its size, stretching to 75-105 mm. It is somewhat cylindrical in shape, with thick fur at the base and the hair becoming gradually sparser towards the tip. The color of the fur is gray to fawn on the dorsal side and whitish or slate colored on the underside. The hand is rather human-like, but the pad on each finger and toe is expanded into two lobes. The hallux is thumb-like and opposable (Walker 1975). The ears are relatively large and the eyes are quite dark and bulging (  http://www.komodo.com.au/wires/3116.htm).

Average mass: 40 g.

Average basal metabolic rate: 0.311 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in temperate rainforest, dry and wet sclerophyll forest, banksia woodland, and coastal heath (Ward and Turner 2008). It is generally nocturnal and arboreal. The species shelters in a spherical nest of bark and leaves in tree hollows or other crannies (Menkhorst 2001). Females give birth usually to litters of four young (Ward and Turner 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A variety of shelters are used including shrubs, tree hollows, abandoned bird nests, and other bark-laced nests. Its small size allows C. nanus to live in small tree holes and nests. The bark nests that C. nanus contructs are usually small and spherical and are up to 6 cm in diameter (Turner 1983).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Primarily an herbivore, C. nanus uses its brush tipped tongue to feed mostly on nectar and pollen from eucalypts, banksias, and bottlebrushes. In wet coastal regions, where fruit and blossoms are less abundant, a variety of insects is consumed, including flying moths, spiders, beetles, termites grasshoppers, and mantises. C. nanus is able to catch flying insects with one paw; these insects are eaten by first biting off the wings and then consuming the bodies. Feeding primarily occurs in short and quick bursts and is immediately followed by grooming (Turner 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.3 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

There are two distinct breeding seasons. On mainland Australia breeding takes place from spring to autumn, while on Tasmania the season lasts from late winter to spring. The litter is size is predominantly four and occasionally five. Like most marsupials, Cercartetus nanus has young that are altricial at birth. The young nurse in the pouch for up to six weeks following birth and are then independent when they reach half of the mother's weight (Turner 1983).

Average birth mass: 0.0198 g.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
190 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
190 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cercartetus nanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACTTCCTATTTGGAGCTTGAGCAGGAATAGTTGGTACAGCCCTAAGCCTTCTAATTCGAGCAGAATTAGGACAACCCGGTACCTTAATTGGTGAC---GACCAAATCTATAATGTAATCGTAACCGCACATGCTTTCGTAATAATTTTCTTCATAGTAATACCTATTATAATCGGAGGCTTTGGTAATTGACTAGTTCCACTAATAATTGGGGCCCCCGATATAGCATTTCCACGAATAAATAACATAAGCTTTTGACTGCTCCCTCCATCATTCCTACTATTACTTGCTTCATCTACAGTAGAAGCTGGAGCAGGAACTGGATGAACTGTTTATCCTCCTTTAGCTGGAAATCTAGCCCATGCAGGGGCTTCTGTAGATCTCGCAATTTTCTCTCTTCATTTAGCAGGAGTATCTTCCATTTTAGGCGCTATTAATTTTATTACAACTATCATCAATATAAAACCGCCAGCCCTATCCCAATACCAAACCCCGCTATTCGTATGATCAGTTATAATCACTGCAGTACTGCTTCTCCTTTCTCTCCCAGTACTAGCTGCTGGTATTACTATACTCCTAACCGACCGAAATCTAAATACTACATTCTTTGATCCTGCAGGAGGGGGCGACCCTATTATATATCAACAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cercartetus nanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Dickman, C., Lunney, D. & Menkhorst, P.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its relatively wide distribution, presence in protected areas, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category. This species, however, probably requires close monitoring of population numbers and trends as it is thought to be uncommon in some regions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The logging industry of Tasmania poses a serious threat to this species. Regeneration burning and clear-cutting currently result in C. nanus being absent from affected areas. There are no specific management interventions, but it has been suggested that unlogged forest areas should be restricted from logging and burning (  http://www.erin.gov.au/environment/land/forest/cra/tas/env/marsup1.html#EasternPygmy).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is usually common. At a number of sites where the habitat appears to be suitable they have not been caught, but this may be because it is a difficult species to capture.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species. It is a mid-story species and is susceptible to habitat loss from clearing and grazing. Inappropriate fire regimes (fires taking place at more frequent intervals or at higher intensity) may also be adversely affect this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is present in protected areas. Research is needed into methods to determine abundance, as the species is notoriously difficult to catch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Little information on the negative impact C. nanus has on humans exists, however it has been suggested that this species can damage valuable fruits or flower populations (Turner 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This species aids in the pollination of certain flowers (Turner 1983). While many possums are valued for their meat and fur, it is unlikely that C. nanus hunted or eaten due to its small size (Lawlor 1979).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eastern Pygmy Possum

The Eastern Pygmy Possum (Cercartetus nanus) is a diprotodont marsupial of south-eastern Australia. Occurring from southern Queensland to eastern South Australia and also Tasmania,[1] it is found in a range of habitats, including rainforest, sclerophyll forest, woodland and heath.

