Overview

Brief Summary

Biology

Living at high altitude, the mountain pygmy possum hibernates during the winter months from May to September. To survive hibernation these possums put on large amounts of fat and then roll into a ball to conserve heat. During the winter, individuals will occasionally rise from torpor to feed on stored seeds and berries (2). The mountain pygmy possum is the only marsupial to store food in a cache. Possums are nocturnal and during the 'active season', which runs from October to April, will feed primarily on the high energy Bogong moth (Agrotis infusa) which arrives in the Australian Alps in large numbers in the summer months to breed (2). As numbers of these moths decrease, the pygmy possum switches its diet to seeds and berries, prising open the hard cases with agile fingers (2). Females occupy overlapping home ranges, whereas males disperse from their natal range and are more nomadic (2). Breeding coincides with the retreat of the snow line and the reappearance of Bogong moths in the region. Females give birth to 4 young, which are born in an immature stage of development (3). The young make their way to the pouch and attach to one of four teats (2), leaving the pouch after a few weeks to stay in a nest constructed from grasses (3). Young pygmy possums are independent after 9 weeks but females only have one litter a year due to the need to store up fat for winter hibernation (3). Mountain pygmy possums can live for as long as 12 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The mountain pygmy possum was only known from fossil records until it was discovered in the Australian Alps in 1966 (3). This small marsupial has fine dense fur, which is grey on the back and a creamy colour underneath (2). Males develop a more fawn-orange coat during the breeding season (2). The tail is prehensile and, at 14 cm, is longer than the body (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Mountain Pygmy Possum is endemic to south-eastern Australia where it occurs as three isolated, genetically distinct populations: 1) between Mt. Bogong and Mt. Higginbotham, Victoria 2) at Mt. Buller, Victoria and 3) in the Kosciuszko region of New South Wales (Osborne et al. 2000). Its range is much smaller than the mapped distribution, and its area of occupancy is estimated to be less than 6 or 7 km² (Heinze et al. 2004; Broome 2008). This species ranges in elevation from 1,300 to 2,228 m asl (Broome 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The mountain pygmy possum, Burramys parvus, lives in the alps of Victoria and New South Wales, Australia. More specifically, it is found atop the Mount Bogong, Mount Loch and Mount Higginbotham mountain ranges of Victoria. In New South Wales, it is found predominantly in the mountain ranges of Kosciusko National Park, which include Mount Townsend, Mount Kosciusko, and Mount Blue Cow (Broome and Mansergh 1994). Burramys parvus ranges in elevation from 1400m to 2230m (Strahan 1995).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in two geographically isolated populations in south east Australia: one in the Mt. Bogong - Mt. Higginbotham range in Victoria and the other in Kosciuszko National Park, New South Wales (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Burramys parvus is a small, rodentlike marsupial. Both sexes are about 110mm in head and body length, with males being slightly longer and heavier than females. The tail of B. parvus is prehensile, ranging from 140mm in females to 148mm in males (Strahan 1983). The fur is fine, but dense. The dorsal side is grey, with a darker section at the back and head midline. The ventral surface is light cream, with males developing a bright fawn-orange in breeding season. The forepaws are dexterous, easily able to manipulate food, while on the hindfoot the hallux aids in climbing (Broome and Mansergh 1994).

Average mass: 45 g.

