Overview

Distribution

Range Description

Brush-tailed Phascogales are endemic to Australia, where they occur in the eastern portion of the country, and in western Kimberley and south-western Western Australia. They are not found on any islands in Western Australia.

The species is known from at least ten localities within northern Queensland and Cape York Peninsula, and they have most commonly been recorded around the Cooktown region (S. Rhind pers. comm.). There have been about 30 reports of phascogales since the 1970s, with records between 1976 and 1995 extending the known range south into northern Queensland by more than 500 km (S. Rhind pers. comm.). There are also records from the Rockhampton area (Ingram and Raven 1991). It was formerly widespread elsewhere in eastern and south-western Australia. The range has been reduced by about 50% since European settlement predominantly due to agricultural clearing, forestry practices, and deforestation associated with mining activities (Traill and Coats 1993; Rhind 2004). It is presumed to be extinct in South Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Northern Brush-tailed Phascogale is found in the Top End of the Northern Territory, where it has been recorded from the Melville Island, Cobourg Peninsula, West Pellew Island, Kakadu National Park, Garig Gunak Barlu National Park, and Litchfield National Park (Woinarski 2005; Rhind et al. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Phascogale topoatafa has a fragmented distribution, being found in various parts of Australia, including northern and southwestern Western Australia, northernmost Northern Territory, northern and southeastern Queensland, eastern New South Wales, the southern parts of Victoria, the Cape York peninsula, and isolated parts of South Australia (Nowak, 1991). There is some evidence of Phascogale tapoatafa in East Gippsland, though this has not been confirmed.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Brush-tailed phascogales are squirrel-sized marsupial mice with a head and body length (excluding the tail) of between 160-230mm. Tail length varies from 170-220mm, or roughly half of body length. They weigh between 110-235 grams, the largest wild specimen known weighed 311 grams. Males tend to be heavier on average than females and this sexual dimorphism first appears at the age of eight months (Nowak, 1999). They are a deep grey color on their dorsal surface and creamy, pale white on the venter. The tail is dark black and it is characterized by having long, black, silky hairs that cover the terminal portion. These long hairs are erected during normal activity producing a "bottle-brush effect" (Nowak, 1999). The erected tail hairs is thought to distract the attention of predators away from the body (Soderquist, 1994). The ears are large and almost lacking hair. Females have eight mammae and lack a true pouch. The pouch consists of a heavy fold of skin covered with coarse, brown hair.

Range mass: 110 to 311 g.

Average basal metabolic rate: 0.694 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is now largely confined to dry sclerophyll forests and open woodlands that contain hollow-bearing trees. It occurs more rarely in wetter forests. Brush-tailed Phascogales are arboreal, nocturnal, and largely solitary. Females typically give birth to eight young, or six to eight in south-western Australia (Soderquist and Rhind 2008). Males die soon after the breeding season, and females can live up to three years, but usually only produce one litter (Soderquist and Rhind 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is solitary, nocturnal, and arboreal. It nests within tree hollows during the day, and forages both on the ground and in trees mostly for invertebrates, but also some small vertebrates (Woinarski 2005). There is little information on the habitat requirements of this species. Most recent records are from tall open forest of Eucalyptus miniata-E. tetrodonta forests (Rhind et al. 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Brush-tailed phascogales prefer eucalyptus forests in Australia for foraging grounds and nesting sites. They inhabit both humid and arid regions and dense to open forest (Nowak, 1999). Preferred habitat is open, dry schlerophyll forest with little ground cover and average rainfall between 500 and 2000mm (Strahan, 1983). Hollow trees are preferred for nesting sites (Nowak, 1999).

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Brush-tailed phascogales are mostly carnivorous. They hunt and kill small mammals, birds, reptiles, insects, spiders, and centipedes. They have been know to kill and eat chickens, and they generally avoid eating carrion. Phascogale tapoatafa can be arboreal and has been known to feed on the nectar of eucalyptus flowers (Nowak, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: male

Status: captivity:
3.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.9 years (captivity) Observations: Males are only reproductively viable for one breeding season. Females in the wild can breed for a second year. One captive specimen was at least 5.9 years old when it died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females nest in up to 30 different sites every year (Grzimek, 1990). Nests are found in hollow trees or tree stumps and under flaking bark. Competition is fierce for these limited resources Nowak, 1999). Mating takes place in early winter and males typically die after breeding at the age of 11-12 months. This is the largest known mammal in which males die after their first breeding season. It is believed that the energy expended in competition for mates leaves males susceptible to stress-induced diseases. Gestation period is roughly 30 days. Litters of seven to eight young are born and remain in the pouch for seven weeks. Young then stay in the nest until they are about 5 months old while the mother forages for food (Millis, 1999). Females raise one litter (sometimes two) in their lifetime, as they typically die in their second year. Females show dominance over males despite their smaller size and they seem to mate with a partner of their choice (MacDonald, 1984). The estrus cycle of females is roughly 40 days, and male spermatogenesis ceases before breeding while testosterone levels remain high (Millis, 1999).

