Overview

Distribution

Range Description

This widespread species ranges from the Moluccan Islands in the west (including the islands of Halmahera, Batjan, and Gebe) (all Indonesia); it is present on the islands of Misool, Salawati, Supiori, Yapen (all Indonesia); it is present on the Kai Islands and Adi Island (both Indonesia); the species is widespread throughout much of the island of New Guinea (Indonesia and Papua New Guinea); it is present on the islands of Bagabag, Karkar and New Britain (all Papua New Guinea); many of the Trobriand Islands, D'Entrecasteaux Islands, and Louisiade Archipelago (all Papua New Guinea); and ranges throughout much of northern, eastern and southern Australia, including the island of Tasmania (were it is introduced) and a number of offshore islands (e.g., Groote Eylandt). It ranges in elevation from sea level to 3,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

The sugar glider's distribution covers New Guinea and certain nearby islands, Bismark Archipelago, and northern and eastern Australia. (Grizmek, 1990,   http://www.evansville.net/%7Empzoo/4whenarr.htm., Nowak, 1997)

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The sugar glider is a relatively small marsupial; its head and body are approximately 120-320mm long and the tail has a length of 150-480mm. Sugar gliders are generally blue-greyish dorsally while their ventral surfaces are somewhat paler. A dark stripe runs down the back from the posterior end to the nose, while similar stripes are located on each side of the face running from the eye to the ear. Much like flying squirrels, sugar gliders have a gliding membrane which extends from the outer side of the fore foot to the ankle of the rear foot and may be opened by spreading out the limbs. The female sugar glider also has a well developed pouch. (Grizmek, 1990; Grove, 1996;   http://www.evansville.net/%7Empzoo/4whenarr.htm; Nowak, 1997)

Average mass: 110 g.

Average basal metabolic rate: 0.517 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is present where nesting hollows are available in various types of primary, secondary, and degraded forest. It has been recorded from plantations and rural gardens. Females give birth to two young.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sugar gliders can live in forests of all types, given that there is an adequate food supply. They build their nests in the branches of eucalyptus trees inside their territory. Since they have also been found to live insSouthern Australia, they must be able to deal with the cold effectively. (Grizmek, 1990, Nowak, 1997)

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Sugar gliders are omnivorous. Sugar gliders are especially found of the sweet sap which can be found in the eucalyptus tree. Their diet also includes pollen, nectar, insects and their larvae, arachnids, and small vertebrates. During the spring and summer months sugar gliders predominately feed upon insects, mainly moths and beetles, and during the fall and winter months they feed on plant products, such as eucalyptus sap and pollen. (Grizmeck, 1990; Grove, 1996; Nowak, 1997; Smith, 1982)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
14.0 years.

Average lifespan

Status: wild:
14.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.8 years (captivity) Observations: In zoos, these animals have been known to live up to 17.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Sugar gliders held in captivity have been found to live up to 14 years. Sexual maturity in sugar gliders occurs late in the first year of life for females and early in the second year for males. Sugar gliders have an estrous cycle of approximately 29 days. In Arnhem Land in the Northern Territory of Australia, there appears to be no definite breeding season. In southeastern Australia, however, the young are born only from the months of June to November. Gestation usually lasts around 16 days. Sugar gliders usually have a litter size of 1-2, each of which weigh about 0.19 grams at birth. The young first leaves the pouch after 70 days, and after about 111 days, they leave the nest and become independent shortly thereafter. Females are not pregnant while the young is still dependent on them. Sometimes females may become hostile towards their young so that they will leave sooner and the female may become pregnant again. (Grove, 1996; Nowak, 1997)

Average birth mass: 0.194 g.

