Overview

Distribution

Range Description

The Northern Quoll occurs in the northern parts of Australia. Historically, it occurred in northern Australia from Pilbara to south-east Queensland, extending inland as far south as Alexandria. More recently, there has been substantial decline in southern and eastern Queensland and the Cape York Peninsula. The Northern Quoll has apparently disappeared from most or all of the lower rainfall former range in the Northern Territory and south-east and south-west Kimberley. A substantial decline has also occurred in Pilbara (Maxwell et al. 1996). The species has been recorded from Groote Eylandt and the nearby North-east Island, Marchinbar Island (in the Wessel group), Inglis Island (in the English Company Islands group) and Vanderlin Island (Sir Edward Pellew group). It has also been recently translocated to Astell and Pobassoo Islands in the English Company island group (Woinarski 2005). This species occurs up to around 1,300 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dasyurus hallucatus now appears to be restricted to six areas in Australia: the Hamersley Range; the Northern Kimberley; northern and western Top End; Cape York tip; Atherton Tableland; and Carnarvon Range. In the past they lived over a larger range of northern Australia, extending from the Pilbara region of Western Australia to southeastern Queensland.

(Strahan, 1995)

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dasyurus hallucatus is the smallest of the four quoll species, weighing, at most, 2 pounds. Males tend to be larger than females, ranging in weight from 400 grams to 900 grams. Females weigh between 300 grams and 500 grams. Differences in weights between sexes can be observed as early as five months of age. Head and body length of D. hallucatus ranges from 240 to 350 millimeters and tail length ranges from 210 to 310 millimeters.

Individuals have prominent white or cream blotches on the back and side of their grey-brown to brown coat. The tip and entire ventral surface of the tail is dark brown or black. Their coat is generally short and coarse, with little underfur. They have five toes and striated pads on the hindfeet, which are probably an adaptation for climbing on smooth, rocky surfaces.

(Strahan, 1983; Grzimek, 1990; Schmitt, 1989; Nowak, 1991)

Average mass: 525 g.

Average basal metabolic rate: 1.501 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Northern Quoll occurs in a range of habitats including Eucalyptus open forest, monsoon rainforest, and savanna woodlands. The species is most abundant (and apparently with less fluctuations) in rocky environments. In north Queensland, it is most common in coastal and/or high altitude rocky areas and in drier habitats of upland tablelands (Maxwell et al. 1996). This species is a generalist, as it occurs in a wide range of habitats and its diet consists of a variety of invertebrates and small vertebrates (Woinarski 2005). The Northern Quoll shelters in hollow logs, rock crevices, caves, and tree hollows (Woinarski 2005). It is mostly a ground-dwelling species, but is also an adept climber (Woinarski 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This native cat is most abundant in broken, rocky country. They also inhabit eucalyptus forests that are no further than 150 kilometers from the coast. Populations tend to fare better in certain environments. In rocky habitats, males and females tend to live for two years. In savanna areas few males make it through the second year.

(Strahan, 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Little northern native cats are very aggressive carnivores . Their diet varies and can include mammals such as Large Rock Rats, Common Rock Rats, and Sandstone Antechinus, as well as reptiles, worms, ants, termites, grasshoppers, beetles, figs and other soft fruits. During the activity of searching for food with their moist and dripping snoust, little northern native cats constantly emit audible sniffling sounds. These animals have huge appetites.

(Grzimek, 1990; Nowak, 1991; Strahan, 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
5.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5.9 years (captivity) Observations: This species can exhibit semelparity. In tropical savannah, males die off after mating and exhibit weight loss, fur loss, parasite infestation, increased testosterone levels and anaemia, though not increased corticosteroid levels (Oakwood et al. 2001). One captive specimen lived 5.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

All native cats appear to be monoestrous, winter breeders. The most successful reproduction of Dasyurus hallucatus occurs near creeklines due to the constant supply of water. In late June mating occurs and up to eight young are born between late July and September (during the dry season). At birth the young measure only about 3 millimeters in length. Females lack a pouch; however, in May the area surrounding their eight mammae becomes enlarged and partially surrounded by a flap of skin. Young are carried by the mother for eight to ten weeks. As many as one-third of them may be lost by September. The young are suckled in the nest until they are about five months old, they reach full maturity by 10 to 11 months.

Reproductive seasonality occurs in this species. Both sexes usually survive to reproduce in subsequent mating seasons, however there is some evidence that males have a higher turnover, with some of them dying after mating.

(Schmitt, 1989; Nowak, 1991; Strahan, 1995)

Average number of offspring: 6.8.