Average gestation period: 29 days.

Average number of offspring: 6.4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascogale tapoatafa

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0137-06|AJ639869|Phascogale tapoatafa| ACTCGATGGTTTTTTTCTACTAATCACAAAGACATCGGAACTCTATATTTACTTTTCGGTGCTTGAGCAGGAATAGTCGGCACCGCTTTA---AGCCTCCTTATTCGAGCAGAACTTGGGCAGCCAGGAACTTTAATCGGAGAT---GATCAAATTTACAACGTAATTGTCACAGCCCACGCCTTTGTAATAATTTTCTTTATAGTCATACCCATTATAATTGGGGGCTTCGGCAATTGACTGGTACCATTAATA---ATCGGGGCTCCCGACATAGCATTTCCCCGGATAAATAATATAAGCTTCTGATTGCTCCCCCCATCCTTCCTTCTTCTCTTAGCATCTTCAACAGTTGAAGCAGGAGCTGGAACTGGCTGAACAGTGTACCCCCCTCTAGCGGGCAATCTTGCTCACGCGGGAGCCTCTGTAGACTTA---GCTATTTTTTCACTTCACCTAGCAGGAATCTCATCCATCTTAGGAGCTATTAATTTTATCACAACAATCATCAATATAAAACCTCCAGCAATATCCCAATACCAAACACCATTATTTGTATGATCCGTCATAATTACAGCAGTTTTACTTCTTCTATCTTTACCCGTACTAGCAGCC---GGCATTACAATACTCCTAACCGACCGTAATCTCAATACAACATTCTTTGATCCTGCCGGAGGAGGAGATCCAATCTTATATCAACATTTATTCTGATTTTTTGGCCACCCAGAAGTATATATCCTAATTCTACCTGGGTTTGGTATTATTTCCCACATTGTAACATATTACGCAGGCAAAAAA---GAGCCATTTGGTTATATAGGTATAGTATGAGCAATAATGTCCATCGGCTTCCTAGGCTTTATCGTCTGAGCCCACCATATATTTACTGTTGGCCTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phascogale tapoatafa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Menkhorst, P., Rhind, S. & Ellis, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Near Threatened because this species is in decline (but at a rate of less than 30% over ten years) because of habitat clearance, degradation, fragmentation, and the impact of introduced predators, making the species close to qualifying for Vulnerable under criterion A2ce.

History
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Woinarski, J., Rhind, S. & Oakwood, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Vulnerable because there are less than 10,000 mature individuals overall, less than 1,000 of which are in any one subpopulation, and there is likely to be continuing decline in populations due to a variety threats.

History
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Brush-tailed phascogales occur are widespread but occur at low densities. Populations may be in decline but the causes are unknown. Preferred forest habitat is being destroyed and fragmented for agriculture, timber, firewood production, and mining (Nowak, 1999). Also, the introduction of feral species such as red fox and domestic cats have a negative influence on Phascogale tapoatafa populations as these two feral species act as predators. As a result, brush-tailed phascogales have disappeared from approximately half of their original range (Soderquist, 1995).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Population

Population
Abundance within its range is mostly unknown because the species eludes conventional faunal survey techniques. It is sparsely distributed and is typically reported from infrequent single sightings and/or captures.

