Overview

Distribution

Range Description

This species ranges from the islands of Waigeo, Yapen, and the Aru Islands (all Indonesia); through much of the lower elevation forests of the island of New Guinea (Indonesia and Papua New Guinea); into Queensland, Australia, where it ranges from Mt. Spec, near Townsville to the Iron Range (Handasyde 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Common striped possums (Dactylopsila trivirgata) inhabit Australia and New Guinea, including some nearby islands. In Australia they are restricted to northeastern Queensland, ranging from the tip of the Cape York Peninsula in the north to Mt. Spec in the south. They are widespread over this limited range, but is quite rare. In New Guinea they are much more common and distributed throughout the lowlands and foothills.

Biogeographic Regions: australian (Native )

Other Geographic Terms: island endemic

  • Broome, L., D. Lindenmayer. 2001. Ringtails, Pygmy Possums, and Gliders. Pp. 834-839 in D MacDonald, S Norris, eds. The Encyclopedia of Mammals. New York: Barnes & Noble Books.
  • Handasyde, K., R. Martin. 1996. Field Observations on the Common Striped Possum (Dactylopsila trivirgata) in North Queensland. Wildlife Research, 23 (6): 755-766.
  • Smith, A. 1982. Is the Striped Possum (Dactylopsila trivirgata; Marsupialia, Petauridae) an Arboreal Anteater?. Australian Mammalogy, 5 (3): 229-234.
  • Van Dyck, S. 1995. Striped Possum (Dactylopsila trivirgata). Pp. 222-223 in R Strahan, ed. The Mammals of Australia. Chatswood, NSW: Reed Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dactylopsila trivirgata is a mid-sized possum with remarkable black and white coloration. The coarse pelage is characterized by 3 longitudinal variable black stripes. The middle stripe runs from the front of the head to the tip of the tail, while the lateral stripes start at the muzzle and course over the eyes and ears to the rump. Branches from the lateral stripes continue down the outside of each limb. The fur of juvenile and subadult animals displays sharp contrast between the black and white markings. The fur of adults exhibits more gradual transitions between black and white markings, and white areas become more grey with age. The distinct bushy tail is considerably longer than the body and is usually darker on top with the tip being either black or white.

Common striped possums have several unique morphological characters. They possess an elongated tongue and fourth finger, long incisors, and a rounding of the braincase. The fourth finger is nearly twice the length of the next, and the procumbent lower incisors of Dactylopsila have the greatest relative length of any possum. In addition, the first upper incisors project forward. All of these are most likely specialized feeding adaptations. The rounding of the braincase makes it possible for D. trivirgata to have the largest brain in relation to its body weight of any marsupial.

Range mass: 246 to 569 g.

Average mass: 423 g.

Range length: 256 to 270 mm.

  • Rawlins, D., K. Handasyde. 2002. The feeding ecology of the striped possum Dactylopsila trivirgata (Marsupialia: Petauridae) in far north Queensland, Australia. Journal of Zoology, uk, 257 (2): 195-206.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This nocturnal, arboreal species occurs in primary and degraded tropical moist forests, and adjacent eucalypt and melaleuca woodlands. The female gives birth to up to two young (Handasyde 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Dactylopsila trivirgata is highly arboreal and lives almost exclusively in lowland tropical rainforest and adjacent woodlands. Within this habitat, it most commonly inhabits vine forests, riparian woodlands, and monsoonlands. Individuals are sometimes observed feeding in more open eucalypt (Eucalyptus spp.) and melaleuca woodlands.

The human alteration and destruction of rainforest may have several ecological impacts on this species. In fragmented landscapes, D. trivirgata requires habitat corridors that are connected to large tracts of continuous forest. These forests must also contain large trees over 30 cm DBH, because common striped possums need large trees with hollows for den sites.

Range elevation: Most common below 300 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: riparian

  • Laurance, S., W. Laurance. 1999. Tropical Wildlife Corridors: Use of Linear Rainforest Remnants by Arboreal Mammals. Biological Conservation, 91: 231-239.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Dactylopsila trivirgata is a generalist insectivore that eats primarily social insects, such as ants and termites, and wood-boring larvae of beetles and moths. It is more reliant on invertebrates than other members of the Petauridae, which is suggested not only by observations of foraging and stomach contents, but also by the simplicity and shortness of the digestive tract. In particular, the length of the caecum, an organ used in fermentation, is significantly shorter in D. trivirgata than in Petaurus breviceps and Gymnobelideus leadbeateri.

