Overview

Distribution

Range Description

This species is endemic to Australia, where it is widespread from Cape York south through eastern Australia, to south-eastern Australia as far west as south-eastern South Australia (McKay and Ong 2008). It is present on the island of Tasmania and also on many offshore islands (e.g., Fraser Island).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Common ringtail possums are found along the eastern coastline of Australia, Tasmania, and the southwestern corner of western Australia (Marsupial Society of Victoria Inc. 2000).

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Common ringtail possums are the smallest of eight species of ringtail possums that live in Australia. The adults of this species typically are between 30 and 35 cm in body length, with a tail length that is roughly equal to the body length. Common ringtail possums have brown or reddish fur on the upper surfaces of the body and light colored or gray fur on the ventral surfaces. Common ringtail possums have large eyes which are well adapted to seeing at night. Two of the claws found on the front feet are opposable and the pads, as well as the tips, of the toes are grooved. They possess a strong, but relatively hairless, prehensile tail. This tail is carried tightly curled when not in use. These animals can be distinguished from other possum species in several ways. Their ears are smaller and more rounded and they typically have patches of white fur both on and above the ears. The tail of common ringtail possums has a white tip and is tapered (Marsupial Society of Victoria Inc. 2000; Wildlife Welfare Org. of S.A. 2000).

Range mass: 500 to 1000 g.

Average mass: 700 g.

Average basal metabolic rate: 2.27 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a nocturnal species, found in many habitat types ranging from tropical moist forest and temperate forest, coastal scrub, to rural gardens and urban areas. The female gives birth to one or two litters of two young annually (McKay and Ong 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Common ringtail possums have an extensive distribution. They occur in temperate or tropical areas but are rarely found in drier areas. It is thought that this wide habitat range is due to their ability to feed on a number of different plant species. They can usually be found in dense brush forests, as they favor environments that are plentiful with eucalyptus. The dense brush is also optimal for the construction of dreys. Along with several other species, the common ringtail possum occupies a range of niches comparable to the niche's of lemurs, monkeys, squirrels, and bushbabies in similar forests on other continents (Barnett et al. 1984; Lee and Smith 1984).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common ringtail possums are nocturnal and primarily folivorous. They feed mainly on eucalyptus leaves, but may also eat flowers, buds, nectar, and fruit. Part of the common ringtail possum's caecum is able to detoxify the tannins and phenols that are present in eucalyptus leaves, making them capable of taking advantage of this food source. A low metabolic rate helps to compensate for the low energy intake of common ringtail possums due to their specialized diet. Feeding occurs both during the first half of the night and, again, before dawn. Common ringtail possums prefer eating the youngest foliage of the plants they consume. This effects reproductive patterns, as the young leave the pouch and are weaned during times when flower and fruit growth peaks (Barnett et al. 1984).

When they are found in urban Australian areas, common ringtail possums eat rose buds (Sydney Metropolitan Wildlife Service Inc. 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
5.0 years.

Average lifespan

Status: captivity:
8.0 years.

Average lifespan

Status: wild:
6.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.1 years (captivity) Observations: In captivity one specimen lived for 10.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Common ringtail possums are marsupials, thus they carry their young in a pouch while they develop. Mating takes place between April and December, depending on the location in Australia. Most young are born sometime between May and July. Both males and females are sexually mature in the mating season after their birth. Common ringtail possums are polyestrous as well as polyovular. The estrous cycle of this species lasts for 28 days (Barnett et al. 1984).

Most common ringtail possums have litters of two offspring, however they can have up to four. It has been suggested that six embryos are born at the same time, however, only two of those six are able to find a useable nipple, thus the other four usually die. The female's pouch has a forward facing opening; two of the four nipples are functional at one time. Older females can produce up to two litters of young per year (Wildlife Welfare Org of S.A. 2000).

Initial growth of the common ringtail possum young is generally slow. This slow growth occurs during the period when female weight is lowest. Between 90 and 106 days after birth, the young both open their eyes and are able to make clear vocalizations. Between 120 and 130 days after birth the young emerge from their mother's pouch. However, lactation generally does not stop until between 180 and 220 days after birth, sometimes ending as early as 145 days (Barnett et al. 1984; Gilmore and Stonehouse 1997).

