Overview

Comprehensive Description

The mite Varroa destructor is an economically devastating ectoparasite of the Western Honeybee (Apis mellifera). It was originally known only from Apis cerana (which is found in southern and eastern Asia), but expanded its host range to include A. mellifera during the first half of the 20th century, spreading rapidly around the world, and is currently considered the single greatest threat to apiculture. Varroa mites have been considered a problem for beekeeping since around the late 1960s; by the 1970s, they had reached Western Europe and South America and by the 1980s they had reached the United States. On A. cerana, both V. jacobsoni and V. destructor apparently only parasitize drone (i.e., male) brood, whereas, for unknown reasons, the two mtDNA lineages of V. destructor that are capable of reproducing on A. mellifera utilize both drone and worker brood. (Rosenkranz et al. 2010 and references therein) Today, it can be safely assumed that all honey bee colonies within the mite’s range harbor varroa mites. As a consequence of mite infestation, dramatic colony losses have repeatedly occurred in affected countries (vanEngelsdorp and Meixner 2010 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Rosenkranz et al. (2010) review the morphology and reproductive systems of Varroa mites. These mites show a distinct sexual dimorphism in body form and males are smaller in all developmental stages and have proportionally longer legs than females.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Lookalikes

Varroa destructor resembles V. jacobsoni, with which it was confused until the end of the 20th century. Relative to V. jacobsoni, V. destructor is significantly larger and differs substantially with respect to mtDNA COI sequence, as well as at other genetic loci investigated. Varroa jacobsoni is rarely found on A. mellifera. Only a couple of lineages of V. destructor appear to have shifted hosts from A. cerana to A. mellifera. Varroa destructor now occurs nearly everywhere A. mellifera is found, but as of 2010 it had not yet been detected in Australia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Virus / infection vector
Deformed Wing virus is spread by Varroa destructor
Other: major host/prey

Virus / infection vector
Kakugo virus is spread by Varroa destructor

Animal / parasite / ectoparasite / blood sucker
Varroa destructor sucks the blood of pupa of Apis mellifera

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Varroa destructor lacks a free-living stage, being totally dependent on its honeybee host. There are two distinct phases in the life cycle of females: A phoretic phase on adult bees (during which the mite is transported by its host) and a reproductive phase within the sealed drone and worker brood cells. Males and nymphs are found only within the sealed brood cells in which bees are developing. The mites suck substantial amounts of hemolymph ("blood") from both adult bees and from the developing bees within the sealed brood cells. Shortly after leaving the brood cell on a young bee, the mites preferentially infest nurse bees for transport to the brood cells. Freshly hatched infested bees are less attractive than older ones and the middle-aged nurse bees are the most infested group of adult bees in breeding colonies. Drone brood are infested at a much higher rate than worker brood. Efforts to identify cues used by varroa females that cause them to switch from bees to brood, which might be used to develop an effective varroa trapping system, have so far been largely unsuccessful (Rosenkranz et al. 2010 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Once inside a 5th instar honeybee larva brood cell and several hours after it has been capped, the female Varroa mite begins to suck hemolymph ("blood") from the larva. Within a few hours, internal egg development is initiated and about 70 hours after the cell is capped, the mite lays her first egg. This first egg is normally unfertilized (females store sperm internally and are able to control whether or not an egg is fertilized). Like honeybees themselves, Varroa mites have a haplo-diploid sex determination system in which unfertilized (and hence haploid, i.e., with a single set of chromosomes) eggs develop into males and fertilized (and hence diploid, i.e., with two sets of chromosomes) eggs develop into females. The first egg is typically unfertilized and develops into a haploid male, while subsequent eggs are fertilized (and therefore female) and laid in 30 hour intervals. Up to five eggs in worker brood and up to six eggs in drone brood are considered typical. (Rosenkranz et al. 2010 and references therein)

Varroa mites become sexually mature immediately after the last molt. Males reach maturity before the females and wait for the first adult female, which molts to adulthood some 20 hours later. Before copulation starts, the male cleans his chelicerae (fang-like mouthparts characteristic of mites, spiders and relatives). He touches the female with his first pair of legs and climbs onto her back. He then slips around to her underside, a repositioning that is often facilitated by the female raising her body. In this "belly-to-belly" position, the male locates the female's gonopores (which are distinct from the genital opening through which the eggs are deposited). He then takes the spermatophore out of his genital opening and transfers it into the gonopore of the female using his chelicerae. Multiple mating is common until the next female is mature and available. (Rosenkranz et al. 2010 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Development