Average age at sexual or reproductive maturity (male)

Sex: male:
315 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
315 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dasyurus hallucatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0380-06|AY795973|Dasyurus hallucatus| ACTCGATGACTTTTCTCTACAAATCATAAAGACATCGGAACTCTTTACCTATTATTTGGGGCTTGAGCAGGTATAACTGGCACAGCATTA---AGTCTTCTAATTCGAGCTGAACTCGGTCAGCCAGGTACTCTTATTGGTGAT---GATCAAATTTATAATGTTATCGTTACAGCCCATGCCTTTGTAATAATTTTCTTTATAGTAATACCCATTATGATTGGAGGTTTTGGTAACTGGTTAGTCCCTCTAATG---ATCGGGGCTCCTGATATAGCATTCCCTCGAATAAATAATATGAGTTTCTGACTGTTACCACCATCATTCTTACTTCTTTTAGCATCCTCAACCGTTGAAGCTGGTGCTGGGACCGGGTGAACAGTCTATCCTCCTTTAGCAGGCAACCTTGCCCACGCAGGAGCATCCGTTGATCTG---GCTATTTTCTCCCTCCACTTAGCAGGAGTTTCATCTATTCTAGGCGCTATTAACTTTATTACCACTATTATTAACATAAAACCCCCTGCAATGTCTCAATATCAAACGCCTCTATTCGTTTGATCTGTGATAATTACAGCAGTTCTACTTCTACTCTCACTACCTGTTCTCGCAGCA---GGCATCACAATATTACTAACTGACCGCAACCTTAATACAACATTTTTCGACCCTGCCGGTGGAGGTGATCCTATTCTATATCAACATCTGTTCTGATTTTTTGGTCACCCTGAAGTCTACATCCTAATCTTACCAGGGTTTGGTATAATCTCTCATATCGTTACTTACTATGCAGGTAAAAAA---GAACCTTTTGGCTATATAGGAATAGTTTGAGCAATAATATCAATTGGCTTTCTAGGCTTTATTGTATGAGCTCACCATATATTCACTGTAGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dasyurus hallucatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2ce+3ce+4ce

Version
3.1

Year Assessed
2008

Assessor/s
Oakwood, M., Woinarski, J. & Burnett, S.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Endangered because of a serious population decline, estimated to exceed 50% over the last 10 years, and one that is projected to continue at a similar rate over the next 10 years based on the effects of habitat destruction and/or degradation, cane toads, and introduced predators.

History
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

There are three main reasons why populations of Dasyurus hallucatus are threatened. Introduced cats and dogs prey on little native cats, habitat destruction through human modifications have restricted their ranges, and an epidemic disease in the early part of the 20th century decimated the populations of many marsupial species in Australia.

(Nowak, 1991)

US Federal List: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The species is locally common, although it currently is undergoing declines across much of its range. Densities of 3-4 females per square kilometre in savanna woodland have been recorded (Oakwood 2002). Several studies suggest that there has been a recent, severe population declines in Kakadu National Park due to cane toads (Watson and Woinarski 2003; Oakwood 2004). This species is common in north-western Kimberley, particularly in near-coastal, high-rainfall areas (A. Burbidge pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Current threats are uncertain, but the species may be vulnerable to disease, possibly related to the presence of cats. Cats and dogs are known to kill individuals, although they apparently do not like to eat them. Predation is the main cause of mortality in some areas (exacerbated by changes in fire regimes that result in more frequent burning), particularly woodland and forest habitats (Maxwell et al. 1996). There have been recent substantial population declines in the Iron Range (Queensland), Cape York Peninsula, and the top end of the Northern Territory associated with the spread of cane toads and land-use changes. For instance, major declines to regional extinction have been reported for Northern Quolls following cane toad invasion on Cape York Peninsula (Burnett 1997). Northern Quolls appear to be particularly susceptible to the poison of cane toads, and are killed when they attempt to kill or consume the toads (Woinarski 2005). The species has also disappeared from coastal lowland areas in north Queensland following agricultural and urban development (Maxwell et al. 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Northern Quoll occurs in a number of protected areas. Recommended actions for this species (Maxwell et al. 1996) include: monitor abundance and disease status at selected sites across range; undertake additional research into causes of decline. In the Northern Territory, it has been recorded from 15 conservation reserves (Kakadu, Litchfield, Garig Gunak Barlu, Mary River, Manton Dam, Nitmiluk, Umbrawara Gorge, Fogg Dam, Charles Darwin, Black Jungle, Tjuwaliyn (Doglas Hot Springs), Berry Springs, Limmen, Leaning Tree Lagoon, and Howard Springs) (Woinarski 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

In Australia, the Northern Quoll is threatened by the invasion of the highly toxic Cane Toad, Bufo marinus. Following toad invasion, quoll populations have become extinct across Northern Australia and consumption of these toads has been suspected as a major cause. O'Donnell et al. (2010) report watching quolls attacking large toads, then convulsing and dying. Because eliminating the toads is likely impossible, O'Donnell et al. decided to explore the possibility of conditioned taste aversion (CTA), i.e., teaching quolls to avoid the toads. In this case, they offered a small non-toxic toad that had been dosed with the nausea-inducing chemical thiabendazole in powdered form. A single experience with this chemical resulted in a significant reduction in attacks on toads and a significant increase in apparent survival in the field. The authors note that CTA has wider potential applications. For example, it could be used to mitigate the impacts of invasive vertebrate predators on threatened native fauna. When invasive predators cannot be eradicated, CTA might provide a feasible way to maintain populations of endangered fauna in the presence of the invader. (O'Donnell et al. 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Native cats have been known to raid poultry yards, which makes them an annoyance to some farmers.