Average birth mass: 0.3 g.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudocheirus peregrinus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0138-06|AJ639870|Pseudocheirus peregrinus| AACCGTTGACTATTCTCAACAAACCACAAAGATATTGGTACCCTTTATCTCCTATTCGGTGCTTGAGCAGGCATAGTAGGCACAGCCCTA---AGCCTATTAATCCGCGCAGAACTCGGACAACCGGGCACTCTGCTTGGAGAT---GATCAAATTTATAACGTTATCGTAACCGCACATGCTTTTGTAATAATCTTTTTCATGGTCATGCCTATTATAATTGGGGGATTTGGAAACTGATTAGTACCACTGATA---ATTGGTGCCCCAGATATAGCATTTCCTCGGATAAATAACATAAGTTTTTGACTACTACCACCATCCTTCCTCCTACTCCTTGCATCTTCTACAGTAGAGGCCGGGGCAGGAACCGGATGGACAGTTTATCCTCCCCTAGCAGGAAACATAGCCCATGCTGGAGCCTCAGTAGATCTA---GCTATTTTTTCCCTTCACTTAGCAGGTATTTCATCAATTCTAGGCGCCATTAACTTTATTACAACAATTATCAACATAAAACCACCAGCCCTATCCCAATACCAAACACCTCTGTTTGTGTGATCAGTTATAATTACAGCAGTGTTATTACTACTATCATTACCTGTTTTAGCAGCA---GGAATTACCATACTCCTCACAGACCGTAACCTAAATACCACATTCTTTGATCCAGCCGGAGGGGGAGATCCAATCTTATATCAGCACCTCTTCTGATTCTTCGGTCACCCTGAAGTTTATATCTTAATTCTACCCGGATTCGGCATAATTTCCCATATTGTAACATACTACTCGGGCAAAAAA---GAACCGTTTGGTTATATAGGAATGGTATGAGCAATAATATCAATTGGTTTCTTGGGCTTCATTGTATGAGCACACCACATATTTACAGTCGGACTGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudocheirus peregrinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Winter, J., Menkhorst, P., Lunney, D. & van Weenen, J.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, lack of major threats, and because its population is not in decline.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

During the 1950's common ringtail possum populations severely declined in numbers. Currently populations seem to have recovered.

Deforestation in Australia has resulted in a loss of habitat for common ringtail possums, because they are almost exclusively arboreal. In suburban areas they are vulnerable to being struck by cars, or hunted by cats and dogs (Sydney Metropolitan Wildlife Services Inc. 2000).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common, though very sparse on the Cape York Peninsula.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There appear to be no major threats to this species. There may be some localized declines due to inappropriate fire regimes, bushfires, clearing of land, and predation by domestic cats and dogs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in many protected areas. Further studies are needed into the taxonomy of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Common ringtail possums do not adversely affect humans. Unlike brushtail possums, they are not considered pests in suburban areas and do not nest within homes or human structures (Sydney Metropolitan Wildlife Services Inc. 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common ringtail possum

The common ringtail possum (Pseudocheirus peregrinus, Greek for "false hand" and Latin for "pilgrim" or "alien") is an Australian marsupial. It lives in a variety of habitats and eats a variety of leaves of both native and introduced plants, as well as flowers and fruits. These dietary factors have, over time, aided burgeoning introduced (pest) populations in New Zealand. This possum also consumes a special type of faeces that is produced during the daytime when it is resting in a nest. This behaviour is called coprophagia and is similar to that seen in rabbits.

Contents

Taxonomy

The common ringtail possum is currently classified as the only living species in the genus Pseudocheirus; the species of Pseudochirulus and other ringtail genera were formerly also classified in Pseudocheirus. Several subspecies have been described, such as the Western Australian Pseudocheirus peregrinus occidentalis, but the entire population may be a species complex.[1] The arrangement as the only extant species of Pseudocheirus is:[1]

Description

The common ringtail possum weighs between 550 and 1100 g and is approximately 30–35 cm long when grown (excluding the tail, which is roughly the same length again). It has grey fur with white patches behind the eyes and usually a cream coloured belly. It has a long prehensile tail which normally displays a distinctive white tip over 25% of its length. The back feet are syndactyl which helps it to climb. The ringtail possum's molar have sharp and pointed cusps.[4]

Ecology

Range and habitat

The common ringtail possum ranges on the east coast of Australia, as well as Tasmania and a part of southwestern Australia.[5] They generally live in temperate and tropical environments and are rare in drier environments. Ringtail possums prefer forests of dense brush, particularly eucalyptus forests.[5] The common ringtail possum and its relatives occupy a range of niches similar to those of lemurs, monkeys, squirrels, and bushbabies in similar forests on other continents.[6]

