Overview

Brief Summary

The honey possum is greyish-brown with yellow to white underneath. It has a dark stripe running to the tail and two lighter outer stripes that are not as long. The tail is almost naked with a prehensile tip. It has a long, slender snout and long tongue. The animal is very small, weighing between 12 and 22 grams and having a head and body length ranging from 70 to 85 mm. Females are larger than males.

The honey possum is the only survivor in the marsupial family Tarsipedidae. It is nocturnal and relies heavily on its sense of smell. Honey possums have non-overlapping home ranges of less than 2.5 acres, but they will group together to feed.
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to south-western Western Australia (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tarsipes rostratus is native to the south western tip of Western Australia, throughout the coastal-sand plain heathlands, which contains a diverse array plant communities.

Biogeographic Regions: australian (Native )

  • Cooper, C., A. Cruz-Neto. 2009. Metabolic, hygric and ventilatory physiology of a hypermetabolic marsupial, the honey possum (Tarsipes rostratus). Journal of Comparative Physiology, 179: 773-781.
  • Nagy, K., C. Meienberger, S. Bradshaw, R. Wooller. 1995. Field metabolic rate of a small marsupial mammal, the honey possum (Tarsipes rostratus). Journal of Mammalogy, 76: 862-866.
  • Richardson, K., R. Wooller, B. Collins. 1986. Adaptations to a diet of nectar and pollen in the marsupial Tarsipes rostratus (Marsupialia: Tarsipedidae). Journal of Zoology, 208: 285-297.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tarsipes rostratus has grey fur that is brown on the dorsal side with a dark stripe starting from the nape of the neck extending down towards the base of the tail. It has white and yellow ventral pelage on its underbelly that becomes orange on its sides. The head is dorsoventrally flattened with an elongated snout that is approximately two and a half times longer than its maximum width. Tarsipes rostratus has a brush-tipped protrusible tongue that is equal in length to the head. With the exception of the incisors, which are enlarged, the dentition of T. rostratus is greatly reduced. Its hands and feet have rough pads, opposable and elongated digits, with nails that do not project beyond the toe-pads. It has a prehensile tail that is hairless on the ventral surface near the tip. Tarsipes rostratus is sexually dimorphic, with females being approximately a third heavier than males. Females range in mass from 10 to 18 g, have a body length ranging from 70 to 90 mm, and a tail that measures from 75 to 105 mm in length. Males range in mass from 6 to 12 g, have a body length ranging from 65 to 85 mm, and a tail that measures from 70 to 100 mm in length. Despite females being slightly larger, there is no difference in head length between the sexes.

Tarsipes rostratus has a higher basal metabolic rate (BMR) and field metabolic rate (FMR) than most other marsupials. It has an average body temperature of 36.6 C, which is much higher than the typical marsupial, and a BMR of 2.9 cm^3 oxygen/hour. When in torpor, if its body temperature falls below 5 degrees C it is incapable of exiting torpor. Daily energy expenditures range from 25 to 30 kJ/day, which classifies them as hypermetabolic. In order to meet their high energy demands, its diet consists primarily of pollen and nectar.

Range mass: 6 to 18 g.

Range length: 65 to 90 mm.

Average basal metabolic rate: 2.9 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Average basal metabolic rate: 0.162 W.

