Overview

Brief Summary

The Egyptian fruit bat according to MammalMAP

Egyptian fruit bat. Egyptian rousette.  Rousettus aegyptiacus.  All these names refer to this widespread megabat.  These bats are typically dark brown to light grey in colour and weigh an average of 150 g.  Its wingspan stretches to 60 cm.  Their eyes are large and are adapted for twilight and night vision.

Like the name suggests, Egyptian fruit bats feed on large amounts of fruit.  Wild dates are their favourite but they will consume any soft, pulpy fruit.  They can also eat unripe, insect damaged fruit which helps them to tolerate habitats that may not have ripe fruit all year round.  These bats perform a vital ecosystem role by pollinating the fruit trees as well as aid seed dispersal when they spit out the seeds of the fruit.

These bats form colonies that vary in size.  Once breeding season is finished, males and females will roost closely together to reduce fluctuations in temperature.  This also allows the colony to communicate during the day.  At sunset, individuals leave the roost to forage and will return before sunrise.  These bats use visual orientation and echolocation to navigate their environment.  Egyptian fruit bats produce a series of short clicks using their tongue against the side of their mouth and use these clicks to navigate in the dark.

Egyptian fruit bats usually have a single baby each year but twins are occasionally born. Female bats carry their young at first but after awhile they will leave them at the roosts while they find fruit. At 3 months old, young bats learn to fly on their own. These bats typically stay in the same colony that they were born in.

The IUCN Red list classifies Egyptian fruit bats as a species of Least Concern.  Despite some fruit farmers poisoning and killing some bats on their farm, the species is wide spread and abundant.

For more information on MammalMAP, visit the MammalMAP virtual museum or blog.

Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Patchily distributed across sub-Saharan Africa and North Africa; also ranges outside of Africa through south-west Asia to Iran and Pakistan; also on Cyprus.

In the Western Palaearctic it occurs as two forms: R. a. arabicus (Iran, southern Arabia, Pakistan), R. a. aegyptiacus (rest of range). In sub-Saharan Africa occurs as four forms: subspecies leachi is found in SW Ethiopia, S Sudan, E and S DR Congo, Uganda, Kenya, Tanzania, Zambia, Malawi, Zimbabwe, Mozambique, and the extreme E and south of South Africa, including Swaziland and Lesotho; subspecies princeps is endemic to Principe Island in the Gulf of Guinea; subspecies tomensis is endemic to Sao Tome; and subspecies unicolor is found from Senegal and the Gambia east to Liberia, Ivory Coast, Ghana, Togo, south to northern central Nigeria and W Cameroon and Bioko Island, then south from Gabon and Congo to western DRC and W Angola.

Elevational range: from sea level to 4,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Widespread (Nile Valley and Delta, North Coast, South Sinai).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Rousettus aegyptiacus is found throughout Africa south of the Sahara, in Egypt, and on the coastlines of the Arabian Peninsula (Grzimek, 2003). Egyptian rousettes are most common from latitudes 15 degrees north through 37 degrees south. However, they have been found as far as 40 degrees north in southern Turkey. They are also found on each of the Canary Islands, western North Africa, and throughout the Gulf of Guinea (Nogales et al., 2006; Nowak, 1999).

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Grzimek, B. 2003. Grzimek's Animal Life Encyclopedia. Farming Hills, Michigan: Gale Virtual Library.
  • Nogales, M., J. Rodriguez-Luengo, P. Marrero. 2006. Ecological Effects and Distribution of Invasive Non-Native Mammals on the Canary Islands. Mammal Review, 36: 49-65.
  • Nowak, R. 1999. Walker's mammals of the world. Baltimore: John Hpkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Egyptian rousettes are medium sized bats with dorsal pelage ranging from dark brown to medium gray. Ventral pelage in both genders is several shades lighter than dorsal coloration, with a collar of pale yellow or orange fur often seen around the neck. There is no color difference between genders; however, males have well-developed stiff hairs along the throat that are more recognizable than in females (Kwiecinski and Griffiths, 1999). Short fur completely covers the head almost to the end of the muzzle, with the exception of the forehead, where the fur is slightly longer. Ears are around the length of the muzzle, with blunt tips and dark coloration when compared to dorsal pelage. Egyptian fruit bats have large eyes adapted for twilight and night vision.  Wing membranes are dark brown with short fur extending to the proximal half of the forearm. A claw is present on both the first and second digits, while all other digits have cartilage. Egyptian rousettes have five toes on both hind limbs, each with claws (Kwiecinski and Griffiths, 1999).