Average basal metabolic rate: 0.205 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is the only Australian mammal species confined to alpine environments (Broome 2008). They occur in periglacial boulder fields (basalt, granite, granodiorites) overlain with mountain plum-pine Podocarpus lawrenceii heathland and adjacent alpine communities. The basalt boulderfields have the greatest population density. Mountain Pygmy Possums are nocturnal and terrestrial, but they are also adept climbers. It has a spring-summer diet composed predominantly of Bogong moths Agrotis infusa and other invertebrates with seeds and fruits important in late summer and autumn (Mansergh and Broome 1994). Females normally have one litter of 4 young following snowmelt in spring. All individuals accumulate subcutaneous fat during late summer and autumn and spend the winter in hibernation (about 7 months for adults and 5 months for juveniles; Geiser and Broome (1991)). Snow cover provides important insulation and protection to hibernating animals.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Burramys parvus lives in a cold, wet climate. Snow is possible year round, but is most frequent between June and September. When snow is not blanketing the ground, rain and powerful winds are typical. The New South Wales and Victorian alps annual rainfall is greater than 1500mm. The altitude of the alps causes temperatures to be low, seldom exceeding 10 degrees celsius from May to September (Broome and Mansergh 1994). The habitat of this species can be described as a boulderfield. Recurrent wetting and freezing of water on the rock surfaceshas led to fragmentation of boulders. These fragments provide necessary protection from the harsh climatic conditions and alpine predators. Burramys parvus often has been found nesting among the crevices. Plants establish in shallow fragments, providing the mountain pygmy possum with plentiful resources (Strahan 1995). These plants are typically low shrubs with grasses intermixed (Strahan 1983).

Terrestrial Biomes: tundra ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits mountain summits at elevations between 1400 - 2200 m (2), where there are rock screes and boulderfields. This species is also usually associated with mountain plum-pine (Podocarpus lawrencei) heathland (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The mountain pygmy possum is best described as an omnivore-insectivore-granivore- frugivore. While eating habits of B. parvus are diverse, the diversity of prey is low, making B. parvus a specialized feeder, according to the season. During the 'active season' from October-April, B. parvus' diet contains high energy food. During this period, B. parvus is an omnivore and insectivore, feeding heavily upon the Bogong moth (Agrotis infusa), which migrates yearly to the Australian alps for breeding. The yearly migration of the moth provides a predictable, energy rich and abundant food supply for B. parvus. Studies conducted by Mansergh and associates (1990) reveal that the Bogong moth constitutes over 33% of the total 'active season' diet of B. parvus. A later study by Smith and associates (1992) reported that the moth may actually be the only dietary item during the reproductive season (October-December) of B. parvus. It has been found that females take a higher percentage of Bogong moths than males, due to the concurrent breeding season and additional nutritional supplements required to raise offspring (Smith and Broome 1992). Other insects, consumed in sparse quantities, are caterpillars, millipedes, beetles and spiders (Broome and Mansergh 1994). As the active season progresses, the abundance of Bogong moths decreases, leading to a dietary switch from moths to seeds and berries. The mountain pygmy possum prefers the seeds of habitat specific species such as Mountain Plum-pine, Rambling Bramble, and Snow Beard-heath, during the months of January-April (Broome and Mansergh 1994).

During the 'non-active', or hibernation season, B. parvus caches seeds and berries, which constitute over 75% of their diet from May-October (Broome and Mansergh 1994). The mountain pygmy possum is the only marsupial found to cache non-perishable food items (Menkhorst 1995).

Burramys parvus is well adapted to its specialized diet. The mountain pygmy possum has agile forelimbs that permit manipulation of seeds, berries and insects. The hard coats of seeds and insect exoskeletons are easily opened with a plagiaulacoid premolar. Burramys parvus uses its procumbent lower incisors to scoop out the interior of the seed or insect.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
4.0 years.

Average lifespan

Status: captivity:
7.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12 years Observations: Although these animals normally do not live more than 4 years in the wild, it has been reported that females can live up to 11 years (Ronald Nowak 1999). Other reports suggest a maximum longevity of 12 years (Fisher et al. 2001), which is plausible.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Burramys parvus follows a low fecundity, high longevity life strategy. The mountain pygmy possum has a non-breeding season from January-April, when it gain sweight for the coming winter and the young disperse. The inactive season, from May-September, is hibernation season for B. parvus. From September through December, B. parvus is in an active season of breeding. B. parvus females are polyestrous but limited to one litter per year by the need to store fat reserves for hibernation. Without sufficient fat, the females die. In response to fat reserve limitations, B. parvus synchronizes its reproduction with spring, when nutrient rich Bogong moths are abundant. Breeding occurs annually for many consecutive years. Reproducing females have been found up to 12 years of age, which makes them one of the longest lived small terrestrial mammals.