Striped possums eat insects from at least 8 orders, including Coleoptera, Hymenoptera, Lepidoptera, Isoptera, Blattodea, Orthoptera, Hemiptera, and Diptera. The insects that contribute most to the diet of striped possums are moth and beetle larvae, ants, termites, and crickets. The high frequency of wood-boring larvae and social insects in stomach samples suggests that D. trivirgata targets these high-energy foods. The fat content in these items is between 20 and 44%.

Many unusual adaptations allow D. trivirgata to be successful as an arboreal insectivore. It uses its forepaws to tap rapidly on wood to locate larvae. Once the insects are located, the powerful jaws and tooth orientation of striped possums make them great at excavating bark and wood from living and dead trees. Ant and termite eggs present in stomach contents suggests that D. trivirgata uses its jaws to break into insect mounds too. The striped possum has a dexterous elongated fourth finger that is used for collecting wood-boring larvae while it is excavating trees. The fourth digit is highly sensitive and some observations suggest that it is used to discriminate different vibration frequencies of various insects and larvae. The fourth finger is so sensitive that it represents 10% of the entire primary somatosensory area (SI) of the brain. This compares to a 4-5% representation of the SI for the fourth digit of northern quolls, Dasyurus hallucatus.

Pollen, nectar, flowers, sap, and fruit also contribute to the diet of striped possums. These items, however, comprise very little of the total diet. Interestingly, striped possums have been observed eating small mammals in captivity.

Animal Foods: mammals; insects; terrestrial non-insect arthropods

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; pollen; flowers; sap or other plant fluids

Primary Diet: carnivore (Insectivore )

  • Huffman, K., J. Nelson, J. Clarey, L. Krubitzer. 1999. Organization of Somatosensory Cortex in Three Species of Marsupials, Dasyurus hallucatus, Dactylopsila trivirgata, and Monodelphis domestica: Neural Correlates of Morphological Specializations. The Journal of Comparative Neurology, 403 (1): 5-32.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Dactylopsila trivirgata is a host to many species of parasites. The first records of certain parasite species have been made from striped possums. Ixodes cornuatus Neumann and Ixodes cordifer Neumann are both parasites of D. trivirgata, along with at least two species of intranasal mites from the family Trombiculidae.

Dactylopsila trivirgata also may limit insect populations.

  • Jackson, J. 1998. A new host record for Ixodes holocyclus Neumann and Ixodes cordifer Neumann (Acarina: Ixodidae) in Australia. Australian Journal of Entomology, 37 (2): 113-114.
  • Kaneko, K., T. Kadosaka, E. Kimura. 1999. Two new species of intranasal mites (Acarina, Trombicidae) from a common striped possum (Marsupialia, Petauridae). Journal of the Acarological Society of Japan, 1 (2): 89-94.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In New Guinea, indigenous peoples hunt D. trivirgata for food and skins. Amesthistine pythons (Morelia amethistina) also prey on striped possums. These pythons are common in the Australian habitat of D. trivirgata and may have a significant impact on young. Barking owls (Ninox connivens) and rufous owls (Ninox rufa) occupy the same areas and are known to feed on arboreal mammals, but have never been observed taking D. trivirgata.

In open areas, D. trivirgata is quite cryptic, due to its contrasting black and white coloration. The white markings make it difficult to make out when there are openings in the canopy that allow beams of light to penetrate.

Dactylopsila trivirgata possesses a foul, pungent odor. Its scent is said to be worse than other marsupial scents, which can be quite powerful. The purpose of the odor is not known, but it has been suggested that it is an enemy deterent.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Striped possums make at least two types of vocalizations. They frequently call in a raspy guttoral "gar-gair, gar-gair" manner (described in "Reproduction," above). These vocalizations are followed by a social aggregation of two or three individuals. This call is suggested to play a role in the species' mating system and also seems to be used for other social groupings. The other type of call is a distress call that is used repeatedly when an animal feels threatened. The distress vocalization is a series of 5-6 creaking "frog-like" calls that decend in pitch ("erreeh"). This suggests that D. trivirgata may demonstrate a high degree of sociality.

The pungent scent of striped possums may be a predator deterent, but also might play a role in the social communication of the species. Further research is needed in this area.

Communication Channels: acoustic ; chemical

Other Communication Modes: duets ; pheromones

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Range lifespan

Status: captivity:
9 years and 7 months (high) hours.

