Overview

Distribution

Range Description

This species is widespread over much of western, southern, central, and eastern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

This species occurs in the extreme southern portions of Queensland, Australia.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Fat-tailed dunnarts typically have a head and body length of 64- 110 mm, and a tail length of 51-12 mm. They range from buffy to brownish in color, and have dark patches on their ears and head.

Average mass: 16 g.

Average basal metabolic rate: 0.121 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Fat-tailed Dunnarts are found in a variety of grasslands, shrubland, and open woodland. They also occur in farmland (Morton and Dickman 2008). Females give birth to between eight and ten young, of which an average of five survive (Morton and Dickman 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The fat-tailed dunnart eats a variety of grasshoppers, moths, and beetles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: wild:
1.5 years.

Average lifespan

Sex: male

Status: wild:
1.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5 years (captivity) Observations: In the wild, these animals do not live more than 1.5 years (Ronald Nowak 1999). One captive specimen was at least 5 years old when it died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

This species is polyestrus. Females may breed and raise litters continuously for up to six months if environmental conditions are favorable. Nearly all of the breeding in this species occurs between July and February. Gestation ranges from 13 to 16 days, and litters of up to ten young may be produced. The young first protrude from their mother's pouch at the age of 37 days. They disperse from their natal range when they are 65-69 days old. Females attain sexual maturity more quickly than males. They are capable of becoming pregnant when they are 155 days old. Males, however, are not capable of breeding until they are 159 days old.

Average gestation period: 14 days.

Average number of offspring: 7.

Average age at sexual or reproductive maturity (male)

Sex: male:
159 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
115 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sminthopsis crassicaudata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0658-06|NC_007631|Sminthopsis crassicaudata| ACTCGATGACTATTTTCTACTAATCATAAAGATATTGGAACTCTCTATCTTCTGTTTGGTGCTTGAGCAGGCATAATTGGAACAGCCTTA---AGCCTCCTTATCCGAGCAGAACTTGGTCAACCGGGCACCTTAATCGGCGAT---GATCAAATCTACAACGTAATTGTAACAGCTCACGCCTTTGTTATAATTTTCTTTATAGTTATACCTATTATGATCGGGGGCTTTGGTAACTGACTTGTGCCTCTAATA---ATTGGAGCCCCAGACATAGCGTTCCCTCGAATAAATAATATGAGCTTTTGACTATTACCACCATCTTTCCTACTACTGCTTGCATCTTCAACAGTTGAAGCAGGGGCCGGCACAGGGTGGACCGTTTACCCACCATTGGCAGGAAATCTAGCCCATGCTGGAGCGTCAGTGGATCTT---GCTATTTTTTCACTTCATCTGGCAGGGGTGTCTTCCATTCTAGGGGCAATTAATTTCATTACAACTATTATTAATATAAAACCCCCTGCTATGTCCCAGTACCAAACACCACTTTTCGTCTGATCAGTAATAATTACAGCAGTTCTTCTTCTCTTATCCCTTCCCGTTTTAGCTGCT---GGAATTACAATACTTCTTACAGATCGTAACTTGAATACAACATTCTTTGACCCAGCAGGAGGAGGAGACCCAATCCTTTACCAACATCTATTCTGATTCTTTGGACACCCAGAAGTATATATTCTTATTCTACCAGGATTTGGTATTATTTCACATATCGTAACATATTATGCAGGTAAAAAA---GAACCTTTTGGTTATATAGGGATGGTGTGAGCAATAATATCTATCGGCTTCCTTGGTTTTATTGTATGAGCTCACCATATGTTTACTGTTGGCCTGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sminthopsis crassicaudata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Burbidge, A., Robinson, T., Ellis, M., Dickman, C., Menkhorst, P. & Woinarski, J.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance of habitat modification, lack of major threats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Fat-tailed Dunnarts are common (Morton and Dickman 2008). They are common even in degraded and agricultural areas.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There appear to be no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Fat-tailed Dunnart is found in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fat-tailed Dunnart

The Fat Tailed Dunnart (Sminthopsis crassicaudata) is a species of mouse-like marsupial of the Dasyuridae family, the family includes the Little Red Kaluta, quolls, and the Tasmanian Devil. It has an average body length of 60–90 mm with a tail of 45–70 mm. Ear length is 14–16 mm. Its weight varies between 10-20 grams, it is one of the smallest carnivorous marsupials. The tail becomes fat a few mm from the anus and right up to the tip of the tail.

Contents

Distribution and habitat

The range of S. crassicaudata in Australia is in diverse habitats except for the Kimberley region of Western Australia and northern Northern Territory like Arnhem Land and Kakadu National Park, but avoids the Wannon and Mallee scrub habitats in Victoria. In the northeast of Victoria, the species can also be found in grassy woodlands and samphire shrublands. The subspecies S. c. crassicaudata is in the Epping Forest National Park in Queensland. S. c. ferruginea is found around Lake Eyre in South Australia. S. c. centralis is found in Killalpannina (as Killalpanima, Lake Eyre East), SA.Fat tailed dunnarts can be found in most deserts in Australia e.g. Simpson desert, Gibson Desert.

The habitats in which the species can be found include sparse grasslands, open shrublands and farmlands where there is considerable bare land. The impact of unimproved farming has been positive for this species as the type of habitat created is suitable to this dunnart's requirements, but intensive agriculture is seen as a negative factor for the species.