  • Bradshaw, S., F. Bradshaw. 2007. Isotopic measurements of field metabolic rate (FMR) in the marsupial honey possum (Tarsipes rostratus). Journal of mammalogy, 88: 401-407.
  • Withers, P., K. Richardson, R. Wooller. 1990. Metabolic Physiology of Euthermic and Torpid Honey Possums, Tarsipes rostratus. Australian Journal of Zoology, 37: 685-93.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a crepuscular species. Its diet includes nectar and some pollen. It is commonly found in diverse vegetation communities on the coastal sand plain heaths of south-western Western Australia (Renfree 2008). In cold weather animals may become torpid. The females give birth to two to three young, and may give birth twice a year (Renfree 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Preferred habitat of Tarsipes rostratus is banksia woodlands, which are rich in floral diversity. The overstory of banksia woodland habitat along the south western coast of Western Australia is dominated by Banksia attenuata (slender Banksia) and B. menziesii (firewood Banksia). Eucalyptus todtiana (coastal blackbutt), E. gomphocephala (Tuart), E. marginata (Jarrah), Allocasuarina fraseriana (Fraser’s sheoak), Nuytsia floribunda (christmas tree) and other Banksia species also occur, but far less frequently. Interspersed throughout the understory are various species in the families Proteaceae, Myrtaceae, Papilionaceae, and Epacridaceae (Maher et al., 2008).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

  • Gnangara Department of Environment and Conservation. Restoration of banksia woodlands after the removal of pines Gnangara: evaluation of seeding trials.. Perth, AU: Murdoch University. 2008. Accessed February 24, 2011 at http://www.water.wa.gov.au/sites/gss/Content/reports/Restoration%20Banksia%20woodlands%20-%20evaluation%20of%20seeing%20trials.pdf.
  • Bradshaw, S., F. Bradshaw. 2002. Short-term movements and habitat use of the marsupial honey possum (Tarsipes rostratus). Journal of Zoology, 258: 343-348.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tarsipes rostratus consumes pollen and nectar from a variety of flowering plants. It is the only flightless animal that feeds exclusively on pollen and nectar. Large amounts of pollen and nectar are consumed from plants belonging to the families Proteaceae, Epacridaceae, and Myrtacae. Tarsipes rostratus prefers to forage on Banksia spp., which are large plants with widely separated and exposed inflorescences from the family Proteaceae. The Mediterranean climate of south-west Western Australia is prone to recurrent fires, which has a significant effect on the population density of T. rostratus. Areas that remain unburnt for longer periods of time have larger plants, which bear more inflorescences. Plants with more inflorescences are correlated with increased abundance of T. rostratus. Its feet and prehensile tail are used for climbing, while their forepaws with elongated digits are used to manipulate flowers during feeding. In order to acquire the necessary nutrients from nectar, a substantial quantity of fluid must be consumed. As a result of the high water content in their diet in conjunction with their inability to concentrate urine, T. rostratus frequently excretes high volumes of dilute urine.

Plant Foods: nectar; pollen

Primary Diet: herbivore (Nectarivore )

  • Everaardt, A. 2008. The impact of fire upon the size and flowering of three honey possum foodplants at the western end of the Fitzgerald River National Park, Western Australia. Western Australian Naturalist, 26: 85-98.
  • Slaven, M., K. Richardson. 1988. Aspects of the Form and Function of the Kidney of the Honey Possum, Tarsipes rostratus. Australian Journal of Zoology, 36: 465-471.
  • Sumner, P., C. Arrese, J. Partridge. 2005. The ecology of visual pigment tuning in an Australian marsupial: the honey possum Tarsipes rostratus. Journal of Experimental Biology, 208: 1803-1815.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Honey possums are important pollinators for a number of different plants and are the principle pollinators of nodding banksia (Banksia nutans), which is common on the southern coast of Western Australia.

Ecosystem Impact: pollinates

  • Wooller, R., S. Wooller. 2003. The role of non-flying animals in the pollination of Banksia nutans. Australian Journal of Botany, 51: 503-507.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Aerial predators of honey possums, include barn owls (Tyto alba) and black-shouldered kites (Elanus caesuleus), and common terrestrial predators include red foxes (Vulpes vulpes) and feral cats (Felis domesticus). In certain parts of their range, Fitzgerald River National Park, other potential predators include tiger snakes (Notechis scutatus), southern monitors (Varanus rosenbergi), square-tailed kites (Lophoictinia isura), Australian kestrels (Falco cenchroides), brown falcons (Falco berigora), and boobook owls (Ninox novaeseelandiae). Honey possums are arboreal and are most commonly found in the lower canopy. As a result, the upper canopy likely provides shelter from aerial predators and being elevated off the forest floor likely decreases predation pressure from terrestrial predators.