A common ringtail possum perched on a utility pole

Diet and foraging

The common ringtail possum prefers to feed on Eucalyptus foliage and are the most densely populated in areas where these plants are found.[4] However, ringtail possums will eat foliage, flowers and fruits from other species trees and shrub species lower in the canopy.[7] When foraging, ringtail possums to prefer young leaves over old ones. One study found the emergence of young possums from their pouches corresponds to the flowering and fruiting of the tea-tree, Leptospermum and the peak of fresh plant growth.[6] Young eucalypt foliage are richer in nitrogen and have less dense cell walls than older leaves, however its the protein gained from them are less available due to higher amounts of tannins.[8] When feeding, the possum’s molars slice though the leaves, slitting them into pieces. The possum's caecum separates the fine particles from the coarse ones.[4] These particles stay the caecum for up to 70 hours where the cell walls and tanned cytoplasts are partially digested.[9]

What distinguishes the system of the digestive system of the common ringtail possum from that of the koala and the greater glider, is the caecal content transfers directly back to the stomach. Because of this, the ringtail possum is able to gain more protein.[4] This is also done by lagomorphs like rabbits and pikas. Hard faeces are produced during the night while feeding and are not eaten, while soft faeces are produced during the day during rests and are eaten.[10]

Metabolism

The re-ingestion of caecal content also serves to maintain the ringtail possum’s energy balance. Ringtail possum seem to prefer Eucalyptus andrewii especially in captivity.[11] When consuming these plants, ringtail possums gain the much of their gross energy from reingestion.[11] The common ringtail possum has a daily maintenance nitrogen requirement (MNR) of 290 mg N/kg0.75. Still, common ringtail possums gain much of their MNR from consuming their nitrogen-rich caecal pellets. They would have to gain 620 mg N/kg0.75 otherwise.[4] The ringtail possum recycles 96% of its liver's urea, which is them tranferred into the caecum and made into bacterial protein. However only re-ingestion makes this effective and the bacterial protein "must be digested in the stomach and the amino acids in the small intestine".[4] This recycling allows the possum to conserve water and urine less. Reingestion allows the possum to live on low nitrogen eucalyptus leaves which is particularly important during late lactation.[12]

Behaviour and life history

Common ringtail possums are mostly nocturnal and are well adapted to arboreal life. They are rarely descend ground and rely on their prehensile tail.[5] They communicate with soft, high-pitched, and twittering calls.[13]

Asleep in daytime roost. Common ringtails usually build nests. This one prefers the open air.

Nesting

Common ringtail possums live a gregarious lifestyle which centres on their communal nests, also called greyer. Ringtail possums build nests from trees branches or use tree hollows. A communal nest is made up of an adult male with one or two adult females, their dependant offspring and immature offspring of the previous year.[7] A group of ringtail possums may build several greyers at different sites. Ringtail possums are territorial and will drive anyway any strange conspecifics from their nests. A group has a strong attachment to their site. In one experiment, a group was removed from their territory, it reminded uncolonised for the following two years.[7] Ringtail possum nests tend to be more common in low scrub or and less common in heavy timbered areas with little under-story.[4] Greyers contribute the survival of the young when they are no longer carried on their mother’s back. Adults also use them as refuges during the day.[4]

Reproduction and growth

As a marsupial, the common ringtail possum carries its young in a pouch, where it develops. Depending on the area, the mating season can take takes place anywhere between April and December.[5] The majority of the young are born between May and July. The oestrous cycle of ringtail possum lasts 28 days.[6] It is both polyoestrous and polyovular. If a female prematurely loses her litter, she can return to oestrous and produce a second litter in October as a replacement if conditions are right.[4] The average litter is made up two young, although four young can be nursed as the female has four teats in her pouch.[4] Common ringtail possum young tend to grow relatively slow. This rate is due to the quality of the milk being providing to the young. As with other marsupials, the common ringtail possum’s milk changes through lactation.[14] "In comparison with the milks of other marsupial species, ringtail possum milk is relatively dilute and low in lipid".[14] During the second phase of lactation, more soild foods are eaten, especially when the young first emerges from the pouch.[14] During this time, concentration of carbohydrates while those of protein and lipid reach their highest.[14] The long lactation of the ringtail possums may give the young more time to learn skills in the communal nest as well as to climb and forage in the trees.[4]

The young both are able to vocalise and open their eyes, between 90 and 106 days of age.[5] They leave their mother's pouch at 120–130 days of day. However, lactation usually continues until 180–220 days after their birth but sometimes ends by 145 days.[6] Both sexes become sexually mature in the first mating season after their birth.