Average lifespan

Status: wild:
5.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Not much is known about the mating systems of D. trivirgata. Observations suggest that there is intense male rivalry for breeding females. Males chase each other and make threatening, raucous vocalizations when in close contact. While coupled, both male and female repeatedly make loud, guttural vocalizations ("gar-gair, gar-gair") and intertwine and thrash their tails about. According to a single observation, copulation lasts approximately ten minutes.

Limited research has been conducted on the breeding biology of D. trivirgata. Observations of mating in Australia have been made from February to August, and from January to October in New Guinea. This suggests a breeding seasonality. The breeding peak in Australia is June to July. Females have well-developed pouches with two mammae. They have one to two young, but almost always have two. The breeding interval for this species is not known. No detailed information has been documented on the development of young and the age to sexual maturity.

Breeding season: Common striped possums mate during the dry season. In Australia mating occurs between February and August. Mating has been observed in New Guinea as early as January and as late as October.

Range number of offspring: 1 to 2.

Average number of offspring: usually 2.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.5.

The degree to which female common striped possums provide care for their young is not known. Males have not been documented to take part in providing for the offspring. Females will carry their offspring on their back after weaning, but it is not known for how long. The provisioning of post-weaning food to the young is not known either.

Parental Investment: altricial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Handasyde, K., R. Martin. 1996. Field Observations on the Common Striped Possum (Dactylopsila trivirgata) in North Queensland. Wildlife Research, 23 (6): 755-766.
  • Smith, A. 1982. Is the Striped Possum (Dactylopsila trivirgata; Marsupialia, Petauridae) an Arboreal Anteater?. Australian Mammalogy, 5 (3): 229-234.
  • Van Dyck, S. 1995. Striped Possum (Dactylopsila trivirgata). Pp. 222-223 in R Strahan, ed. The Mammals of Australia. Chatswood, NSW: Reed Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dactylopsila trivirgata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0033-06|AB241054|Dactylopsila trivirgata| AATCGTTGATTATTTTCAACTAATCACAAAGATATCGGCACCCTCTATCTACTATTTGGTGCATGAGCCGGTATAGTAGGAACAGCCCTA---AGCTTACTAATTCGAGCAGAACTCGGCCAGCCAGGGACACTTATTGGAGAC---GATCAGATCTACAATGTAATTGTTACTGCCCACGCTTTTGTAATAATCTTTTTCATAGTAATGCCAATTATAATTGGAGGGTTTGGCAACTGATTAGTCCCCCTAATA---ATTGGAGCCCCAGATATAGCATTTCCACGAATAAACAATATAAGCTTTTGATTACTCCCACCATCATTTTTGCTTCTTCTAGCATCCTCTACAGTTGAAGCAGGAGCTGGGACAGGCTGAACAGTGTACCCCCCACTAGCAGGCAATCTCGCTCATGCAGGTGCTTCTGTAGATTTA---GCAATTTTCTCATTACATCTTGCAGGAATTTCTTCTATCCTAGGCGCTATCAACTTTATCACCACAGTCATTAATATAAAACCTCCAGCACTATCCCAATATCAAACCCCACTCTTCGTATGGTCAGTAATAATCACCGCAGTCCTACTACTCCTTTCTCTTCCAGTTTTAGCAGCC---GGAATTACTATACTCCTTACAGATCGTAATCTAAATACTACATTTTTTGACCCTGGCGGAGGAGGGGATCCTATCCTATACCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTATATATTCTTATTTTACCTGGGGTTGGCATAATCTCACATATTGTAACATACTATTCAGGAAAAAAA---GAGCCATTCGGCTATATAGGAATAGTATGAGCAATAATGTCAATTGGATTCCTAGGATTTATTGTATGAGCACACCATATATTTACAGTAGGACTGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dactylopsila trivirgata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Salas, L., Dickman, C., Helgen, K., Burnett, S. & Martin, R.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, occurrence in several protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

This species is not yet globally listed.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Within New Guinea this species is abundant in suitable habitat. In Australia, it is common in the lowlands and uncommon at higher elevations.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species overall. Within New Guinea, the main threat to this species is deforestation through subsistence agriculture. It is also hunted for food, however, this is not considered to be a major threat. There are no major threats to this species in Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is present in several protected areas in New Guinea, and is also present in some Australian protected areas (e.g., Wet Tropics World Heritage Area).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In agricultural areas that border lowland rainforest, striped possums sometimes cause slight damage to sugar cane crops. They break into sugar cane stalks, but it is not known if they consume the sap or are simply looking for insects.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The indigenous people of New Guinea hunt D. trivirgata for meat and skins. The skins are used in certain cultural rituals. Striped possums are relatively common in New Guinea, and provide a good food source.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Striped Possum

The Striped Possum (Dactylopsila trivirgata) is a member of the Petauridae family,[3] one of the marsupial families. The species is black with three white stripes running head to tail, and its head has white stripes that form a 'Y' shape. It is closely related to the Sugar Glider, and is similar in appearance.