Males are typically larger than females with a total body length ranging from 14 to 19.2 cm, while females range from 12.1 to 16.7 cm. Adults may weigh 80 to 170 g and have a wingspan close to 60 cm. The forearm varies between 85 to 101.9 mm in males and 88.1 to 99 mm in females (Kwiecinski and Griffiths, 1999; Grzimek, 2003).

Range mass: 80 to 170 g.

Range length: 12.1 to 19.2 cm.

Average wingspan: 60 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in arid to moist tropical and subtropical biomes. Has broad habitat tolerance, so long as abundant food and appropriate roosting sites are available. Feeds on soft fruits (date, carob, mulberry, azedarach, fig, apricot, peach and apple), flowers, occasionally takes leaves. Often forages in orchards. Roosts: a strictly cavernicolous species, roosting in moist natural caverns and artificial structures including underground irrigation tunnels (ghanats), ruins, tombs, mines, military bunkers and open wells. Often roosts with other bat species. Possible altitudinal migration in parts of its range (e.g., Lebanon).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egyptian rousettes are found throughout Africa’s tropical rain forests, tropical deciduous forests, savanna, and Turkey’s Mediterranean scrub forests. Egyptian rousettes have been found in arid biomes; however, they prefer to remain in habitats that provide forest cover, roosting opportunities, and abundant fruit tree growth (Kwiecinski and Griffiths, 1999).

Range elevation: 0 to 4000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: caves

  • Kwiecinski, G., T. Griffiths. 1999. Rousettus egyptiacus. Mammalian Species, 611: 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Egyptian rousettes are frugivores, preferring to eat the pulp and juice of very ripe fruit. They typically take fruit from trees, such as lilac, mulberry, carob, sycamore, fig, and baobob (Kwiecinski and Griffiths, 1999; Korine et al., 1996; Grzimek, 2003). Egyptian rousettes consume 50 to 150% of total body mass in fruit each night. After selecting fruit, Egyptian rousettes take their fruit and roost close to the feeding tree. Only the pulp and juice is consumed; after thorough chewing, the seeds are spit out. Egyptian rousettes feed while holding the fruit close to the body, as a means of protecting the fruit from being pilfered by other bats. Stealing fruit is common, and these bats are aggressive when feeding (Kwiecinski and Griffiths, 1999).

Plant Foods: fruit

Primary Diet: herbivore (Frugivore )

  • Korine, C., Z. Arad, A. Arieli. 1996. Nitrogen and Energy Balance of the Fruit Bat Rousettus aegyptlacus on Natural Fruit Diets. Physiological Zoology, 69: 618-634.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Egyptian rousettes are pollinators of many nocturnally flowering trees throughout paleotropical forests. Due to their frugivorous diets, they not only pollinate the flowers of fruit trees but also assist as the primary agent in seed dispersal for many tree species (Fujita and Tuttle, 1991). Egyptian rousettes are carriers for both ectoparasites and endoparasites throughout their geographic range. Ectoparasites that use Egyptian rousettes as hosts include: Spinturnix lateralis, Ancystropus leleupi, Ancystropus zelebori, Ancystropus lateralis, Ancystropus zeleborii, Liponyssus glutinosus, Liponyssus longimanus, Eucampsipoda africanum, Nycteribosca africana, Brachytarsina alluaudi, Eucampsipoda hyrtlii, Nycteribosca diversa, Thaumapsylla brevicep, Nycteribia pedicularia, Nycteribia schmidlii, Eucampsipoda africana, Afrocimex leleupi, Thaumapsylla breviceps, Archaeopsylla metallescens, and Alectorobius camicasi (Kwiecinski and Griffiths, 1999). Endoparasites that are found in Rousettus aegyptiacus include the hemosporidian Plasmodium roussetti and the roundworm Nycteridocoptes rousetti. Outbreaks of rabies are also found in populations of Egyptian fruit bats (Kwiecinski and Griffiths, 1999).