From hatching out of the egg until the adult molt, developmental time is about 5.8 and 6.6 days for female and male mites, respectively. The mother mite creates a hole in the cuticle of the pupa for the nymphs to feed through. This behavior is part of ‘‘parental care” and necessary because the soft chelicerae of the nymphal stages cannot perforate the pupal cuticle and the male’s chelicerae are modified for sperm transfer. (Rosenkranz et al. 2010 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

The genus Varroa includes at least four species of obligate ectoparasitic mites. Varroa jacobsoni was described from Java in 1904 as a parasite of Apis cerana and has a wide distribution on this bee throughout Asia and on A. nigrocincta in Indonesia. Varroa underwoodi was first described from A. cerana in Nepal in 1987. Varroa rindereri was described from Apis koschevnikovi in Borneo in 1996. Varroa destructor was described from both A. cerana (its original host) and A. mellifera (a new host) in 2000; prior to its recognition, V. destructor was mistakenly lumped together with V. jacobsoni and most literature referring to V. jacobsoni prior to 2000 probably refers to the species now known as V. destructor. (Anderson and Trueman 2000; Rosenkranz et al. 2010 and references therein) Oldroyd (1999) discusses aspects of the evolution of the varroa mite-honeybee association and notes that A. mellifera is the only Apis species believed to have escaped natural parasitism.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Phylogeography

Only two of several known mitochondrial haplotypes of Varroa destructor have been found to be capable of reproducing on Apis mellifera (the others being limited to V. destructor's original host, A. cerana). Solignac et al. (2005) analyzed microsatellite markers and mtDNA of V. destructor from 45 populations in 17 countries. They found that the two V. destructor halotypes on A. mellifera also have characteristic and diagnistic alleles at numerous microsatellite loci. They also found genetic evidence suggesting that there has been at least one host transfer from A. mellifera back to A. cerana.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Varroa destructor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACGTTGATTATTTTCTTGTAATCATAAGGATATTGGAACTATTTATTTTATTTTTAGTTTATGATCAGGAGTTTTAGGAATAATATTAAGTCTATTAATTCGTGTAGAGTTAGGTCAACCTGGTTCTTTTATTGGAGAT---GATCAGATTTATAATACTATTGTTACTTCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTGCTATAATTGGAGGTTTTGGTAATTGGTTAGTTCCTTTAATAATTTCTGCACCAGATATAGCTTTTCCACGTTTAAATAATATAAGTTTTTGATTATTAGTACCTTCTCTTAGTTTATTAATTTTTTCTTCTTTTATTGAAAGTGGAGTAGGTACAGGTTGAACGGTTTATCCTCCTTTATCAGGAAATTTATTTCATAGAGGTGTAGCAGTTGATTTAGGAATTTTAAGTTTGCATTTAGCTGGAATCTCCTCTATTATAAGATCTATTAATTTTATTGCTACTATTTTAAATATACGTGTAAAGGGGATAAATCTTGAAATAATGCCTTTATTTGTATGGTCTGTTTTTATTACTACTATTTTATTATTATTATCTTTGCCTGTTTTAGCTGGAGCTATTACAATATTGTTAACAGATCGAAATTTTAATACTACATTTTTTGATCCTAGAGGTGGTGGTGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTTTGCCTGGTTTTGGTATTATTTCTCATGTAATTTGTATACAAAGAGGGAAGAAGCAGCCTTTTGGAAATTTAGGGATAATTTACGCTATAATAACTATCGGTATTTTAGGTTTTATTGTATGGGCTCATCATATATTTACAGTAGGAATAGATATTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Varroa destructor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 35
Specimens with Barcodes: 35
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Risk Statement

