Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 40 - 100
  Temperature range (°C): 15.316 - 15.500
  Nitrate (umol/L): 0.535 - 1.175
  Salinity (PPS): 38.444 - 38.795
  Oxygen (ml/l): 5.352 - 5.528
  Phosphate (umol/l): 0.095 - 0.143
  Silicate (umol/l): 1.434 - 1.446

Graphical representation

Depth range (m): 40 - 100

Temperature range (°C): 15.316 - 15.500

Nitrate (umol/L): 0.535 - 1.175

Salinity (PPS): 38.444 - 38.795

Oxygen (ml/l): 5.352 - 5.528

Phosphate (umol/l): 0.095 - 0.143

Silicate (umol/l): 1.434 - 1.446
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eunicella cavolinii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGGCTAGAACTGTCAGCTCCAGGTAGTATGTTAGGAGAT---GATCATCTATATAATGTGATTGTAACAGCACATGCTTTATTAATGATTTTCTTCCTGGTAATGCCAGTAATGATTGGGGGATTCGGAAATTGGTTTGTGCCAATTATGATTGGTGCGCCTGATATGGCCTTTCCTAGATTAAACAATATCAGTTTCTGGTTATTACCACCTGCTCTAATACTATTGGCTGGTTCTATGTTTGTGGAGCAGGGGGTAGGTACAGGCTGGACCATTTATCCCCCCCTAGCAAGCATTCAAGCCCATTCAGGGGGAGCAGTGGATATGGCTATATTTAGTTTACATCTAGCTGGTGTATCTTCCATTTTAAGTTCTATCAACTTTATAACTACTATAATTAACATGAGGGTTCCTGGTATGAGTATGCATAGATTACCTCTATTTGTATGGGCTCAATTAATTACTACAATATTGTTATTATTATCTTTACCAGTGTTAGCTGGTGGAATTACAATGTTGTTAACAGATAGAAATTTTAATACAACATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eunicella cavolinii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eunicella cavolini

Eunicella cavolini, commonly known as the yellow gorgonian or yellow sea whip, is a species of colonial soft coral in the Gorgoniidae family. It is native to parts of the eastern Atlantic Ocean and most of the Mediterranean Sea, where it is a common species.

Description[edit]

Eunicella cavolini is a much-branched soft coral growing to a height of about 50 cm (20 in). It is fan-shaped with the irregular, cylindrical branches largely growing in a single plane. The stem has an enlarged base fixed to the substrate and the branches are smooth, short and about 3 mm (0.12 in) thick. The coenenchyme (the thin fleshy covering of the stiff skeleton) is yellowish-orange. The polyps are white to yellow, about 2 mm (0.08 in) long and arranged in four rows.[2] Eunicella cavolini can be confused with the warty gorgonian (Eunicella verrucosa), but that sea fan has rougher branches, or with Leptogorgia sarmentosa, but that species has straighter, more slender branches with smaller polyps.[2]

Distribution and habitat[edit]

Eunicella cavolini is common throughout the Mediterranean Sea. It grows mainly between 10 and 30 m (33 and 98 ft) but can be found as deep as 150 m (492 ft). It is normally found in a shallower zone than the violescent sea-whip (Paramuricea clavata). It is often found growing in association with other soft corals, sponges, polychaete worms, bryozoans, barnacles and winged oysters.[2]

Biology[edit]

The polyps expand their tentacles to catch zooplankton. The food fragments are passed to the mouth and then move into the gut to be digested. The nutrients are then transferred to all parts of the colony via channels in the living matrix of the branches. The fan is usually orientated perpendicular to the current so as to maximise the capture of prey.[2]

Colonies are either male or female and breeding takes place during the summer. Polyps in male colonies liberate sperm into the water and the eggs are fertilised inside the gastric chambers of female polyps in other colonies. The embryos develop into planula larvae which are released into the sea. After drifting as part of the plankton for one to four weeks, these settle on suitable surface and undergo metamorphosis into new polyps. These develop into new colonies by budding. The growth rate is slow, at about 1 to 2 cm (0.4 to 0.8 in) per year.[2]

References[edit]

  1. ^ van Ofwegen, Leen (2014). "Eunicella cavolini (Koch, 1887)". World Register of Marine Species. Retrieved 2014-12-17. 
  2. ^ a b c d e Dumas, Jacques; Maran, Vincent; Ader, Denis; Sittler, Alain-Pierre, (2014-01-16). "Eunicella cavolini (Koch, 1887)". DORIS (in French). Retrieved 2014-12-17. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!