Ecosystem Impact: disperses seeds; pollinates

Mutualist Species:

Commensal/Parasitic Species:

  • streblid flies (Nycteribosca species)
  • sarcoptid mites (Nycteridocoptes rousetti)
  • malarial plasmodium (Plasmodium roussetti)
  • parasitic mites (Spinturnix lateralis)
  • parasitic mites (Ancystropus species)
  • parasitic mites (Liponyssus species)
  • parasitic flies (Eucampsipoda species)
  • bat bugs (Afrocimex leleupi)
  • fleas (Thaumapsylla breviceps)
  • fleas (Archaeopsylla metallescens)
  • parasitic mites (Alectorobius camicasi)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Because of their frugivorous diet, Egyptian rousettes are sometimes considered a threat to fruit crops during the growing season. Plantation owners and farmers often hunt Egyptian rousettes or hire bounty hunters during the flowering and fruiting seasons to reduce the risk of crop damage and profit loss (Fujita and Tuttle, 1991). Egyptian rousettes, like many members of the Family Pteropodidae, are hunted for meat as well. As a result roost population densities have declined (Fujita and Tuttle, 1991). Natural predators have not been described but are likely to include aerial predators, such as falcons, and cave predators, such as snakes and mustelids. Their nocturnal habits, cave roosting, flight, and cryptic coloration all help them to avoid predation.

Known Predators:

Anti-predator Adaptations: cryptic

  • Fujita, M., M. Tuttle. 1991. Flying Foxes (Chiroptera: Pteropodidae): Threatened Animals of Key Ecological and Economic Importance. Conservation Biology, 5: 455-463.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Egyptian rousettes are one of 3 members of the Rousettus genus to use both visual orientation and echolocation. Echolocation in this species is produced through a series of crude, short clicks of the tongue against the side of the mouth (Roberts, 1975; Holland et al., 2004). These short, impulsive-paired clicks assist in navigation in the dark. The frequency range is usually 12 to 70 kHz, with click structure and duration most similar to dolphins. This form of echolocation has evolved independently from the echolocation system used by other echolocating bats, such as vespertilionids (Roberts, 1975; Holland et al., 2004; Holland and Waters, 2007).

Communication Channels: visual ; acoustic ; chemical

Perception Channels: visual ; echolocation

  • Holland, R., D. Waters. 2007. The Effect of Familiarity on Echolocation in the Megachiropteran Bat Rousettus aegyptiacus. Behavior, 144: 1053-1064.
  • Holland, R., D. Waters, J. Rayner. 2004. Echolocation Signal Structure in the Megachiropteran Bat Rousettus aegyptiacus Geoffrey 1810. The Journal of Experimental Biology, 207: 4361-4369.
  • Roberts, L. 1975. Confirmation of the Echolocation Pulse Production Mechanism of Rousettus. Journal of Mammalogy, 56: 218-220.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The recorded maximum lifespan of Rousettus aegyptiacus is 22 years in the wild, with a maximum of 25 years in captivity for both males and females. In wild populations, average lifespan is typically 8 to 10 years due to factors such as predation, vitamin D deficiency, calcium-phosphorus imbalance, and osteoproliferation. Longevity in captive bats is also dependent on environmental temperatures and neurological impairment (Kwiecinski and Griffiths, 1999).

Average lifespan

Status: wild:
9 years.

Range lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: captivity:
22 years.

Typical lifespan

Status: wild:
8 to 10 years.

Typical lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: captivity:
22 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Rousettus aegyptiacus is a polygamous species, with biannual breeding seasons. However, instances of monoestry have been recorded at higher latitudes (Baydemir and Albayrak, 2006; Bernard and Cumming, 1997). Egyptian rousettes observed in latitudes south of Egypt have two distinct peak breeding seasons separated by short periods. The first peak breeding season is from spring through summer, the second is fall through winter. Births occur towards the end of each breeding season (Okia, 1987).