Known Predators:

  • Everaardt, A. 2003. "The impact of fire on the honey possum Tarsipes rostratus in the Fitzgerald River National Park, Western Australia." (On-line pdf). Murdoch University Research Repository. Accessed March 04, 2011 at http://researchrepository.murdoch.edu.au/66/2/02Whole.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little is known of communication and perception in Tarsipes rostratus. In other possum species, it has been suggested that secretions from the holocrine gland are used to mark habitats and signal alarm. There is no evidence indicating that possums use scent marking to attract potential mates.

Communication Channels: chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

  • Woolhouse, A., R. Weston, B. Hamilton. 1994. Metabolic physiology of euthermic and torpid honey possums, Tarsipes rostratus. Australian Journal of Zoology, 37: 685-693.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Honey possums are relatively short lived, with a lifespan of 1 to 2 years. Lifespan of captive individuals has not been documented.

Range lifespan

Status: wild:
1 to 2 years.

Average lifespan

Status: wild:
2.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: At birth, these animals are the smallest among mammals. Little is known about their longevity, but they appear to live at least 2 years in the wild (David Macdonald 1985), but possibly longer.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Tarsipes rostratus mates several times a year in a non-seasonal pattern. Females are polyandrous and have small litters, usually between 2 and 3 offspring but potentially up to 4, with multiple paternities. Female polyandry results in sperm competition between males. The testes of male T. rostratus are very large relative to their body size, weighing more than 4% of their total body mass. Their testes contain sperm that is larger than any other mammal. Males compete for estrous females and courtship is limited with no ongoing association after copulation.

Mating System: polyandrous

There is a strong association between reproductive success and diet in Tarsipes rostratus. Reproduction occurs during peak flowering periods when resources are abundant. In addition, breeding periods are affected by photoperiod and evidence suggests that the southern summer solstice triggers the first reproduction of the year. In general, breeding occurs from May to June, when day length begins to decrease and from September to October, when day length begins to increase.

Breeding interval: Honey possums breed whenever conditions are favourable.

Breeding season: Honey possums breed year round.

Range number of offspring: 2 to 4.

Range weaning age: 60 (high) days.

Range time to independence: 60 (high) days.

Range age at sexual or reproductive maturity (female): 90 (high) days.

Range age at sexual or reproductive maturity (male): 90 (high) days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; embryonic diapause

Average birth mass: 0.004 g.

Average gestation period: 24 days.

Average number of offspring: 3.

Tarsipes rostratus has the smallest young of any mammal, which are reared in the pouch for about 60 days. By 60 days old young are highly mobile, fully-furred, and have eyes that are completely open. Young become sexually mature around 90 days and females often breed before their young disperse. Due to a period of embryonic diapause, gestation in T. rostratus lasts from 60 to 80 days longer than in other marsupials. Unlike other mammals, embyonic diapause in T. rostratus is not controlled by lactation.