Studies have successfully mapped out the reproductive timeline of the mountain pygmy possum (Mansergh and Scotts 1990). Mating occurs between late September and mid October. Female estrous lasts ~20 days. After fertilization, a gestation period of 13-16 days ensues, followed by birth in the last week of October of four altricial young (Mansergh and Scotts 1990). The young have well developed forelimbs and heads for traveling from the cloaca to the pouch. The female cleans a trail for the young to the pouch, where the young attach to a teat (Broome and Mansergh 1994). Frequently the female bear smore than four young, leading to more offspring than teats. Under these circumstances, the 'slowest' young will not have a teat when it arrives in the pouch, and will die. The lactation period lasts 30 days, with a subsequent nesting period of 30-35 days (Strahan 1995). The young are fully weaned and independent after 65 days. Young disperse between January and March (Lee and Cockburn 1985). At approximately 1 year of age, the young begin mating. Only 50% of the reproducing young will survive, due to the inability of younger B. parvus to maintain fat reserves for hibernation (Mansergh et al. 1990). By their second summer, young are fully capable of sustaining themselves for both activities (Strahan 1995).

Average gestation period: 15 days.

Average number of offspring: 3.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
320 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
320 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Burramys parvus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACTTACTATTCGGCGCCTGAGCAGGAATAGTAGGAACAGCCCTAAGCCTTTTAATTCGAGCAGAACTTGGCCAACCTGGCACCTTGATTGGTGAC---GACCAAATTTACAACGTAATTGTTACCGCACACGCTTTTGTAATAATCTTCTTTATAGTCATACCTATTATAATCGGAGGCTTTGGCAACTGACTAGTCCCTCTAATAATTGGCGCTCCCGATATAGCATTTCCTCGTATAAACAATATAAGCTTCTGACTTTTACCACCCTCATTCTTACTATTACTTGCTTCATCCACAGTTGAGGCAGGAGCTGGAACTGGATGAACCGTTTACCCCCCTCTAGCCGGTAATTTAGCGCATGCAGGAGCCTCTGTGGACTTGGCAATTTTCTCCCTGCACTTAGCGGGAGTATCCTCTATTCTAGGAGCTATCAACTTCATTACTACAATTATTAATATAAAACCACCAGCCCTATCTCAGTACCAAACTCCGTTATTTGTATGATCCGTAATAATTACAGCCGTCCTACTACTTTTATCCCTTCCAGTACTAGCAGCAGGCATTACTATACTACTCACAGATCGAAACCTAAATACTACTTTCTTTGACCCCGCTGGAGGGGGCGACCCTATTATATATCAACAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Burramys parvus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
B1ab(iii,v)+2ab(iii,v)

Version
3.1

Year Assessed
2008

Assessor/s
Menkhorst, P., Broome, L. & Driessen, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Critically Endangered because its extent of occurrence is less than 100 km², its area of occupancy is less than 10 km², the population is severely fragmented, and there is continuing decline in the extent and quality of its habitat and in the number of mature individuals.

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Endangered
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Mountain Pygmy Possum lives in the Australian alps, where the ski industry has been growing since the mid 1950's. Leveling and grooming of land for ski trails has greatly affected the amount of available habitat for B. parvus. While B. parvus oftens makes its home in ski lodge foundations, the dispersal of males to and from the natal site has become increasingly difficult. Also problematic is the destruction of trees and shrubs, which B. parvus uses for food. Sufficient field data were collected in 1979 by Ken Norris, an Australian zoologist, and his associates to place a threatened label on B. parvus. A debate between tourism economists and wildlife conservationists soon developed (Broome and Mansergh 1994). Since these debates, measures have been taken to decrease the amount of habitat fragmentation and destruction by the ski industry. For the B. parvus habitats in established ski resorts, underground tunnels with simulated B. parvus habitat substrate have been constructed to aid in dispersal between intact habitat and ski resort habitat (Mansergh and Scotts 1992). These tunnels have become respected at the ski resorts by tourists and government officials alike. Future management plans to save B. parvus include protecting undestroyed lands and buffer lands surrounding the ski areas, continuing to devise tunneling systems for already affected B. parvus populations, monitoring effects of snow grooming on B. parvus habitats and populations, and making the public more aware of the vulnerability of this animal (Broome and Mansergh 1994).