Mating System: polygynandrous (promiscuous)

Females give birth to and raise a single pup with each breeding effort, though twins have been recorded occasionally (Korine et al., 1994). Estimated gestation length is 3.5 to 4 months, with synchronized births occurring in breeding colonies (Kwiecinski and Griffiths, 1999; Okia, 1987). Newborn bats are born with deciduous teeth and are altricial - completely naked apart from a thin layer of down along the head and back. Pups are weaned at 6 to 10 weeks with no difference in growth between sexes. Young reach full adult weight and size around 9 months old, about the same time young become independent from their mothers (Kwiecinski and Griffiths, 1999). Sexual maturity is reached on average at 15 months, however, females have been noted to be sexually mature at 5 to 7 months ("Egyptian Fruit Bat", 2006).

Breeding interval: Breeding occurs twice yearly throughout most of their range, although one breeding effort per season may occur in northern latitudes.

Breeding season: Breeding occurs typically from April to August and October to February

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 3.5 to 4 months.

Average gestation period: 4 months.

Range birth mass: 17.9 to 22.5 g.

Average birth mass: 18.7 g.

Range weaning age: 6 to 10 weeks.

Range time to independence: 8 to 9 months.

Average time to independence: 9 months.

Range age at sexual or reproductive maturity (female): 5 to 16 months.

Average age at sexual or reproductive maturity (female): 15 months.

Range age at sexual or reproductive maturity (male): 14 to 18 months.

Average age at sexual or reproductive maturity (male): 15 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

After birth Egyptian rousette pups are cared for solely by their mothers for around 9 months. They are capable of flying at 63 to 70 days after birth and stay with their mother until they have reached adult weight and size. Once mature, males leave maternity colonies to join bachelor groups, females join maternity colonies (Kwiecinski and Griffiths, 1999).

Parental Investment: altricial ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • 2006. "Egyptian Fruit Bat" (On-line). Rosamond Gifford Zoo. Accessed April 20, 2010 at http://www.rosamondgiffordzoo.org/assets/uploads/animals/pdf/EgyptianFruitBat.pdf.
  • Baydemir, N., I. Albayrak. 2006. A Study on the Breeding Biology of Some Bat Species in Turkey (Mammalia: Chiroptera). Turkish Journal of Zoology, 30: 103-110.
  • Bernard, R., G. Cumming. 1997. African Bats: Evolution of Reproductive Patterns and Delays. The Quarterly Review of Biology, 72: 253-274.
  • Korine, C., I. Izhaki, D. Makin. 1994. Population Structure and Emergence Order in the Fruit-bat (Rousettus aeyyptiacus: Mammalia, Chiroptera). The Zoological Society of London, 232: 163-174.
  • Kwiecinski, G., T. Griffiths. 1999. Rousettus egyptiacus. Mammalian Species, 611: 1-9.
  • Okia, N. 1987. Reproductive Cycles of East African Bats. Journal of Mammalogy, 68: 138-141.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Echolocation pinpoints target: Egyptian fruit bat
 

Echolocation of Egyptian fruit bats is used to pinpoint the position of prey after detection by directing calls at the sides of the desired target.

   
  "Is centering a stimulus in the field of view an optimal strategy to  localize and track it? We demonstrated, through experimental and  computational studies, that the answer is no. We trained echolocating  Egyptian fruit bats to localize a target in complete darkness,  and we measured the directional aim of their sonar clicks.  The bats did not center the sonar beam on the target, but  instead pointed it off axis, accurately directing the maximum slope  ('edge') of the beam onto the target. Information-theoretic calculations  showed that using the maximum slope is optimal for  localizing the target, at the cost of detection. We propose that  the tradeoff between detection (optimized at stimulus peak) and  localization (optimized at maximum slope) is fundamental to  spatial localization and tracking accomplished through hearing, olfaction,  and vision." (Yovel et al. 2010:701)