Varroa destructor has a variety of negative impacts on honeybees (and, therefore, on human apiculture). The loss of hemolymph during development within the brood cell significantly decreases the weight of the hatching bee, which has a variety of downstream effects such as shortened lifespan of workers. This mite is also a vector for a variety of honeybee viruses, such as Deformed Wing Virus (DWV) and Israeli acute paralysis virus (IAPV) (vanEngelsdorp and Meixner 2010 and references therein). There is strong suspicion that V. destructor plays a significant role in Colony Collapse Disorder (Schäfer et al. 2010), having a synergistic effect in combination with other causes such as other pathogens, environmental factors, and stressful colony management practices. Some feral, unmanaged A. mellifera populations appear to have evolved a degree of resistance to varroa mites, after initial sharp declines, through natural selection and there is some hope that studying these examples could provide valuable insights that could be applied to managed colonies. (Rosenkranz et al. 2010 and references therein) On the other hand, a number of authors have noted that the level of mite infestation that causes significant colony damage appears to have decreased over time in at least some areas (vanEngelsdorp and Meixner 2010 and references therein). Clearly, the host-parasite relationship is complex and may vary through space and time as it evolves.

Cook et al. (2007) estimated that preventing Varroa destructor from establishing in Australia over the next 30 years would avoid costs of between 16 million and 40 million dollars (U.S.) per year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Varroa destructor

Varroa destructor is an external parasitic mite that attacks the honey bees Apis cerana and Apis mellifera. The disease caused by the mites is called varroosis.

Varroa destructor can only reproduce in a honey bee colony. It attaches to the body of the bee and weakens the bee by sucking hemolymph. In this process, RNA viruses such as the deformed wing virus (DWV) spread to bees. A significant mite infestation will lead to the death of a honey bee colony, usually in the late autumn through early spring. The Varroa mite is the parasite with the most pronounced economic impact on the beekeeping industry. It may be a contributing factor to colony collapse disorder, as research shows it is the main factor for collapsed colonies in Ontario, Canada[1] and Hawaii, USA.[2]

Physical description[edit]

The adult mite is reddish-brown in color; has a flat, button shape; is 1–1.8 mm long and 1.5–2 mm wide; and has eight legs.

Reproduction, infection and hive mortality[edit]

Mites reproduce on a 10-day cycle. The female mite enters a honey bee brood cell. As soon as the cell is capped, the Varroa mite lays eggs on the larva. The young mites, typically several females and one male, hatch in about the same time as the young bee develops and leave the cell with the host. When the young bee emerges from the cell after pupation, the Varroa mites also leave and spread to other bees and larvae. The mite preferentially infests drone cells.

The adults suck the "blood" (hemolymph) of adult honey bees for sustenance, leaving open wounds. The compromised adult bees are more prone to infections. With the exception of some resistance in the Russian strains and bees with varroa-sensitive hygiene genes developed by the USDA, the European Apis mellifera bees are almost completely defenseless against these parasites (Russian honey bees are one-third to one-half less susceptible to mite reproduction).[3]

The model for the population dynamics is exponential growth when bee brood are available and exponential decline when no brood is available. In 12 weeks, the number of mites in a western honey bee hive can multiply by (roughly) 12. High mite populations in the autumn can cause a crisis when drone rearing ceases and the mites switch to worker larvae, causing a quick population crash and often hive death.

Low temperature scanning electron micrograph of V. destructor on a honey bee host

Varroa mites have been found on flower-feeding insects such as the bumblebee Bombus pennsylvanicus, the scarab beetle Phanaeus vindex and the flower-fly Palpada vinetorum.[4] Although the Varroa mite cannot reproduce on these insects, its presence on them may be a means by which it spreads short distances (phoresy).

Varroa mites on pupa
Varroa mites on pupae
Varroa destructor on bee larva

Introduction around the world[edit]

As of mid-2012, Australia was thought to be free of the mite.[9][10] In early 2010, an isolated subspecies of bee was discovered in Kufra (southeastern Libya) that appears to be free of the mite.[11]

Identification[edit]

Until recently, V. destructor was thought to be a closely related mite species called Varroa jacobsoni. Both species parasitize the Asian honey bee, Apis cerana. However, the species originally described as V. jacobsoni by Anthonie Cornelis Oudemans in 1904 is not the same species that also attacks Apis mellifera. The jump to A. mellifera probably first took place in the Philippines in the early 1960s where imported A. mellifera came into close contact with infected A. cerana. Until 2000, scientists had not identified V. destructor as a separate species. This late identification in 2000 by Anderson and Trueman corrected some previous confusion and mislabeling in the scientific literature.[12]