Social organisation and breeding

This species breeds from July to February, with the young in the pouch from July to April (Morton 1978b). Gestation is for 13 days and the young remain in the pouch for 70 days with litter size on average 7.5 with a 33% infant death rate. They generally have 2 litters per year with females not breeding for the first year. The average life span of the females is 18 months, and males 15 months.

Diet

The Fat-tailed Dunnart's diet includes insects such as beetles, spider larvae, small reptiles, and amphibians. It stores fat reserves in its carrot-shaped tail for times of food shortage.

Survival

The Fat-tailed Dunnart can survive in extreme, semi-arid environments. This is due to various physiological and behavioral characteristics. First, this marsupial is nocturnal and functions within a 24-hour circadian rhythm.[3] During the nighttime it is protected from high temperatures that cause energy loss. While awake, it spends the majority of its time feeding. Every night it consumes approximately its own body weight of food.[3] During periods of food shortage it decreases its duration of activity while also increasing its intensity of feeding.[4] It uses specialized, sharp teeth to grind its prey into fine pieces. This increases its ability to obtain nutrients from its prey. It has a high rate of digestion and can use fat stored in its tail as an energy source.[3]

Another survival technique that it uses is daily torpor. It lowers its body temperature and metabolic rate,[5] in order to reduce energy expenditure. Torpor is unaffected by alterations in photoperiod but is greatly affected by environmental conditions. Two conditions must occur in order for the fat-tailed dunnart to use daily torpor: low ambient temperatures and food shortage.[3][6] There are seasonal variations in torpidity. They use it more often in the winter because food is scarce and it requires more energy to maintain a high constant body temperature. During torpor, the body temperature can drop as low as 14.6 °C.[5][7] This species does not use torpor for extended periods of time, thus the heart rate is variable and does not reach a steady state, such as seen in long-term torpidators. This species is unique in that it can use torpor during development and reproduction. Even during lactation a female is capable of entering daily torpor without affecting the offspring.[8][9]

Coupled with the daily torpor is a process called re-warming. The re-warming process demands a high amount of energy in order to raise the body temperature.[9] After awaking from a torpid state, these marsupials actively seek out areas in which they can bask in the sun to aid in this process.[10]

Nesting is also used as behavioral, survival technique. During times of cold temperatures, the fat-tailed dunnart shares nests with other rodent species such as the household mouse, Mus musculus, to conserve heat. This is unusual because the fat-tailed dunnart preys upon these mice during less extreme conditions.[3] Group nesting is observed only during times of non-breeding.[11]

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 34. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Burbidge, A., Robinson, T., Ellis, M., Dickman, C., Menkhorst, P. & Woinarski, J. (2008). Sminthopsis crassicaudata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b c d e Tyndale-Biscoe, Hugh (2005). Life of Marsupials. CSIRO Publishing. ISBN [[Special:BookSources/0-643-06257-3|0-643-06257-3]]. 
  4. ^ Crowcroft, Peter; Gillian K. Godfrey (Feb, 1968). "The daily cycle of activity in two species of Sminthopsis (Marsupial: Dasyuridae)". Journal of Comparative Physiology & Biochemistry (British Ecological Society) 73 (1): 63–73. 
  5. ^ a b Warnecke, Lisa; James Turner, Fritz Geiser (2008). "Torpor and basking in a small arid zone marsupial". Naturwissenschaften 95 (1): 73–78. doi:10.1007/s00114-007-0293-4. PMID 17684718. 
  6. ^ Holloway, J.C.; F. Geiser (1996). "Reproductive status and torpor of the marsupial Sminthopsis crassicaudata: Effect of photoperiod". Journal of Thermal Biology 21 (6): 373–380. doi:10.1016/S0306-4565(96)00023-X. 
  7. ^ Geiser, F.; R.V. Baudinette (1987). "Seasonality of torpor and thermoregulation in three dasyurid marsupials". Journal of Comparative Physiology and Biochemistry (Springer Verlag) 157: 335–344. 
  8. ^ Zosky, G.R. (Aug. 2002). "The parasympathetic nervous system: its role during torpor in the fat-tailed dunnart ('Sminthopsis craussicaudata")'". Journal of Comparative Physiology & Biochemistry (Springer Verlag) 172 (7): 677–684. 
  9. ^ a b Geiser, F.; Christian, Nereda and Cooper, Christine and Krtner, Gerhard and McAllan, Bronwyn M. and Pavey, Chris and Turner, James M. and Warnecke, Lisa and Willis, Craig K. R. and Brigham, R. Mark (6 Aug 2008). "Torpor in marsupials: recent advances". In Lovegrove, B. and McKechnie, A. E. (ed). 13th International Hybernation Symposium 2008. Swakopmund, Namibia: University of KwaZulu-Natal. pp. 297–307. 
  10. ^ Warnecke, Lisa; Fritz Geiser (2010). "The energetics of basking behavior and torpor in small marsupial exposed to stimulated natural conditions". Journal of Comparative Physiology and Biochemistry 180: 437–445. 
  11. ^ Morton, S.R. (Aug, 1978). "The energetics of basking behavior and torpor in small marsupial exposed to stimulated natural conditions". Journal of Mammology (American Society of Mammologist) 53 (3): 569–575. 
  • Menkhorst, Peter W. (1995). Mammals of Victoria. Oxford Press. ISBN 0-19-553733-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!