  Learn more about this functional adaptation.
  • Yovel Y; Falk B; Moss CF; Ulanovsky N. 2010. Optimal localization by pointing off axis. Science. 327(5966): 701 - 704.
  • 2010. 'Zen' bats hit their target by not aiming at it. Science Daily [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rousettus aegyptiacus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGTTGACTTTTCTCAACCAATCATAAAGATATCGGGACCCTGTACCTTCTATTTGGCGCCTGAGCAGGGATAGTAGGTACCGCCCTCAGCCTATTAATCCGAGCGGAACTAGGCCAACCAGGGACTTTACTGGGCGAC---GACCAGATCTATAATGTAATTGTTACGGCTCATGCATTTGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGCTTCGGAAATTGACTCATTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCTCGAATGAACAACATGAGCTTTTGACTTCTACCCCCATCTTTTCTTCTTCTATTAGCCTCCTCAACAGTAGAAGCTGGAGCCGGAACAGGATGAACGGTATATCCACCCCTAGCTGGTAATCTAGCCCATGCTGGAGCCTCTGTAGACCTAGCAATCTTCTCACTTCACTTGGCAGGGGTCTCATCTATCCTAGGAGCAATTAATTTTATTACCACAATTATTAATATAAAACCACCAGCCCTATCCCAATACCAAACCCCCCTATTTGTCTGATCCGTACTGATCACAGCCGTCCTTCTTCTCCTGTCCCTACCGGTACTCGCCGCCGGAATCACAATACTGCTAACAGACCGAAACCTCAACACCACCTTTTTCGACCCTGCAGGAGGAGGGGATCCTATTCTGTATCAACACCTCTTTTGATTCTTTGGGCACCCCGAAGTATATATTCTCATTCTACCAGGCTTCGGAATAATTTCACACATTGTTACTTATTATTCTGGAAAGAAAGAACCGTTCGGATACATGGGTATGGTATGAGCCATGATATCAATTGGATTCCTAGGTTTTATCGTGTGAGCCCACCACATATTCACAGTCGGCCTAGATGTCGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rousettus aegyptiacus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 135
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Benda, P., Aulagnier, S., Hutson, A.M., Amr, Z.S., Kock, D., Sharifi, M., Karataş, A., Mickleburgh, S., Bergmans, W. & Howell, K.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is broadly distributed and abundant, and is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category, hence is listed as Least Concern.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rousettus aegyptiacus is considered a species of least concern by the IUCN. However, due to poaching and a negative interactions with commercial farming, there has been a decline in roosting sites (Albayrak et al., 2008).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Common in parts of Africa; generally uncommon in SW Asia although locally abundant in Israel and Jordan (Z. Amr pers. comm. 2005).

In Africa it occurs in large colonies of up to 40,000 to 50,000 individuals. In SW Asia colonies generally number 50 to 500 individuals, although up to 3,000 individuals were recorded in a cave in Jordan. The population in Turkey is estimated at 5,000 to 10,000 individuals; the population there may be decreasing due to control measures in caves (A. Karatas pers. comm. 2007). In Syria only a single locality is known of 1,000 to 2,000 animals (A. Karatas pers. comm. 2007).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species faces a number of threats, but none of them are considered a serious threat to the species at the global level. Hunted for food in some cave systems in Africa. Cave disturbance and persecution are also a problem in parts of the range. The species is considered as a pest by fruit farmers and consequently cave roosts have been fumigated and destroyed in Israel, Turkey and Cyprus, resulting in incidental killing of many insectivorous bats of the genera Rhinolophus and Myotis. The Israeli Nature Conservation Society is trying to prevent this lethal control (D. Kock pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
International legal obligations for protection through the Bonn Convention (Eurobats) in areas where this applies. Included in Annex IV of the EU Habitats Directive in areas where this applies. Occurs in a number of protected areas. There is a need to enforce measures to protect this species, especially to prevent the fumigation of caves.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Rousettus aegyptiacus is perceived by many fruit farmers to be a pest of fruit crops grown commercially for human production throughout its range, though little evidence supports this and cases are often exaggerated (Albayrak et al., 2008).

  • Albayrak, I., N. Asan, T. Yorulmaz. 2008. The Natural History of the Egyptian Fruit Bat, Rousettus aegyptiacus, in Turkey (Mammalia: Chiroptera). Turkish Journal of Zoology, 32: 11-18.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Throughout their range, Egyptian rousettes pollinate many commercially valuable fruit trees. This species also works to disperse seeds away from the parent plant, allowing seed germination and spread in unpredictable conditions (Fujita and Tuttle, 1991; Izhaki et al., 1995).