Parental Investment: female parental care ; pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Bradshaw, S., F. Bradshaw. 2002. Short-term movements and habitat use of the marsupial honey possum (Tarsipes rostratus). Journal of Zoology, 258: 343-348.
  • Oates, J., F. Bradshaw, S. Bradshaw, E. Stead-Richardson, D. Philippe. 2007. Reproduction and embryonic diapause in a marsupial: Insights from captive female honey possums, Tarspies rostratus (Tarsipedidae). General and Comparative Endocrinology, 150: 445-461.
  • Rose, R., C. Nevison, A. Dixson. 1997. Testes weight, body weight and mating systems in marsupials and monotremes. Journal of Zoology, 243: 523-531.
  • Wooller, R., K. Richardson, G. Bradly. 1999. Dietary constraints upon reproduction in an obligate pollen and nectar-feeding marsupial, the honey possum (Tarsipes rostratus). Journal of Zoology, 248: 279-287.
  • Wooller, R., K. Richardson, C. Garavanta, V. Saffer, K. Bryant. 2000. Opportunistic breeding in the polyandrous honey possum, Tarsipes rostratus. Australian Journal of Zoology, 48: 669-680.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tarsipes rostratus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0626-06|NC_006518|Tarsipes rostratus| AACCGTTGACTATTTTCCACTAACCACAAAGATATCGGCACCTTATACTTATTGTTCGGTGCCTGAGCCGGAATAGTTGGTACTGCCTTA---AGCCTCCTTATCCGTGCTGAATTAGGTCAACCAGGTACTCTAATCGGGGAT---GACCAGATTTATAACGTTGTAGTTACTGCCCATGCTTTTGTAATAATCTTCTTTATAGTAATGCCAATTATAATTGGCGGGTTCGGTAATTGACTAATCCCATTAATA---ATTGGTGCTCCAGATATAGCCTTCCCCCGAATAAATAATATAAGCTTCTGACTTCTTCCACCTTCATTTCTTCTACTCTTGGCCTCTTCTACTGTAGAAGCAGGTGCTGGTACTGGGTGAACAGTCTACCCTCCTTTAGCAGGGAACTTAGCCCATGCAGGCGCATCAGTAGATTTA---GCCATTTTCTCACTACATTTGGCTGGAGTATCTTCAATTCTAGGCGCTATTAACTTTATTACTACTATTATTAACATAAAACCACCAGCTTTATCCCAATACCAGACCCCCTTATTCGTATGATCTGTAATAATCACAGCAGTATTACTTCTACTCTCCCTTCCCGTTCTTGCAGCT---GGCATTACTATGCTTCTCACTGACCGTAATTTAAATACAACTTTCTTTGATCCTGCAGGAGGAGGAGATCCTATCTTATATCAACACCTCTTCTGATTTTTTGGACATCCAGAAGTCTATATTTTAATCCTCCCAGGGTTCGGAATTATTTCACACATTGTCACTTATTACTCAGGCAAAAAA---GAACCTTTCGGCTATATAGGTATAGTCTGAGCAATAATATCTATCGGTTTCCTTGGTTTTATTGTTTGAGCCCATCACATGTTTACAGTCGGCCTTG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tarsipes rostratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Friend, T., Morris, K., Burbidge, A. & McKenzie, N.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

According to the IUCN Red List of Threatened Species, honey possums are a species of “least concern”. Due to their relative abundance and broad distribution, there are no major threats to their existence. However, bushfires can result in significant habitat loss. In addition, water mold (Phytophthora cinnamomi), which is prevalent in many high humidity environments, can cause plant pathogens that could decrease resource abundance for honey possums. Finally, feral cats may have a negative effect on honey possum abundance.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Friend, T., K. Morris, A. Burbidge, N. McKenzie. 2008. "Tarsipes rostratus" (On-line). IUCN Red List of Threatened Species. Accessed November 11, 2010 at http://www.iucnredlist.org/apps/redlist/details/40583/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no reliable estimates of its global population, but it is likely to number in the hundreds of thousands.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. It is adversely affected by changes to the fire regime and destruction of habitat by the water mould Phytophthora cinnamomi. Cats and foxes may have some affect on populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in many protected areas. Reserves should be managed to decrease the likelihood of extensive and frequent wildfires.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Tarsipes rostratus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of Tarsipes rostratus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Honey possum

The honey possum (Tarsipes rostratus) or tait, its Native Australian name[3] or noolbenger is a tiny Australian marsupial weighing just seven to eleven grams for the male, and eight to sixteen grams for the female—about half the weight of a mouse. Their physical size ranges from a body length of between 6.5 – 9 cm. They have a typical lifespan of between one and two years.[4]

The honey possum has no close relatives. It is currently classified as the only member of the genus Tarsipes and of the family Tarsipedidae, but many authorities[who?] believe that it is sufficiently distinct to be more properly raised to a separate superfamily within the Diprotodontia, or perhaps even further. It is thought to be the sole survivor of an otherwise long-extinct marsupial group. Although restricted to a fairly small range in the southwest of Western Australia, it is locally common and does not seem to be threatened with extinction so long as its habitat of heath, shrubland and woodland[4] remains intact and diverse.