This species is very small, weighing from 15 to 43 grams and having a body length of between 70 and 110 millimetres. It is light-brown above and white below, with big, forward pointing ears and a long, almost bare, prehensile tail.

The Eastern Pygmy Possum is an active climber. It uses its brush tipped tongue to feed on nectar and pollen, especially from Banksia, Eucalyptus and Callistemon species.[3] It also feeds on insects, and will eat soft fruits when flowers are not available. It is a largely solitary animal, sheltering in tree hollows and stumps, abandoned bird-nests, and thickets. During winter it spends time in torpor. The female will usually have four, but sometimes 5 young. The young will stay and nurse in her pouch for up to 6 weeks.[3]

Contents

Discovery

The first specimen of Eastern Pygmy Possum known to Europeans was collected by François Péron, a naturalist aboard Nicolas Baudin’s voyage to the south seas.[4] Whilst on a short stay on Maria Island, off eastern Tasmania between 19 and 27 February 1802, Péron traded with the Aboriginal inhabitants for a single small marsupial. Péron wrote (in translation) ‘In the class of mammiferous animals, I only saw one kind of Dasyurus, which was scarcely as large as a mouse. I obtained one that was alive, in exchange for a few trifles, from a savage who was just going to kill and eat it’.[5] In an unpublished manuscript (now held in the Le Havre Museum in France) Péron also wrote that the animal ‘was given to me by the natives; it was still alive; I believe it to be a new species and have described it as Didelphis muroides because of its resemblance to the D. mus of Linnaeus’.[6] The specimen collected by Péron (a juvenile male) was transported back to France, and is now held in the Muséum National d’Historie Naturelle in Paris as the holotype.[7]

Taxonomy and nomenclature

The Eastern Pygmy Possum is the type species of the genus Cercartetus (family Burramyidae), and was first described as Phalangista nana with the specific name meaning ‘dwarf’ in Latin. Currently, the authority for the specific name is widely accepted as Desmarest 1818, but in a review recently published, it was pointed out that an earlier version of Desmarest's account was published in 1817.[4]

Names synonymous with Cercartetus nanus are Phalangista glirifomis (Bell, 1828) and Dromicia britta (Wood Jones, 1925).[1] These coincide with the two subspecies C. n. nanus (Desmarest, 1818) (the Tasmanian subspecies) and C. n. unicolor (Krefft, 1863) (the mainland Australian subspecies).[1]

Vernacular names that have been used for this species include dwarf phalanger, minute phalanger, dwarf cuscus, pigmy phalanger, Bell's Dromicia, opossum mouse, dusky Dromicia, pygmy opossum, thick-tailed Dromicia, mouse-like phalanger, common dormouse-phalanger, dormouse phalanger, common dormouse-opossum, dormouse possum, pigmy opossum, pigmy possum and eastern pigmy possum.[4] A standard name finally arose via a committee of the Australian Mammal Society.[8]

Fossil record

Bones of this species are often recorded as fossils or sub-fossils from late Pleistocene and Holocene cave deposits in south-eastern Australia. It is incorporated into the fossil record because owls and/or quolls that have preyed on Eastern Pygmy Possums (and other small mammals) deposit regurgitated or faecal pellets in caves which then act as excellent preservation sites. About 50 such sites form the fossil record for the Eastern Pygmy Possum.[9][10][11]

Conservation status

This species is listed as least concern by the IUCN,[2] and both subspecies are listed as lower risk by Australian Commonwealth Government legislation. At the State level within Australia, its status is defined variously. In New South Wales, it is considered vulnerable under the Threatened Species Conservation Act 1995. In South Australia, the species is considered vulnerable under Schedule 8 of that State's National Parks and Wildlife Act 1972. In Victoria, it is not listed under the Flora and Fauna Guarantee Act 1988, and is therefore officially not threatened. Records for Queensland are scant, but the species is perhaps misleadingly classed as common under that State's Nature Conservation (Wildlife) Regulation 1994. In Tasmania, the Eastern Pygmy Possum is currently considered not threatened under the Nature Conservation Act 2002.