(Nowak, 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Native cats destroy many mice and agricultural insect pests.

(Nowak, 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern Quoll

The Northern Quoll (Dasyurus hallucatus), also known as the Northern Native Cat, the Satanellus, the North Australian Native Cat or the Njanmak (in the indigenous Mayali language), is a carnivorous marsupial mammal, native to Australia.

Contents

Taxonomy

The Northern Quoll is a member of the family Dasyuridae, and is often stated to be the most distinctive Australian quoll. It was first described in 1842 by the famed naturalist and author John Gould, who gave it the species name hallucatus, which indicates that it has a notable first digit. This species has sometimes been placed in a separate genus, Satanellus.

There are no recognised subspecies.

Life history

The Northern Quoll is the smallest of the four Australian quoll species. Females are smaller than males with adult females weighing between 350-690g and adult males 540-1120g. Head and body length ranges from 270-370mm (adult males) to 249-310 (adult females). Tail length ranges between 202-345mm. A remarkable feature of this species is that the males show complete die-off after mating, leaving the females to raise the young alone.

Northern Quolls feed primarily on invertebrates, but also consume fleshy fruit, and a wide range of vertebrates including small mammals, birds, lizards, snakes and frogs. They also scavenge on road-kills, around campsites and in garbage tins.

Range and habitat

The Northern Quoll occurs from the Pilbara region of Western Australia across the Northern Territory to south east Queensland. Their historical range extended uninterrupted from S.E Queensland to the Kimberleys in Western Australia [3]. There are several disjunct populations. This quoll species is most abundant in rocky ranges and open eucalypt forest.

Conservation status

1863 illustration by John Gould

The Northern Quoll is now absent from many parts of its former range.The Northern Quoll has recently been listed as Endangered under Australian Commonwealth legislation (EPBC Act), although it is listed as Near Threatened by the IUCN. The current major threat to the Northern Quoll is the spread of cane toads, which were originally introduced in Queensland, but have now reached Kakadu National Park in the Northern Territory, and are nearly in Darwin.

In two Kakadu study sites, quolls have become extinct at one site and declined from 45 individuals to 5 at the other site. The unconfirmed conclusion to be drawn from this is that the Northern Quoll will cease to exist in most areas in the Top End of the Northern Territory once the toad population completely overlaps the Northern Quolls range. There are remnant populations of Northern Quolls still persisting in Queensland where toads have been present for many years. Scientists do not yet understand the mechanism for their persistence; some will focus on this area in future research.

To help protect northern quolls against cane toads a University of Sydney project, revealed in 2010, is teaching them to avoid eating the invasive amphibians through taste aversion.[4]

References

Cited references

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 25. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ Oakwood, M., Woinarski, J. & Burnett, S. (2008). "Dasyurus hallucatus". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/6295. Retrieved 28 December 2008.  Database entry includes justification for why this species is listed as endangered
  3. ^ Menkhorst. P, Knight. F "A field Guide to the Mammals of Australia" Oxford University Press South Melbourne, 2001, p.48 ISBN 0-19-550870-X
  4. ^ "Taste training for northern quolls". Australian Geographic. http://www.australiangeographic.com.au/journal/quolls-in-danger.htm. Retrieved 2010-04-15. 

General references

  • Braithwaite, R.W. & R.J. Begg (1995), "Northern Quoll", in Strahan, Ronald, The Mammals of Australia, Reed Books
  • Oakwood, M. 2000. Reproduction and demography of the northern quoll, Dasyurus hallucatus, in the lowland savanna of northern Australia. Australian Journal of Zoology 48, 519-539.
  • Oakwood, M. and Spratt, D. 2000. Parasites of the northern quoll, Dasyurus hallucatus (Marsupialia: Dasyuridae) in tropical savanna, Northern Territory. Australian Journal of Zoology 48, 79-90.
  • Oakwood, M., Bradley, AJ., and Cockburn, A. 2001. Semelparity in a large marsupial. Proceedings of the Royal Society of London, B. 268, 407-411.
  • Oakwood, M. 2004. Death after sex. Biologist 51, 5-8.
  • Oakwood, M. 2004. Case of the disappearing spots. Nature Australia 26, 26-35.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!