There is little information on the Kimberley population, which is represented by only 23 records (S. Rhind pers. comm.). In south-western Australia, the population fluctuates markedly in response to climatic conditions (Rhind and Bradley 2002). The species may have declined in the south-west in the last ten years; there are fewer records in spite of increased survey effort. It is presumed to be extinct in South Australia (last reliable record is from 1967). In Victoria, there have been major declines in the past, but populations appear to have stabilized more recently. In New South Wales phascogales are most commonly encountered on the north coast, particularly from Taree to Port Macquarie and Coffs Harbour and parts of the Hunter Valley. It is uncommon to rare in northern Queensland.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total global population of this species is estimated to be less than 10,000 mature individuals and it might be less than 2,500. The Northern Brush-tailed Phascogale was said to be very common historically, though currently there are only about 10 records known from the mainland in the last decade despite intensive survey work for the species (Rhind et al. 2008). There are two recent records from Melville Island (Firth et al. 2006), and two records from West Pellew Island (1988), but a recent survey of West Pellew was unable to locate it (Taylor et al. 2004).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Reduction in area of occupancy for this species has been predominantly caused by gross habitat alteration including continued habitat clearing and fragmentation. Habitat alteration as a result of logging and mining has also been detrimental to the species. The greatest current threat is the increasing decline in the availability of hollow-bearing trees. Predation by foxes and cats is also a threat. Male die-off makes this taxon particularly vulnerable to stochastic events. Reproductively viable populations require large areas of suitable habitat in order to persist because male home ranges are often greater than 100 hectares (Soderquist and Rhind 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Inappropriate fire regimes which alter the understorey to increase the presence of tall grasses (especially exotic grasses) and habitat degradation associated with pastoralism are the main threats to the species (Rhind et al. 2008). The clearance of vegetation is a threat in the western portion of the mainland range and on Melville Island where exotic tree plantations are detrimental and expanding (Firth et al. 2006; Rhind et al. 2008). Introduced cane toads and cats might be threats (Rhind et al. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Recommended actions for this species include: taxonomic work to assess the status of the various regional populations; developing survey techniques for this species to increase knowledge of its distribution, population status, and to allow for monitoring; identifying key habitats and populations; determining the relative importance of threatening processes throughout its range; and determining the potential impact of 1080 baiting on phascogales in south-east Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
It is found within three protected areas: Litchfield, Garig Gunak Barlu, and Kakadu National Parks. More surveys and monitoring are needed on the distribution, abundance, habitat requirements, and population trends of this species (Woinarski 2005). Targeted surveys for this animal, which is not readily trapped using standard methods (A. Burbidge pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

They have been known to raid chicken farms but the benefits of pest regulation seem to outweigh any negative impact they may have.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Phascogale tapoatafa is considered effective at helping to control insect and rodent pest populations since it is a natural predator of these animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brush-tailed phascogale

The brush-tailed phascogale (Phascogale tapoatafa), also known as the tuan, the common wambenger or the black-tailed phascogale, is a rat-sized arboreal carnivorous marsupial of the family Dasyuridae, characterized by a tuft of black silky hairs on the terminal portion of its tail. Males of this species do not live past the age of one, as they die after reproducing.

Contents

Taxonomy

The brush-tailed phascogale was first described by F. Meyer in 1793; George Shaw published a revised description in 1800. For some time it was considered a member of the opossum genus Didelphis, but this ended in 1844 when Coenraad Jacob Temminck erected the genus Phascogale. The species is closely related to the red-tailed phascogale (P. calura). Its scientific name, tapoatafa, is a reference to an indigenous Australian[which?] name for the species. It has sometimes been known as Phascogale penicillata, referring to its brushed tail. There are two subspecies:[3]

Description

This phascogale is black. Its tail is covered with long black hairs on the lower half that can erect, causing it to appear similar to a bottle brush.[4]

Distribution and habitat

The brush-tailed phascogale has a widespread but fragmented distribution throughout all states of Australia, excluding Tasmania. As a result of habitat destruction and predation by the red fox and feral cat, they are believed to have disappeared from roughly half of their former range. The species is considered very vulnerable to localised extinction.[3]

It is listed as a vulnerable species on Schedule 2 of the Threatened Species Conservation Act, 1995 (TSC Act, NSW). However the IUCN Red List lists it only as near threatened, and it does not have a EPBC Act status.

Diet

This species is a nocturnal and arboreal hunter. It eats smaller mammals, birds, lizards, and insects, particularly spiders.[4] It also drinks nectar from flowering trees.[4]

Reproduction

Breeding occurs between June and August when the females come into estrus. All male brush-tailed phascogales die before reaching one year of age, generally from stress-related diseases brought about by the energy expended in a bout of frenzied mating.[4] However, some captive males have lived to the age of three, though they were reproductively unviable after the first year.[4] Females nest in hollow trees, bearing litters of 7 to 8 young which stay in the nest to the age of 5 months.

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 32. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Menkhorst, P., Rhind, S. & Ellis, M. (2008). Phascogale tapoatafa. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as near threatened
  3. ^ a b Soderquist, T. (1995). "Brush-tailed Phascogale". In Strahan, Ronald. The Mammals of Australia. Reed Books. pp. 104–106. ISBN 0-7301-0484-2 
  4. ^ a b c d e Ellis, Richard (2004). No Turning Back: The Life and Death of Animal Species. New York: Harper Perennial. pp. 227. ISBN 0-06-055804-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!