Average gestation period: 16 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
456 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
236 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Petaurus breviceps

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0034-06|AB241055|Petaurus breviceps| AATCGTTGATTATTTTCAACCAACCACAAAGATATTGGCACCCTTTACCTATTATTTGGTGCATGAGCAGGCATAGTAGGTACAGCCTTA---AGCTTATTAATCCGTGCAGAACTAGGTCAACCAGGGACTCTAATTGGAGAT---GACCAAATTTATAATGTAATTGTTACCGCACACGCCTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGCAACTGACTAGTCCCACTAATA---ATTGGAGCCCCAGATATAGCGTTCCCACGAATAAATAACATGAGCTTCTGACTTCTACCCCCTTCTTTTCTTCTTCTACTTACATCATCAACAGTCGAAGCTGGTGCAGGGACCGGATGAACAGTCTACCCTCCTTTAGCAGGAAACCTAGCCCACGCTGGTGCTTCAGTAGATCTA---GCAATCTTTTCACTTCACTTAGCCGGTATCTCATCTATCTTAGGCGCAATTAATTTTATTACCACCATTATCAACATGAAACCACCCGCTTTATCACAATATCAAACCCCATTATTCGTCTGATCCGTGATAATTACAGCAGTTCTACTCCTCCTATCTTTACCAGTATTAGCAGCA---GGAATTACTATACTTCTAACAGATCGAAATCTTAACACTACATTCTTTGACCCTGCAGGAGGTGGAGACCCAATCCTATATCAACACTTATTCTGATTTTTTGGACATCCAGAAGTATACATTTTAATTCTTCCAGGTTTTGGTATCATTTCCCATATTGTAACCTACTATTCTGGCAAAAAA---GAACCTTTCGGATATATGGGAATAGTATGAGCAATAATATCAATTGGTTTCCTAGGGTTTATCGTATGGGCTCATCATATATTTACTGTAGGCTTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Petaurus breviceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Salas, L., Dickman, C., Helgen, K., Winter, J., Ellis, M., Denny, M., Woinarski, J., Lunney, D., Oakwood, M., Menkhorst, P. & Strahan, R.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, large population, occurrence in a number of protected areas, tolerance of a broad range of habitats (including degraded habitats), lack of major threats, and because its population numbers are probably stable. Taxonomic work is needed to determine species limits, because this might represent a species complex.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Sugar gliders are quite common in Australia. (Nowak, 1997)

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is locally common over much of its range. Populations in Australia are considered to be stable (Suckling 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species overall. Land clearance mainly for agriculture is a threat through many parts of its range. It is susceptible to bushfires.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in numerous protected areas throughout its range. Further taxonomic studies are needed because P. breviceps might be composed of more than one species. It is very understudied; research into its ecology, habitat requirements, population status are also needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

There has been a recent boom in the American pet population of sugar gliders. Currently, the USDA's guidelines for owning and breeding sugar gliders in the United States varies from state to state. (  http://www.isga.org/; Grove, 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sugar glider

The sugar glider (Petaurus breviceps) is a small gliding possum originating from the marsupial Infraclass.[3][4][5]

The sugar glider is native to eastern and northern mainland Australia (as well as being introduced to Tasmania, Australia) and is also native to New Guinea and the Bismarck Archipelago.

Contents

Habitat

Sugar gliders can be found all throughout the northern and eastern parts of mainland Australia, as well as the surrounding islands of Tasmania, Papua, New Guinea, and Indonesia. They can be found in any forest where there is food supply but are commonly found in forests with eucalyptus trees. They are nocturnal, meaning they sleep in their nests during the day and are active at night. At night, they hunt for insects and small vertebrates and feed on the sweet sap of certain species of eucalyptus, acacia and gum trees.[6] The sugar glider is named for its preference for nectarous foods and its ability to glide through the air, much like a flying squirrel.[6][7]

When suitable habitats are present, sugar gliders can be seen 1 per 1,000 square meters provided that there are tree hollows available for shelter. They live in groups of up to eight adults, plus the current season's young, all sharing a nest and defending their territory, an example of helping at the nest. A dominant adult male will mark his territory and members of the group with saliva and a scent produced by separate glands on the forehead and chest. Intruders who lack the appropriate scent marking are expelled violently.[6]

Appearance and anatomy

The sugar glider has a squirrel-like body with a long partially[8] prehensile tail. The males are larger than the females, and their length from the nose to the tip of the tail is about 24 to 30 cm (12–13 inches, the body itself is approx. 5–6 inches). A sugar glider has a thick, soft fur coat that is usually blue-grey; some have been known to be yellow, tan, or albino. A black stripe is seen from its nose to midway of its back. Its belly, throat, and chest is a cream color.