It is one of the very few entirely nectarivorous mammals; it has a long, pointed snout and a long, protusible tongue with a brush tip that gathers pollen and nectar, like a honeyeater or a hummingbird. Its teeth are fewer and smaller than is typical for marsupials, with the molars reduced to tiny cones, and a dental formula of

Dentition
2.1.1.3
1.0.0.3

Floral diversity is particularly important for the honey possum as it cannot survive without a year-round supply of nectar, and unlike nectarivorous birds, it cannot easily travel long distances in search of fresh supplies. Radio-tracking has shown, however, that males particularly are quite mobile, moving distances of up to 0.5 km in a night and with utilisation areas averaging 0.8 hectares.[5] Both its front and back feet are adept at grasping, enabling them to climb trees with ease, as well as traverse the undergrowth at speed. Honey possums can also utilise their tail (which is longer than their head and body combined) to grip, much like another arm.[4]

The honey possum is mainly nocturnal but will come out to feed during daylight in cooler weather. Generally, though, it spends the days asleep in a shelter of convenience: a rock cranny, a tree cavity, the hollow inside of a grass tree, or an abandoned bird nest. When food is scarce or in cold weather, it becomes torpid to conserve energy.

Reproduction

Breeding depends on the availability of nectar and can occur at any time of the year. Females are promiscuous, mating with a large number of males. Competition has led to the males having the largest testes relative to their body weight for any known mammal, being 4.2 per cent. Their sperm is also the largest in the mammal world, measuring 0.36mm. Gestation lasts for 28 days, 2-3-4 young being produced. At birth they are the smallest of any mammal, weighing 0.005g.[citation needed] Nurturing and development within the pouch lasts for about 60 days, after which they emerge covered in fur and with open eyes, weighing some 2.5g. As soon as they emerge, they are often left in a sheltered area (such as a hollow in a tree) while the mother searches for food for herself, but within days they learn to grab hold of the mother's back and travel with her. However, their weight soon becomes too much, and they will stop feeding off milk at around eleven weeks, and start to make their own homes shortly after this.[4] As is common in marsupials, a second litter is often born when the pouch is vacated by the first, fertilised embryos being stopped from developing - see diapause. [6]

Most of the time, honey possums will stick to separate territories of about one hectare (2.5 acres),[7] outside of the breeding season. They live in small groups of no more than ten, which results in them engaging in combat with one another only rarely. During the breeding season, females will move into smaller areas with their young, which they will defend fiercely, especially from any males.[4]

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 55-56. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Friend, T., Morris, K., Burbidge, A. & McKenzie, N. (2008). Tarsipes rostratus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ Chambers English Dictionary
  4. ^ a b c d e Branson, Andrew; Martyn Bramwell, Robin Kerrod, Christopher O'Toole, Steve Parker, John Stidworthy (1993). The Illustrated Encyclopedia of Mammals. Andromeda Oxford. pp. 26–27. ISBN 1-871869-16-1. 
  5. ^ BRADSHAW, S. D. & BRADSHAW, F. J. (2002) Short-term movements and habitat utilisation of the marsupial Honey possum, Tarsipes rostratus. Journal of Zoology (London) 258, 343-348.
  6. ^ http://www.bbc.co.uk/nature/wildfacts/factfiles/655.shtml
  7. ^ Russell, Eleanor M. (1984). Macdonald, D.. ed. The Encyclopedia of Mammals. New York: Facts on File. pp. 878–879. ISBN 0-87196-871-1. 

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!