Varroosis[edit]

The infection and subsequent parasitic disease caused by varroa mites is called varroosis. Sometimes, the incorrect names varroatosis or varroasis are used. A parasitic disease name must be formed from the taxonomic name of the parasite and the suffix -osis[13] as provided in the Standardised Nomenclature by the World Association for the Advancement of Veterinary Parasitology.[14] For example, the World Organisation for Animal Health (OIE) use the name varroosis in the OIE Terrestrial Manual.[15]

Treatments have been met with limited success. First, the bees were medicated with fluvalinate, which had about 95% mite falls. However, the last five percent became resistant to it, and later, almost immune. Fluvalinate was followed by coumaphos.

Control or preventive measures and treatment[edit]

Chemical measures[edit]

Varroa mites can be treated with commercially available miticides. Miticides must be applied carefully to minimize the contamination of honey that might be consumed by humans. Proper use of miticides also slows the development of resistance by the mites.

Synthetic chemicals

Naturally occurring chemicals

  • Formic acid as vapor or pads (Mite-Away)
  • Powdered sugar (Dowda method), talc, or other "safe" powders with a grain size between 5 and 15 µm (0.20 and 0.59 mil) can be sprinkled on the bees.
  • Essential oils, especially lemon, mint and thyme oil[17]
  • Sugar esters (Sucrocide) in spray application
  • Oxalic acid trickling method or applied as vapor
  • Mineral oil (food grade) as vapor and in direct application on paper or cords
  • Natural hops compounds in strip application (Hopguard)

Physical, mechanical, behavioral methods[edit]

Varroa mites can also be controlled through nonchemical means. Most of these controls are intended to reduce the mite population to a manageable level, not to eliminate the mites completely.

  • Heating method, first used by beekeepers in Eastern Europe in the 1970s and later became a global method. In this method, hive frames are heated to a certain temperature for a period of time, which kills the varroa larvae, but doesn't harm the bees and broods. In Germany, anti-varroa heaters are manufactured for use by professional bee keepers.
  • Perforated bottom board method is used by many beekeepers on their hives. When mites occasionally fall off a bee, they must climb back up to parasitize another bee. If the beehive has a screened floor with mesh the right size, the mite will fall through and cannot return to the beehive. The screened bottom board is also being credited with increased circulation of air, which reduces condensation in a hive during the winter. Studies at Cornell University done over two years found that screened bottoms have no measurable effect at all.[18] Screened bottom boards with sticky boards separate mites that fall through the screen and the sticky board prevents them from crawling back up.
  • Limited drone brood cell method, is based on limiting the brood space cell for Varroa mites to inhabit (4.9 mm across — about 0.5 mm smaller than standard), and also to enhance the difference in size between worker and drone brood, with the intention of making the drone comb traps more effective in trapping Varroa mites. Small cell foundations have staunch advocates, though controlled studies have been generally inconclusive.
  • Comb trapping method (also known as swarming method), is based on interrupting the honey bee brood cycle. It is an advanced method that removes capped brood from the hive, where the Varroa mites breed. The queen is confined to a comb using a comb cage. At 9-day intervals, the queen is confined to a new comb, and the brood in the old comb is left to be reared. The brood in the previous comb, now capped and infested with Varroa mites, is removed. The cycle is repeated. This complex method can remove up to 80% of Varroa mites in the hive.
  • Freezing drone brood method takes advantage of Varroa mites' preference for longer living drone brood. The beekeeper will put a frame in the hive that is sized to encourage the queen to lay primarily drone brood. Once the brood is capped, the beekeeper removes the frame and puts it in the freezer. This kills the Varroa mites feeding on those bees. It also kills the drone brood, but most hives produce an excess of drone bees, so it is not generally considered a loss. After freezing, the frame can be returned to the hive. The nurse bees will clean out the dead brood (and dead mites) and the cycle continues.
  • Drone brood excision method is a variation applicable to top bar hives. Honey bees tend to place comb suitable for drone brood along the bottom and outer margins of the comb. Cutting this off at a late stage of development ("purple eye stage") and discarding it reduces the mite load on the colony. It also allows for inspection and counting of mites on the brood.