It has five digits on each foot, each having a claw, except for the opposable toe on the hindfeet. Also on the hindfeet, the second and third digits are partially syndactylous (fused) together to form a grooming comb.[9] Its most striking feature is the patagium, or membrane, that extends from the fifth finger to the first toe. When legs are stretched out, this membrane allows it to glide distances of 50–150 meters. This gliding is regulated by changing the curvature of the membrane or moving the legs and tail.[10]

Another feature are the scent glands, located on the frontal (forehead), sternal (chest), and paracloacal (cloaca). These are used for marking purposes, mainly for the males. The frontal is easily seen on adult males as a bald spot. The male also has a bifurcated (two shafts) penis. The female has a marsupium (pouch) in the middle of her abdomen to carry offspring.[9]

Torpor

During the cold season, drought, or rainy nights, a sugar glider's activity is reduced. This is usually seen due to torpor. In the winter season or drought, there is a decrease in food supply, which is a challenge for this marsupial because of the energy cost for the maintenance of its metabolism,[11] locomotion, and thermoregulation. With energetic constraints, the sugar glider will enter into daily torpor for 2–23 hours while in rest phase.[12] However, before entering torpor, a sugar glider will reduce activity and body temperature normality in order to lower energy expenditure and avoid torpor.[11][13]

Torpor, which is seen as an emergency measure, allows the animal to save energy by allowing its body temperature to fall to a minimum of 10.4 °C[12] to 19.6 °C.[14] When the food is scarce, as in winter, heat production is lowered in order to reduce energy expenditure.[15] With low energy and heat production, it is important for the sugar glider to peak its body mass by fat content in autumn (May/June)[16] in order to survive the following cold season. In the wild, sugar gliders enter into daily torpor more often than sugar gliders in captivity.[13][14]

Diet and nutrition

Like many exotic animals, the sugar glider can suffer from calcium deficiencies if it is not fed an adequate diet.[17] Calcium to phosphorus ratios should be 2:1 to prevent hypocalcemia, sometimes known as hind leg paralysis (HLP).[18]

In the wild, gliders live off gum and sap (typically from the eucalyptus), acacia trees, nectar and pollen, manna and honeydew and a wide variety of insects and arachnids. A captive glider's diet should be 50% insects (gut-loaded) or other sources of protein, 25% fruit and 25% vegetables.[clarification needed][19]

Some of the more recognized diets are BML, HPW, various calcium rich diets and LBM. These diets are proper protein supplements for captive sugar gliders.[citation needed]

Breeding

The age of sexual maturity in sugar gliders varies slightly between the males and females. The males reach maturity between 4–12 months old, while females reach maturity between 8–12 months. In the wild, sugar gliders breed once or twice a year depending on the climate and habitat conditions, while they can breed multiple times a year in captivity as a result of consistent living conditions and proper diet.[9]

A sugar glider female has one (19%) or two (81%) joeys a litter. The gestation period is 15 to 17 days, after which the baby sugar glider (0.2 g) will crawl into a mother's pouch for further development. It is virtually unnoticeable that the female is pregnant until after the joey has climbed into her pouch and begins to grow, forming bumps in her pouch. Once in the pouch, the joey will attach itself to its mother's nipple, where it will stay for about 60 to 70 days. The joey gradually spills out of the pouch until it falls out completely. The mother can get pregnant while her joeys are still ip (in pouch) and hold the pregnancy until the pouch is available. Their eyes will remain closed for another 12–14 days, and they are virtually furless at first. During this time, they will begin to mature by growing fur and increasing gradually in size. It is about two months for the offspring to be completely weaned off of the mother, and at four months, they are on their own.[9]

