Physical Description

Type Information

Neotype; Syntype for Corallium konojoi Kishinouye, 1903
Catalog Number: USNM 19929
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): Kishinouye
Locality: Shikoku Island, Near Murotsu, Kochi, Japan, North Pacific Ocean
  • Neotype: Nonaka, M., et al. 2012. Descriptions of two new species and designation of three neotypes of Japanese Coralliidae from recently discovered specimens that were collected by Kishinouye, and the introduction of a statistical approach to sclerite abundance and size. Zootaxa. 3428: 1-67.; Kishinouye, K. 1903. Zool. Anz. 26: 625.; Syntype: Nonaka, M., et al. 2012. Descriptions of two new species and designation of three neotypes of Japanese Coralliidae from recently discovered specimens that were collected by Kishinouye, and the introduction of a statistical approach to sclerite abundance and size. Zootaxa. 3428: 1-67.; Kishinouye, K. 1903. Zool. Anz. 26: 625.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corallium konojoi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGAATAAATATCTTACACGTTGGCTATTTTCTACTAACCATAAGGATATCGGCACTTTATATTTACTATTTGGAGCATTTTCCGGAATGGCGGGGACAGCTTCGAGTATGTTAATACGGCTAGAACTGTCAGCTCCAGGTAGTATGTTAGGAGATGATCATCTATATAATGTGATCGTAACAGCACATGCTTTATTAATGATTTTCTTCCTGGTAATGCCAGTAATGATTGGGGGATTCGGGAATTGGTTTGTGCCAATTATGATTGGTGCACCCGATATGGCCTTTCCCAGATTAAACAATATTAGTTTTTGGTTATTACCGCCTTCTCTTATACTACTGACTGGTTCTATGTTTGTGGAGCAAGGGGCAGGTACAGGTTGGACCGTTTATCCCCCATTAGCAAGTGTACAGGCCCACTCAGGGGGAGCCGTGGACATGGCCATATTCAGTTTACATCTAGCTGGGGTCTCTTCCATCCTAAGTTCTATTAACTTTATAACTACTATAATTAACATGAGAATTCCTGGTATGAGCATGCATAGATTACCTCTATTCGTATGGTCAGTATTGATTACTACAATACTATTATTGTTATCTCTACCAGTATTAGCGGGTGCAATTACAATGTTATTAACAGATAGAAATTTTAATACAACATTCTTTGATCCTGCGGGAGGGGGGGACCCAATCTTATTCCAGCACTTATTCTGGTTTTTTGGGCATCCTGAAGTCTATATATTAATTTTGCCAGGATTTGGTATGGTATCTCAAATTATCCCCACATTTTCTGCTAAACAGCATATTTTTGGTTATTTGGGTATGGTCTATGCTATGATTTCTATCGGAATATTAGGATTTATTGTTTGGGCTCATCATATGTTTACCGTTGGTATGGATGTCGATACTCGTGCCTACTTTACTGCAGCCACTATGATTATTGCTGTTCCCACCGGAATTAAGATATTTAGCTGGCTAGCTACTATATATGGGGGAAGCCCGCGGCTTGACACCCCTATGTTGTGGGCTATTGGGTTTGTATTCTTATTTACCATTGGTGGTTTAACCGGAGTTATATTAGCTAATAGTTCATTAGATATAATGTTACACGACACTTATTATGTAGTAGCTCACTTCCATTACGTGTTATCTATGGGGGCCATATTTGCCATATTTGGAGGATACTACTATTGGTTCGGTAAGATTACAGGTTTTAGCTATAATGAGTTATACGGTAAAATTCATTTTTGGATTATGTTTATCGGAGTTAATTTGACTTTCTTCCCCCAACATTTCTTGGGCTTAGCCGGATTACCTAGAAGATACTCCGATTTTGCTGATGCCTATCAGGGTTGGAACTTAGTAAGCTCTTGCGGAGCTATAATAGCCCTAATAGGAGTTATATGGTTTATATACCTATCTTATGAAGCATTAGCAGCCGAAAGACCATTTGAGGGCTGGTCAACTGCGCCTGGCTCGTTAGAGTGGTCTTTAAGTTCTCCGCCTGCTTTTCATACTTATAATGAATTACCGTTTGTCTATCAGAGTAAATTGAGTCATGGGGATGATTTACATATTATTTCCACACTACTCCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corallium konojoi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!