Overview

Brief Summary

“The precious red coral Corallium rubrum (L., 1758) lives in the Mediterranean Sea and adjacent Eastern Atlantic Ocean on subtidal hard substrates. Corallium rubrum is a long-lived gorgonian coral that has been commercially harvested since ancient times for its red axial calcitic skeleton and which, at present, is thought to be in decline because of overexploitation.” (Costantini et al., 2010)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Greek Exclusive Economic Zone, Mediterranean Sea, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near shore waters of the Canary and Cape Verde islands, Morocco, Algeria, Tunisia, along the north coast of the Mediterranean Sea from western Greece to Spain, including Corsica, Sardinia and Sicily, and north into the Atlantic along the coast of Portugal (Zibrowius et al., 1984; UN-FAO, 2011).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

  • Branching colonies with rigid skeleton of intermeshed calcium carbonate spicules, colored red (or sometimes pink) by carotenoid pigments -- branching may be relatively sparse or quite dense, resulting in a bushy shape
  • In living colony, skeleton overlaid by soft-tissue integument
  • Short and hemispheric calyces distributed on branches
  • In living colonies, extended radially symmetrical polyps are translucent-white, with eight tentacles and fine pinnules but without sclerites

(Food & Agriculture Organization of the United Nations, 2011)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Corallium rubrum lives on rocky substrates at depths from 20 to 200 m (or 15 to 300 m), generally in areas of relatively low light ((Zibrowius et al., 1984; Costantini et al., 2010; UN-FAO, 2011). Recently, however, live colonies have been found in the Strait of Sicily at depth of about 600 to 800 m (Costantini et al., 2010).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Corallium rubrum is a passive suspension feeder, with a diet based on small zooplankton (UN-FAO, 2011). Feeding rates increase with water temperature and prey concentration, with an apparent preference for autotrophic flagellates (Picciano & Ferrier-Pagès, 2007).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

“…populations of this slow-growing long-lived octocoral exhibit a high capacity for colonization and seem to be quite resilient to environmental variability.” (Bramanti et al., 2005)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Natural Enemies

Populations of Corallium rubrum are infested by a variety of endobiotic boring sponges (UN-FAO, 2011).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Long-lived and slow-growing – a few centimeters per year.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corallium rubrum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CGGCTAGAACTGTCAGCTCCGGGCAGTATGTTAGGAGAT---GATCATCTATATAATGTAATTGTAACAGCACATGCTTTATTAATGATTTTCTTCCTGGTAATGCCAGTAATGATTGGGGGATTCGGAAATTGGTTTGTGCCAATTATGATTGGTGCACCCGATATGGCCTTTCCCAGATTAAACAATATTAGTTTTTGGTTATTACCGCCTTCTCTAATACTATTGACTGGTTCTATGTTTGTGGAACAAGGGGCAGGTACAGGTTGGACCATTTATCCCCCATTAGCAAGTGTTCAGGCCCATTCGGGGGGAGCCGTGGACATGGCCATATTTAGTTTACACCTAGCTGGGTTATCTTCCATTTTAAGTTCTATTAACTTTATAACTACTATAATTAATATGAGAATTCCTGGTATGAGTATGCATAGATTACCTCTATTTGTATGGTCTGTATTAGTTACTACTATACTGTTATTATTATCTCTACCAGTATTAGCGGGTGCAATTACAATGTTATTAACAGATAGAAATTTTAATACAACATTCTTTGATCCTGCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Corallium rubrum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Likely over-harvested in its shallow-water habitats.

Listed by the European Commission on the Environment as “Annex V” = animal & plant species of community interest whose taking in the wild and exploitation may be subject to management measures.

(http://ec.europa.eu/environment/nature/legislation/habitatsdirective/index_en.htm).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats to populations of Corallium rubrum include water temperature anomalies, over-harvest, and destructive fishing practices. During the late summer of 1999, unusually high temperatures may have been the cause of both the mass mortality of the corals and the drastic reduction in settlement of new recruits (Bramanti et al., 2005). The popularity of Corallium rubrum in jewelry has resulted in the unsustainable harvest of easily accessible populations (Santiangelo & Abbiati, 2001; Oral, 2010). In addition, fishing practices like trawling damage or destroy the coral (Oral, 2010).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Legislation

The European Commission on the Environment has listed Corallium rubrum in Annex V of the Habitats Directive. Annex V = an “animal or plant species of community interest whose taking in the wild and exploitation may be subject to management measures” In 1994 the European Union banned the harvest of Corallium in the Mediterranean via dredging equipment.

(http://ec.europa.eu/environment/nature/legislation/habitatsdirective/index_en.htm).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

Red coral has been used for thousands of years in jewelry and other ornamentation. Examples have been found from ancient Egypt and in graves in Wiesbaden, Germany from 25,000 years ago. It’s still very popular (and therefore, economically valuable) as jewelry and is also used by some who believe it’s effective as a homeopathic remedy for a variety of ailments.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!