Conservation status

Unlike many native Southern Australian animals, particularly smaller ones, the sugar glider is not endangered.[20] Despite the massive loss of natural habitat in Australia over the last 200 years, it is adaptable and capable of living in surprisingly small patches of remnant bush, particularly if it does not have to cross large expanses of clear-felled land to reach them. Several close relatives, however, are endangered, particularly Leadbeater's Possum and the Mahogany Glider. The sugar glider is protected by law in South Australia, where it is illegal to keep them without a permit[21] or to capture or sell them without a license (which is usually only issued for research).

As pets

Male sugar glider on a table

Around the world, the sugar glider is a popular domestic pet, but is one of the most commonly traded wild animals in the illegal pet trade, where animals are plucked directly from their natural habitats.[22] In Australia, sugar gliders can be kept in Victoria, South Australia and the Northern Territory but not Western Australia, New South Wales, ACT or Tasmania.[23]

Sugar gliders are popular as pets in the United States, where they are bred in large numbers. Most states and cities allow sugar gliders as pets, with some exceptions including California,[24] Hawaii, Alaska, Pennsylvania and Massachusetts.[25]

Taxonomy

There are seven subspecies of P. breviceps:

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 55. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Salas, L., Dickman, C., Helgen, K., Winter, J., Ellis, M., Denny, M., Woinarski, J., Lunney, D., Oakwood, M., Menkhorst, P. & Strahan, R. (2008). Petaurus breviceps. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ Sugar Glider – Unique Australian Animals
  4. ^ Possums and Gliders. Australia Zoo
  5. ^ Australian Possums
  6. ^ a b c "Sugar Glider". Department of Primary Industries and Water, Tasmania. 28 October 2009. http://www.dpiw.tas.gov.au/inter.nsf/webpages/bhan-53j8xs?open. Retrieved 22 June 2010. 
  7. ^ "Sugar Glider – Australian Fauna". Australianfauna.com. http://www.australianfauna.com/sugarglider.php. Retrieved 22 June 2010. 
  8. ^ http://www.webvet.com/main/article/id/1815
  9. ^ a b c d "A guide to medicine and surgery in sugar gliders". Hilltopanimalhospital.com. http://www.hilltopanimalhospital.com/sugarglider.htm. Retrieved 22 June 2010. 
  10. ^ "Sugar Glider Fun Facts". Drsfostersmith.com. http://www.drsfostersmith.com/pic/article.cfm?aid=799. Retrieved 22 June 2010. 
  11. ^ a b Geiser, Fritz (15 October 2003). "Metabolic Rate and Body Temperature Reduction During Hibernation and Daily Torpor". Annual Review of Physiology 66 (1): 239–274. doi:10.1146/annurev.physiol.66.032102.115105. http://arjournals.annualreviews.org/doi/abs/10.1146/annurev.physiol.66.032102.115105. Retrieved 22 June 2010. 
  12. ^ a b Körtner, Gerhard; Fritz Geiser (May 2000). "Torpor and activity patterns in free-ranging sugar gliders Petaurus breviceps (Marsupialia)". Oecologia 123 (3): 350–357. doi:10.1007/s004420051021. http://www.springerlink.com/content/6ku64m3rhn9n4fl7/. Retrieved 22 June 2010. 
  13. ^ a b Christian, Nereda; Fritz Geiser (June 2007). "To use or not to use torpor? Activity and body temperature as predictors". Naturwissenschaften 94 (6): 483–487. doi:10.1007/s00114-007-0215-5. http://www.springerlink.com/content/m5753w4237261416/. Retrieved 22 June 2010. 
  14. ^ a b Geiser, Fritz; Joanne C. Holloway and Gerhard Körtner (July 2007). "Thermal biology, torpor and behaviour in sugar gliders: a laboratory-field comparison". Journal of Comparative Physiology B: Biochemical, Systemic, and Environmental Physiology 177 (5): 495–501. doi:10.1007/s00360-007-0147-6. http://www.springerlink.com/content/w08813m1615178x4/. Retrieved 22 June 2010. 
  15. ^ . PMID 11765973. 
  16. ^ "Australian weather and the seasons". Australia's Culture Portal. Cultureandrecreation.gov.au. 17 March 2008. http://www.cultureandrecreation.gov.au/articles/weather/. Retrieved 22 June 2010. 
  17. ^ "Microsoft Word - Care of Hamsters.doc" (PDF). http://nessexotic.com/portals/0/docs/sugargliders.pdf. Retrieved 22 June 2010. [dead link]
  18. ^ A. Lennox. "Emergency and Critical Care Procedures in Sugar Gliders (Petaurus breviceps), African Hedgehogs (Atelerix albiventris), and Prairie Dogs (Cynomys spp)". Veterinary Clinics of North America. Exotic Animal Practice 10 (2): 533–555. http://linkinghub.elsevier.com/retrieve/pii/S1094919407000023. 
  19. ^ Conservation and natural resources, 1995 Mammals of Victoria, ed. by Menkhorst. P., Oxford University Press, South Melbourne ISBN 0-19-553733-5
  20. ^ Gliders – Monash University[dead link]
  21. ^ "Fauna Permits – Government of South Australia". Environment.sa.gov.au. 3 July 1972. http://www.environment.sa.gov.au/animalwelfare/licences/fauna.html. Retrieved 22 June 2010. 
  22. ^ "Insider the Exotic Pet Trade: Fatal Attractions". discovery.com. http://animal.discovery.com/tv/fatal-attractions/exotic-pet-trade-overview.html. Retrieved 22 October 2010. 
  23. ^ "DixiGliders". http://www.dixiglen.com.au/sugargliders.html. 
  24. ^ "Illegal pets in California". http://www.dfg.ca.gov/wildlife/nongame/nuis_exo/ferret/ferret_issues_table6.html. Retrieved 16 June 2011. 
  25. ^ "MassWildlife Keeping Captive Exotic Wildlife". http://www.mass.gov/dfwele/dfw/regulations/regulations_exotic.htm#categories. Retrieved 6 September 2011. 