Genetic engineering[edit]

Researchers have been able to use RNA interference to knock out genes in the Varroa mite. The aim is to change the bees genetic traits so that the bees can smell infected brood and remove them before the infestation spreads further.[19][20]

See also[edit]

References[edit]

  1. ^ Ernesto Guzmán-Novoa, Leslie Eccles, Yireli Calvete, Janine Mcgowan, Paul G. Kelly & Adriana Correa-Benítez (2009). "Varroa destructor is the main culprit for the death and reduced populations of overwintered honey bee (Apis mellifera) colonies in Ontario, Canada" (PDF). Apidologie 41 (4): 443–450. doi:10.1051/apido/2009076. 
  2. ^ Welsh, Jennifer (7 June 2012) Mites and Virus Team Up to Wipe Out Beehives Live Science, Retrieved 11 June 2012
  3. ^ J. Raloff (August 8, 1998). Russian queens bee-little mites' impact 154 (6). Science News. p. 84. 
  4. ^ Peter G. Kevan, Terence M. Laverty & Harold A. Denmark (1990). "Association of Varroa jacobsoni with organisms other than honeybees and implications for its dispersal". Bee World 71 (3): 119–121. 
  5. ^ Helen M. Thompson, Michael A. Brown, Richard F. Ball & Medwin H. Bew (2002). "First report of Varroa destructor resistance to pyrethroids in the UK" (PDF). Apidologie 33 (4): 357–366. doi:10.1051/apido:2002027. 
  6. ^ "Varroa Mite, Varroa destructor". MAF Biosecurity New Zealand. June 30, 2009. Retrieved February 24, 2011. 
  7. ^ Nina Wu (April 25, 2007). "Bee mites have spread on Oahu". Honolulu Star-Bulletin. Retrieved February 24, 2011. 
  8. ^ "Varroa Mite Information". State of Hawaii. 2013. Retrieved December 9, 2013. 
  9. ^ Holland, Malcolm (June 26, 2012). "Varroa mites could devastate our honeybee industry". The Sydney Morning Herald. Retrieved June 26, 2012. 
  10. ^ Jopson, Debra (August 18, 2010). "It's a bee nuisance – and food growers are more than a mite scared". The Sydney Morning Herald. Retrieved June 20, 2012. 
  11. ^ "Honigbienenart in der Sahara entdeckt" [Honey bee species discovered in the Sahara] (in German). Die Zeit. July 2010. Retrieved February 24, 2011. 
  12. ^ D. L. Anderson & J. W. H. Trueman (2000). "Varroa jacobsoni (Acari: Varroidae) is more than one species". Experimental and Applied Acarology 24 (3): 165–189. doi:10.1023/A:1006456720416. PMID 11108385. 
  13. ^ Kassai T., 2006, Nomenclature for parasitic diseases: cohabitation with inconsistency for how long and why?, Veterinary Parasitology, 138, 169–178, http://www.waavp.org/files/Nomenclature%20for%20parasitic%20diseases.pdf
  14. ^ http://www.waavp.org/node/43
  15. ^ http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.02.07_VARROOSIS.pdf
  16. ^ Mark Ward (March 8, 2006). "Almond farmers seek healthy bees". BBC News. Retrieved May 2, 2009. 
  17. ^ Natalia Damiani, Liesel B. Gende, Pedro Bailac, Jorge A. Marcangeli & Martín J. Eguaras (2009). "Acaricidal and insecticidal activity of essential oils on Varroa destructor (Acari: Varroidae) and Apis mellifera (Hymenoptera: Apidae)". Parasitology Research 106 (1): 145–152. doi:10.1007/s00436-009-1639-y. PMID 19795133. 
  18. ^ Northeast Beekeeper Vol 1 #1 Jan 2004)
  19. ^ "A Sustainable Approach to Controlling Honey Bee Diseases and Varroa Mites". SARE. Retrieved 2008-11-18. 
  20. ^ Victoria Gill (December 22, 2010). "Genetic weapon developed against honeybee-killer". BBC News. Retrieved February 24, 2011. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!