Status

Common ringtail possum populations severely declined during the 1950s. However, populations seem may have recovered in recent times.[5] Because they are largely arboreal, common ringtail possums are particularly affected by deforestation in Australia. They are also hit by cars, or killed by cats and dogs in suburban areas.[5] Ringtail possums do not use homes or other human-built structures as nest and are thus not considered pests.[5]

References

  1. ^ a b c Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 51. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Winter, J., Menkhorst, P., Lunney, D. & van Weenen, J. (2008). Pseudocheirus peregrinus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ "Pseudocheirus occidentalis — Western Ringtail Possum". Species Profile and Threats Database. Department of Sustainability, Environment, Water, Population and Communities. http://www.environment.gov.au/cgi-bin/sprat/public/publicspecies.pl?taxon_id=25911. Retrieved 3 November 2010. 
  4. ^ a b c d e f g h i j k C. Hugh Tyndale-Biscoe (2005). Life of Marsupials. Csiro Publishing. pp. 243–247. ISBN 978-0-643-06257-3. http://books.google.com/books?id=KqtlPZJ9y8EC&pg=PA243. Retrieved 8 May 2012. 
  5. ^ a b c d e f g h Pseudocheirus peregrinus Animal diversity
  6. ^ a b c d Barnett, J.L, A., R. R.A. How. 1984. "The Population Biology of Pseudocheirus peregrinus". pp. 261–268 in Possums and Gliders Andrew Smith, Ian D. Hume (Eds.) New South Wales: Surrey Beatty & Sons Pty Limited.
  7. ^ a b c Thomson, JA. Owen WH. (1964). "A Field Study of the Australian Ringtail Possum Pseudocheirus peregrinus (Marsupialia: Phalangeridae)". Ecological Monographs 34 (1): 27–52. doi:10.2307/1948462. JSTOR 1948462. 
  8. ^ Cork SJ, Pahl. (1984) "The possible influence of nutritional factors on diet and habitat selection by the ringtail possum (Pseudocheirus peregrinus)". In: Possums and gliders Andrew Smith, Ian D. Hume (Eds.) pp. 269–76. Australian Mammal Society.
  9. ^ TP Obrien, A Lomdahl and G Sanson (1986). "Preliminary Microscopic Investigations of the Digesta Derived From Foliage of Eucalyptus-Ovata (Labill) in the Digestive-Tract of the Common Ringtail Possum, Pseudocheirus peregrinus (Marsupialia)". Australian Journal of Zoology 34 (2): 157–176. doi:10.1071/ZO9860157. 
  10. ^ Chilcott M J (1984). "Coprophagy in the common ringtail possum, Pseudocheirus peregrinus (Marsupialia: Petuaridae)". Australian Mammalogy 7: 107–110. 
  11. ^ a b Chilcott MJ, Hume ID (1984). "Nitrogen and Urea Metabolism and Nitrogen, Requirements of the Common Ringtail Possum, Pseudocheirus peregrinus, Fed Eucalyptus andrewii Foliage". Aust. J. Zool 32 (5): 615–22. doi:10.1071/ZO9840615. 
  12. ^ Munks, SA; Green, B (1997). "Milk consumption and growth in a marsupial arboreal folivore, the common ringtail possum". Physiological zoology 70 (6): 691–700. doi:10.1086/515871. PMID 9361143. 
  13. ^ Lee, Anthony, A. 1984. "The Evolution of Strategies for Survival and Reproduction in Possums and Gliders". pp. 17–19 in Possums and Gliders Andrew Smith, Ian D. Hume (Eds.). New South Wales: Surrey Beatty & Sons Pty Limited.
  14. ^ a b c d SA Munks, B Green, K Newgrain and M Messer (1991). "Milk-Composition in the Common Ringtail Possum, Pseudocheirus peregrinus (Petauridae, Marsupialia)". Australian Journal of Zoology 39 (4): 403–416. doi:10.1071/ZO9910403. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!