Positive Impacts: food ; pollinates crops

  • Izhaki, I., C. Korine, Z. Arad. 1995. The Effect of Bat (Rousettus aegyptiacus) Dispersal on Seed Germination in Eastern Mediterranean Habitats. Oecologia, 101: 335-342.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Egyptian fruit bat

The Egyptian fruit bat or Egyptian rousette (Rousettus aegyptiacus) is a species of Old World fruit bat.

Distribution[edit]

Egyptian fruit bat found throughout Africa, except in the desert regions of the Sahara, and throughout the Middle East, as far east as Pakistan and northern India. Due to its extensive geographic range, and relatively large wild population, Rousettus aegyptiacus does not hold any specific conservation status.

Description[edit]

Egyptian fruit bat, Rousettus aegyptiacus

The Egyptian fruit bat is small compared to some of its megachiropterid relatives. Its wingspan averages 60 cm (2 ft), and body length around 15 cm (6 in). Its weight is typically around 160 g (5.6 oz). Males are larger than the females and can be easily distinguished by their large scrotal sack. This bat is typically light brown in color, with darker brown wings. It has large, pointed ears, dark eyes, and a long dog-like muzzle - which sometimes leads it to be referred to as a flying fox. Its fur is very soft, and the wings feel like pantyhose.

Behaviour[edit]

An Egyptian fruit bat in flight in Tel Aviv, Israel

Like many bats, Egyptian fruit bats are nocturnal. They spend their days roosting in trees or caves, often with large groups of other bats, sometimes numbering in the thousands. They emerge from the roost to forage for food in the late evening, and return just before dawn. They hang upside down, with their wings folded closely around their bodies. Egyptian fruit bats, along with other species in the genus Rousettus, are the only megachiropterid bats to use echolocation, which they accomplish by emitting a series of sharp clicks with their tongues. The clicks are normally slow and constant, and speed up dramatically when the bats approach an object. They also make use of a range of vocalizations for communication, including grunts and screeches. As a result, a large roosting colony can be a deafening cacophony.

Diet[edit]

An Egyptian fruit bat clings to pieces of orange at the Cotswold Wildlife Park, England

Egyptian fruit bats are frugivorous, consuming large amounts of fruit each night. Wild dates tend to be a favorite, but they will consume almost any soft, pulpy fruit. Most of their diets tends to consist of unripe and insect- and fungus-damaged fruit, which allows them to thrive in habitats where ripe fruit are not available year-round.

Reproduction[edit]

Baby Egyptian fruit bat

Maturity is reached at about nine months of age. Females typically give birth to only a single baby each year, but twins are occasionally born, after a gestation period of around 115–120 days. The young are carried by the female until they are able to hang from the roost on their own (after about six weeks), then they are left in the roost while the mother forages for food. Once the baby bat can fly, at about three months of age, it will leave the roost on its own to hunt for its own food. Offspring typically stay with the same colony as the parents for their entire lives.

In captivity[edit]

The Egyptian fruit bat is well represented in zoos around the world. They breed readily in captivity and easily adapt to a captive diet of more commonly available fruits and nectar.

Concerns[edit]

These bats, as well as many other fruit-eating bats, are ecologically important because they are pollinators or seed dispersers for many species of trees and plants. The baobab tree, for instance, relies almost exclusively on fruit bats to pollinate its flowers. Unfortunately, fruit bats also eat fruit crops intended for human consumption, so are consequently poisoned or otherwise eliminated by farmers to prevent loss of crops.

The Marburg virus is carried by Egyptian fruit bats in Africa. The Marburg virus is related to Ebola, thus the virus may be carried by an otherwise healthy fruit bat, which may not be readily showing symptoms that negatively affect the bat.

References[edit]

  1. ^ Mickleburgh et al. (2004). Rousettus aegyptiacus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 11 May 2006. Database entry includes a brief justification of why this species is of least concern
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!