Predators and parasites

Known predation records are by the Barn Owl Tyto alba, the Masked Owl T. novaehollandiae, the Sooty Owl T. tenebricosa, the Barking Owl Ninox connivens, the Brown Antechinus Antechinus stuartii, the Tiger Quoll Dasyurus maculatus, the Tasmanian Devil Sarcophilus harrisii, the Dingo Canis lupus dingo, the Dog Canis lupus familiaris, the Red Fox Vulpes vulpes, the Cat Felis catus, Stephen's Banded Snake Hoplocephalus stephensii, and the Rough-scaled Snake Tropidechis carinatus.[9][10][12][13]

Parasites recorded for the Eastern Pygmy Possum are the fleas Acanthopsylla rothschildi, A. scintilla, Choristopsylla thomasi, and Ch. ochi; the mites Guntheria newmani, G. shieldsi, Ornithonyssus bacoti (normally a parasite of captive rats), and Stomatodex cercarteti (type described from C. nanus); two nematodes Tetrabothriostrongylus mackerrasae and Paraustrostrongylus gymnobelideus; and the common marsupial tick Ixodes tasmani. There is also a record of a free-living platyhelminth Geoplana sp., although this was possibly an accidental infection.[14]

References

  1. ^ a b c d Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 45. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b Dickman, C., Lunney, D. & Menkhorst, P. (2008). Cercartetus nanus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b http://animaldiversity.ummz.umich.edu/site/accounts/information/Cercartetus_nanus.html | University of Michigan Museum of Zoology: Animal Diversity Web
  4. ^ a b c Harris, J.M. (2006). "The discovery and early natural history of the eastern pygmy-possum, Cercartetus nanus (Geoffroy and Desmarest, 1817)". Proceedings of the Linnean Society of New South Wales 127: 107–124. 
  5. ^ Péron, M.F. (1975). A voyage of discovery to the southern hemisphere, performed by order of the Emperor Napoleon during the years 1801, 1802, 1803 and 1804. Melbourne: Marsh Walsh Publishing. p. 233. 
  6. ^ Observations zoologiques by François Péron, on Maria Island, unpublished manuscript # 18043:31.
  7. ^ Julien-Laferriere, D (1994). Catalogue des types de mammiferes du Museum National d’Histoire Naturelle. Order des Marsupiaux. Extrait de Mammalia. Tome 58. 
  8. ^ Strahan, R. (1981). A number of Australian mammal names: Pronunciation, derivation, and significance of the names, with bibliographical notes. Sydney: Angus and Robertson. 
  9. ^ a b Harris, J. M., and Goldingay, R.L. (2005). "The distribution of fossil and sub-fossil records of the eastern pygmy-possum Cercartetus nanus in Victoria". The Victorian Naturalist 122: 160–170. http://www.australianmammals.org.au/publications/pubs_ausMamCat/am_29_2/233-236%20Harris%20Cercartetus%20fossils%20080321.pdf. 
  10. ^ a b Harris, J. M. and Garvey, J.M. (2006). Papers and Proceedings of the Royal Society of Tasmania. 140. pp. 1–10. 
  11. ^ Harris, J.M. (2006). "Fossil occurrences of Cercartetus nanus (Marsupialia: Burrmayidae) in South Australia". Transactions of the Royal Society of South Australia 130: 239–244. 
  12. ^ Bladon, R. V., Dickman, C.R. and Hume, I.D. (2002). "Effects of habitat fragmentation on the demography, movements and social organisation of the eastern pygmy possum (Cercartetus nanus) in northern New South Wales". Wildlife Research 29: 105–116. doi:10.1071/WR01024. 
  13. ^ Fitzgerald, M., Shine, R. and Lemckert, F. (2004). "Life history attributes of the threatened Australian snake (Stephen’s banded snake Hoplocephalus stephensii, Elapidae)". Biological Conservation 119: 121–128. doi:10.1016/j.biocon.2003.10.026. 
  14. ^ Harris, J. M., and Vilcins, I. (2007). "Some parasites of the eastern pygmy-possum, Cercartetus nanus (Marsupialia: Burramyidae)". Australian Mammalogy 29: 107–110. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!