The present habitat of B. parvus is less than 10 square kilometers. The present population of B. parvus is no more than 2600 adults (Strahan 1995).

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Burramys parvus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN - B1+2abcde) on the IUCN Red List 2002 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Common where they occur, but declining. The total population is estimated to number approximately 1,700 adult females and 550 adult males (Broome 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The extremely restricted habitat has been fragmented or destroyed by road construction, dam/aqueduct construction, and development of infrastructure for the downhill skiing industry. Approximately 50% of the habitat supporting the Mt. Bogong-Mt. Higginbotham population and 20% of the Kosciuszko habitat was burned in bushfires in January 2003, killing Podocarpus heathland aged from 50-400 years (L. Broome pers. comm.). The population at Mt. Buller suffers from fragmentation and subpopulations here and around ski resorts in the Kosciuszko area have declined severely since 2000 due to: habitat destruction, predation by feral cats, and possibly low snow cover. Predation by the introduced red fox is also a threat and the habitat is subject to weed invasion (e.g., willow Salix species). Bogong moths are migratory and have been found to carry arsenic from their breeding grounds in the Murray-Darling Basin to the mountains where it accumulates in food chains. Arsenic has been found in the scats of B. parvus and other small mammals, but the implications of this are as yet unknown (Green et al. 2001).

Marginalisation and loss of habitat and the severity of predation are predicted to increase with global warming. A recent trend of second litters following early snow melt has been observed at Mt. Buller (D. Heinze pers. comm.). Neither second litters nor their mothers are known to survive the winter because they are unable to accumulate the fat reserves necessary for successful hibernation through winter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Due to the restrictions of their habitat requirements, mountain pygmy possums have suffered from the development of the ski industry in the Australian Alps (2). Although individuals may build nests around the foundations of lodges, development and the building of roads obstruct the dispersal of males. Habitat is also destroyed from the management of pistes and by general tourist development. A further threat to the mountain pygmy possum comes from habitat loss caused by increased temperatures and decreasing snow cover as a result of global warming (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The entire extent of the species' range is in protected areas, though important parts (and all of the Mt. Buller population) are in ski-resort lease areas. Government-endorsed management plans exists in Victoria (Mansergh et al. 1989) and New South Wales (NSW 2002), and a national recovery plan is being prepared. The recovery objectives for this species (Maxwell et al. 1996; NSW 2002), include: conserve all remaining habitat and maintain it in a condition to support existing population levels; restore or re-create habitat in areas of disturbance; define habitat and population levels in Buller-Stirling area (Victoria) and reassess total population size and distribution of habitat in New South Wales; control feral predators and exotic species; monitor populations and habitat; define source and sink populations, understand genetic interrelationships and produce a metapopulation dynamics model; review threatening processes and predict the probability of long-term persistence in the wild; determine the feasibility of a viable captive breeding program; promote community awareness.

Recovery actions completed or underway include: distribution and abundance is well defined, general ecology and population dynamics have been studied at five sites over the last 20 years and additional sites over the last 10 years. Monitoring of populations, diet, food supply (Bogong moths and seeds) and habitat in ski resorts and control areas and consequent on-ground protection and planning is ongoing; protocols that provide protection to populations have been developed within some ski resorts, legislative and operational protection of all habitat needs to be finalised. Habitat restoration is occurring in fragmented, burnt, and disturbed areas in ski resorts. Feral cat, fox, rabbit, and weed control has been initiated in some areas; genetic studies are nearing completion; establishment of a captive colony of the Mt. Buller population is under consideration.