Contents

Range

The Striped Possum lives in rainforests and eucalypt woodland along the east coast of Cape York Peninsula and as far south as Townsville in Queensland, Australia, but is more commonly found in New Guinea.[3] as well as several other small islands in the area. Uncommon and rarely seen in Australia.[4]

Description

This possum looks like a black and white squirrel. It is solitary, mostly nocturnal, arboreal, and builds nests in tree branches.[5] The body length is approx. 263 mm long, tail 325 mm, and weight 423 g.[6] The Striped Possum's tail is prehensile.[3] Its fourth finger is elongated relative to the others (like the third finger of the Aye-aye, another rainforest mammal) and is used to take beetles and caterpillars from tree bark,[7] making it a "mammalian woodpecker".[8] In addition, the Striped Possum eats leaves, fruits, and small vertebrates.[3] Its main diet consists of wood-boring insect larvae which are extracted from rotten branches probing with its elongated fourth finger and its powerful incisor teeth which are used to rip open tree bark to expose insects. It detects the larvae by a rapid drumming along branches with the toes of its forefoot.[9] The fourth finger has an unusual hooked nail which it uses to extract insects out of cracks.[10]

It emits a "very powerful unpleasant smell."[11] It is noisy and growls. During the day it curls up on an exposed branch and sleeps.[12]

The female striped possum has two teats in her pouch and can give birth to as many as two young.[3] However, not a lot is known of this possum's breeding habits.

It is most easily found by the sound it makes chewing and drinking in the forest. The Striped Possum is one of the least known marsupials. The species is not considered to be threatened.


Footnotes

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 54. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Salas, L., Dickman, C., Helgen, K., Burnett, S. & Martin, R. (2008). Dactylopsila trivirgata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b c d e McKay, G. (Ed.). (1999). Mammals (p. 60). San Francisco: Weldon Owen Inc. ISBN 1-875137-59-9
  4. ^ Marlow (1981), p. 80.
  5. ^ Marlow (1981), p. 80,
  6. ^ Ryan and Burwell (20000), p. 339.
  7. ^ Rawlins, D. R; Handasyde, K. A. (2002). "The feeding ecology of the striped possum Dactylopsila trivirgata (Marsupialia: Petauridae) in far north Queensland, Australia". J. Zool., Lond. (Zoological Society of London) 257: 195–206. doi:10.1017/S0952836902000808. http://journals.cambridge.org/action/displayFulltext?type=1&fid=108810&jid=ZOO&volumeId=257&issueId=02&aid=108809. Retrieved 2010-04-09. 
  8. ^ Beck, R. M. D. (2009). "Was the Oligo-Miocene Australian metatherian Yalkaparidon a ‘mammalian woodpecker’?". Biological Journal of the Linnean Society (The Linnean Society of London) 97: 1–17. http://www3.interscience.wiley.com/journal/122341804/abstract. Retrieved 2010-04-20. 
  9. ^ Marlow (1981), p. 80.
  10. ^ Drury (1981), p. 71.
  11. ^ Drury (1981), p. 71.
  12. ^ Ryan and Burwell (2000), p. 339.

References

  • Drury, Susan (1981) Native Animals of Australia. Macmillan Pocket Guide. Macmillan Company of Australia, Melbourne, Victoria. ISBN 0-333-33755-7.
  • Marlow, Basil (1981). Marsupials of Australia. Amended edition. First published in 1962. Hesperian Press, Victoria Park, Western Australia.
  • Ryan, Michelle and Chris Burwell, editors (2000). Wildlife of Tropical North Queensland. Queensland Museum, Brisbane. ISBN 0-7242-9349-3.
  • Briggs, Mike; Briggs, Peggy (2004). The Encyclopedia of World Wildlife. Paragon. ISBN 1-4054-3679-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!