Overview

Distribution

Range Description

This species is endemic to north-west Queensland, Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is known from the Mitchell Grass downs, which are covered with cracking clay soils. It uses the cracks and dense vegetation (particularly Flinders grass) as cover (Lundie-Jenkins and Payne 2000). Females can raise two litters annually of up to eight young (Woolley 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about these animals and only a few have been studied in detail (Ronald Nowak 1999). One captive specimen lived 3.2 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sminthopsis douglasi

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0135-06|AJ639867|Sminthopsis douglasi| ACTCGATGACTATTCTCTACTAACCACAAAGATATTGGTACTCTATACTTACTGTTCGGAGCTTGAGCAGGCATAGTAGGCACTGCTCTT---AGTCTTCTTATCCGAGCGGAGCTTGGGCAACCCGGAATACTAATTGGTGAT---GATCAAATTTACAACGTAATTGTCACAGCCCATGCTTTTGTAATAATTTTCTTCATGGTAATGCCTATCATGATTGGAGGGTTTGGGAACTGACTTGTTCCACTAATA---ATTGGGGCCCCTGATATAGCATTCCCTCGAATGAATAATATAAGCTTTTGACTTCTACCACCCTCATTTCTATTACTCCTAGCGTCTTCAACTGTTGAGGCAGGTGCTGGGACTGGGTGAACGGTCTACCCACCCCTGGCAGGAAATCTAGCCCATGCTGGGGCATCAGTGGACTTA---GCTATCTTTTCTCTCCATTTAGCAGGAGTTTCTTCAATTCTTGGGGCTATTAACTTTATTACAACAATTATTAATATAAAACCCCCAGCTATGTCCCAGTACCAAACCCCCCTATTTGTCTGATCAGTAATAATTACAGCAGTCCTTCTTCTTTTATCTTTACCAGTCTTAGCTGCC---GGGATTACAATACTTCTAACAGACCGTAACCTGAACACAACATTCTTTGACCCTGCTGGAGGAGGAGACCCTATCCTTTACCAACACTTATTCTGATTTTTCGGTCACCCAGAAGTATATATTTTAATCCTTCCAGGCTTTGGTATTATTTCCCATATTGTAACATATTACGCAGGTAAAAAA---GAACCTTTTGGATACATAGGAATAGTATGGGCTATAATATCAATTGGATTCCTAGGGTTTATTGTATGAGCCCACCACATATTCACCGTTGGGTTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sminthopsis douglasi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Burnett, S. & Winter, J.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Near Threatened because, although the species is now known from a relatively large extent of occurrence, it is very sparsely distributed within its range and little is known about its population trend. It is unlikely to be declining at the rate required to qualify for listing in a threatened category, but it might be nearly there. Almost qualifies as threatened under criterion A or B2.

History
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Indeterminate
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Julia Creek Dunnart is rare and scattered through what appears to be large amounts of suitable habitat (Woolley 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Exotic predators (especially cats and foxes), grazing by sheep and cattle, as well as the presence of the prickly acacia (Acacia nilotica) have all been implicated as major threats to the species. Cats have been shown to prey heavily on Julia Creek Dunnarts (Lundie-Jenkins and Payne 2000). Introduced prickly acacia excludes an ample understorey for the species (Lundie-Jenkins and Payne 2000). Experiments eliminating grazing by sheep have shown to have little effect on the species, but there is some question about the methods used and the effects of cattle grazing are unknown (Lundie-Jenkins and Payne 2000). A recent study of habitat suitability, however, found that increased ground cover (in the absence of prickly acacia) and low levels of grazing were highly correlated with habitat suitability (Smith et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Julia Creek Dunnart is listed as a threatened species under Australian law. It is present in several protected areas. A recovery plan has been developed for the 2000-2004 period (Lundie-Jenkins and Payne 2000), and an updated recovery plan is being drafted.

Recommendations from the current recovery plan (Lundie-Jenkins and Payne 2000), include: surveying to improve knowledge of the current distribution and critical habitat; studying the ecology and habitat requirements of the species; managing threats at key sites; developing management agreements with private landowners for the benefit of the species; maintaining the current captive breeding programs at La Trobe University and David Fleay Wildlife Park; and promoting community awareness, support, and participation in the recovery of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Julia Creek Dunnart

The Julia Creek Dunnart (Sminthopsis douglasi) is a marsupial with a large buffy brown upperside and white underside. This dunnart has a body length of 100-135 mm with a tail of 60-105 mm to make a total length of between 160-240 mm. Its weight is between 40-70g. The length of the hind foot is between 22-24 mm. The species has a dark brown triangle colour from above and below the eye with the point at the nose, and another dark stripe on top of the skull. A healthy dunnart has a carrot shaped tail filled with fat stores.

Contents

Distribution and habitat

Typically found on 8000 km² in the Mitchel Grass downs of riparian grassland's, between Julia Creek and Richmond in Queensland, it possibly occurs in the Mitchell Plateau of Western Australia.[1] The Prickly Acacia is a threat to its habitat as it kills native grasslands. Cultivation and introduced species also threatens this dasyurid's habitat.

Social organisation and breeding

During the dry season, it shelters in cracks in the ground; in the wet season it shelters under vegetation. This nocturnal animal doesn't drink often as all the water it needs is in the food. Gestation is for 12 days with an average of eight young born. Males are independent in 210 days and females in 168 days. A 4-mm-long joey can breathe through its skin.

Diet

Insects and small vertebrates make up the majority of this species diet.

Status

The Julia Creek Dunnart is currently listed as an near threatened species by the IUCN.[2] This is likely due to the invasion of prickly acacia plants and introduced predators such as cats and foxes.

References

  1. ^ a b Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 34. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=10800093. 
  2. ^ a b Burnett, S. & Winter, J. (2008). Sminthopsis douglasi. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as near threatened
  • Menkhorst, Peter W. (1995). Mammals of Victoria. Oxford Press. ISBN 0-19-553733-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!