Studies required include: determine effects of the ski industry (notably use of snow-grooming equipment over habitat) and loss of snow cover on hibernation and over-winter survival; investigate Bogong moth population dynamics and pesticide residues, the possibility of competition or predation by co-occuring small mammal species, social dynamics, reproductive success, and captive husbandry techniques; continue research aimed at producing reliable metapopulation dynamics and viability models.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Measures have been taken to decrease habitat fragmentation in ski resorts by protecting areas that are yet to be developed (2). In areas where possums and developments occur together, underground tunnels have been constructed to allow males to go about their nomadic lifestyle and therefore come into contact with mates. In Mouth Hotham the plight of male pygmy possums has captured local imagination and the tunnel has been dubbed the 'tunnel of love' (4). A captive breeding programme currently exists in Healesville Sanctuary (4), in order to provide a reservoir of animals for possible reintroduction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ski industries sometimes feel their land acquistion opportunities are being thwarted by efforts aimed at conservation of B. parvus habitats. Recent conservation efforts (tunnel building) for B. parvus have been tolerated and accepted by established ski resorts. However, it has become increasingly difficult for new entrepeneurs in the industry to find unprotected portions of B. parvus habitat to develop.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Conservationists consider Burramys parvus economically important to research. The confined habitat and home ranges of B. parvus make it ideal for studies on wildlife managment, especially those with rapidly declining population. By establishing broad range methods to effectively treat animal populations, less monetary funds will be required for species specific method development.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mountain Pygmy Possum

The Mountain Pygmy Possum (Burramys parvus) is a small, mouse-sized (weighs 45 g) nocturnal marsupial of Australia found in dense alpine rock screes and boulder fields, mainly southern Victoria and around Mount Kosciuszko in Kosciuszko National Park in New South Wales at elevations from 1300 to 2230 m.[2] At almost 14 cm, its prehensile tail is longer than its 11 cm combined head and body length. Its diet consists of insects (such as the Bogong Moth), fleshy fruits, nuts, nectar and seeds. Its body is covered in a thick coat of fine grey fur except for its stomach, which is cream colored; its tail is hairless. On the underside of the female's body is a pouch containing four teats. This possum is the only extant species in the Burramys genus.[1] It is also the only Australian mammal restricted to alpine habitat.[2]

The Mountain Pygmy Possum was first described as a Pleistocene fossil by Robert Broom in 1896. It was thought to be extinct until 1966, when a living specimen was discovered in a ski-hut on Mount Hotham.[3]

As of 1992, there were two geographically isolated populations: Mount Bogong - Mount Higginbotham/Mount Hotham (Victoria) and Kosciuszko National Park (New South Wales). For most of the year, males and females live apart from each other. The females live on the better part of the rocky slopes, while the males live on the margins, usually lower on the mountain. In order to breed, the males migrate to the females' habitat. However, during the peak of the ski season on Mount Higginbotham, the males had to cross a road which put their survival in jeopardy. In an attempt to solve the problem, a "Tunnel of Love" was constructed under the road and a road sign was put in place to warn drivers.

To further preserve the Mountain Pygmy Possum, a small proportion of the Perisher Blue Ski Resort, New South Wales, Australia, has been 'roped-off' to prevent resort guests (skiers and snowboarders) from disturbing the possums whilst they hibernate.[citation needed] It is estimated that there are only about 2000 Mountain Pygmy Possums remaining.[4]

References

  1. ^ a b Groves, Colin P. (16 November 2005). "Order Diprotodontia (pp. 43-70)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 44. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11000019. 
  2. ^ a b c Menkhorst, P., Broome, L. & Driessen, M. (2008). Burramys parvus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as critically endangered
  3. ^ Turner, Vivienne and McKay, G. M. (1989). "27. Burramyidae". In Walton, D.W. and Richardson, B. J. (eds). Fauna of Australia, Volume 1B: Mammalia. Canberra: Australian Government Publishing Service. ISBN 0-644-06056-5. 
  4. ^ http://www.act4nature.org.au/Campaigns/Mountain-Pygmy-Possum.html
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!