Bibliography

  • Cronin, Leonard. Key Guide to Australian Mammals, published by Reed Books Pty. Ltd., Sydney, 1991 ISBN 0-7301-0355-2
  • van der Beld, John. Nature of Australia: A portrait of the island continent, co-published by William Collins Pty. Ltd. and ABC Enterprises for the Australian Boadcasting Corporation, Sydney, 1988 (revised edition 1992), ISBN 0-7333-0241-6
  • Russell, Rupert. Spotlight on Possums, published by University of Queensland Press, St. Lucia, Queensland, 1980, ISBN 0-7022-1478-7
  • Troughton, Ellis. Furred Animals of Australia, published by Angus and Robertson (Publishers) Pty. Ltd, Sydney, 1941 (revised edition 1973), ISBN 0-207-12256-3
  • Morcombe, Michael & Irene. Mammals of Australia, published by Australian Universities Press Pty. Ltd, Sydney, 1974, ISBN 0-7249-0017-9
  • Ride, W. D. L.. A Guide to the Native Mammals of Australia, published by Oxford University Press, Melbourne, 1970, ISBN 19 550252 3
  • Serventy, Vincent. Wildlife of Australia, published by Thomas Nelson (Australia) Ltd., Melbourne, 1968 (revised edition 1977), ISBN 0-17-005168-4
  • Serventy, Vincent (editor). Australia's Wildlife Heritage, published by Paul Hamlyn Pty. Ltd., Sydney, 1975
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!