Overview

Brief Summary

Biology

This giant amphibian is generally active at night, when it relies on smell and touch to locate its prey. It feeds on a variety of prey, including fish, smaller salamanders, worms, insects, crayfish and snails: catching them with a rapid sideways snap of the mouth (4) (5). It has an extremely slow metabolism and can go for weeks without eating if necessary (3). During the day it retires beneath rocks (4). Like other amphibians, this salamander has smooth skin rather than scales. The skin acts as a respiratory surface, where oxygen enters the body and carbon dioxide is released (4). This species' large size and lack of gills are thought to confine them to cold, fast flowing water where oxygen is in good supply (4). Reproduction takes place in late August, when hundreds of individuals congregate at nest sites. Males compete viciously, with many dying from injuries. Females lay between 400 and 500 eggs in the nest, held together like a thread of beads (3). Several males fertilise the eggs, and protect them from predators like fish, until they hatch 12-15 weeks later in the early spring (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Japanese giant salamander is the second largest salamander in the world, growing in length to a massive 1.5 metres (2). The largest is the Chinese giant salamander, which grows to 1.8 metres while most other salamanders are only 5–15 centimetres in length. The Japanese species is huge and fairly ugly in appearance, though totally harmless. Its skin is a mottled grey, black and cream, and heavily wrinkled (5). This species has an elongated body, a long broad tail and two pairs of legs that are roughly similar in size. The eyes are tiny and positioned on top of the broad, flat head, providing the salamander with poor vision. It is however well adapted to its aquatic life (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Andrias japonicus is a heavily built salamander, and with its Chinese sister species, Andrias davidianus, is one of the two largest extant salamander species. Head broad and flat. Body strongly depressed; terminal two-thirds of tail strongly compressed; nostrils small, near tip of the snout, their distance from each other less than one-half the distance between the eyes, which are without eyelids and very small. Vomerine teeth in an arched series starting between the choanae, parallel to the maxillary and premaxillary series. Thin lower labial fold starting midway between nostril and eye to angle of mouth. Legs short and flattened. Tail short, slightly more than one-third the length of head and body, with a high dorsal fin beginning at insertion of hind legs, and a lower ventral fin. Skin rather smooth and slippery, with wrinkles, folds and tubercles.No external sexual dimorphism. During the breeding season, cloacal lips are swollen in the male and flat in the female.Color usually reddish-brown to brownish-yellow, paler below; irregularly blotched and marbled with dusky spots. Considerable individual variation ranging from being completely black to almost yellow.Total length of an adult Japanese Giant Salamander ranges from 30 to 150 cm - with a snout vent length of 20 to 90 cm - a result of continuous growth after sexual maturity (Kawamichi and Ueda 1998). Many specimens found in the wild are 60-70 cm (Environment Agency of Japan 2000). Weight of sexually mature animals ranging between 1.5 and 35 kg. The heaviest specimen found in the wild, on record, was 26.3 kg and measured 136 cm (Tochimoto, pers. com).Genetic variation is low (Matsui and Hayashi 1992, Matsui et al. 2008).The Japanese Giant Salamander is closely related and very similar to the Chinese Giant Salamander (A. davidianus) and differs from the latter by the arrangement of tubercles on the head and throat. These tubercles are larger and more numerous than in A. davidianus; they are mostly single and irregularly scattered. The snout is more rounded and the tail a little shorter in the Japanese species.

Video: A new program in Japan is helping giant salamanders get past dams built to control flooding so the rare amphibians can lay their eggs upstream. December 31, 2009.


Video by Public Television's Wild Chronicles, from National Geographic Mission Programs.
Runtime: 3:38. Language: English.

There is a vast literature on this species, much of it in Japanese. See Stejneger (1907), Sato (1943), Thorn (1969), and for recent ecological studies by T. Tochimoto and J. Kobara in Japanese, see references in Kawamichi and Ueda (1998).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Goka, K., Yokoyama, J., Une, Y., Kuroki, T., Suzuki, K., Nakahara, M., Kobayashi, A., Inaba, S., Mizutani, T., and Hyatt, A. D. (2009). ''Amphibian chytridiomycosis in Japan: distribution, haplotypes, and possible route of entry into Japan.'' Molecular Ecology, 18, 4757 - 4774.
  • Goris, R.C. and Maeda, N. (2004). Guide to the Amphibians and Reptiles of Japan. Krieger Publishing Company, Malabar, Florida.
  • IUCN. (2010). IUCN Red List of Threatened Species. Version 2010.2. http://www.iucnredlist.org. Accessed on 16 September 2010.
  • Japan Agency of Environment (2000). Threatened Wildlife of Japan - Red Data Book. 2nd ed. Reptilia/Amphibia. (in Japanese with English summary). Japan Wildlife Research Center, Tokyo, Japan.
  • Kato, T. and Ota, H. (1993). Endangered Wildlife of Japan. Hoikusha, Osaka, Japan.
  • Kerbert, C. (1905). ''Über die Eier und Larven von Megalobatrachus maximus Schl.'' C. R. 6e Congr. Intern. Zool., Berne, 1904, 289-294.
  • Kobara, J. (1985). The Giant Salamander (in Japanese). Doubutsu-sha, Tokyo, Japan.
  • Kuwabara, K. and Nakagoshi, N. (2009). ''Analysis on Reproductive Behavior of Japanese Giant Salamander, Andrias japonicus - Observations on the Breeding Behavior and Notes on the Video Imagery.'' Natural History of Nishi-Chugoku Mountains, 14, 11-50 + DVD.
  • Kuwabara, K., Suzuki, N., Wakabayashi, F., Ashikaga, H., Inoue, T. and Kobara, J. (1989). ''Breeding the Japanese Giant Salamander at Asa Zoological Park.'' International Zoo Yearbook, London, 28, 22-31.
  • Matsui, M., Tominaga, A., Liu, W.-Z., and Tanaka-Ueno, T. (2008). ''Reduced genetic variation in the Japanese giant salamander, Andrias japonicus (Amphibia: Caudata) .'' Molecular Phylogeny and Evolution, 49, 318-326.
  • Matsui, M., and Hayashi, T. (1992). ''Genetic uniformity in the Japanese Giant Salamander, Andrias japonicus.'' Copeia, 1992, 232-235.
  • Ministry of the Environment, Japan, (2008). ''Review of the Status of Japanese Giant Salamander (Andrias japonicus).'' Annex 2 to Periodic Review of Species Included in the CITES Appendices, Geneva 2009, 5-14.
  • Ohno, M. (1981). "Megalobatrachus japonicus." Final Report of the Reptiles and Amphibians Survey of the Second National Survey on the Natural Environment of Japan. 1978, pt. 2. Nature Conservancy Society of Japan, Tokyo., 55-70.
  • Okada, S., Utsunomiya, T., Okada, T., Felix, Z.I., and Ito, F. (2008). ''Characteristics of Japanese Giant Salamander (Andrias japonicus) populations in two small tributary streams in Hiroshima Prefecture, Western Honshu, Japan.'' Herpetological Conservation and Biology, 3, 192-202.
  • Ota, H. (2000). ''Current status of the threatened amphibians and reptiles of Japan.'' Population Ecology, 42, 5-9.
  • Sato, I. (1943). A Monograph of the Tailed Batrachians of Japan (In Japanese). Nippon Shuppan-Sha, Osaka, Japan.
  • Stejneger, L. (1907). Herpetology of Japan and Adjacent Territory. Government Printing Office, Washington. Reprinted 1996, with an introduction by M. Matsui. Society for the Study of Amphibians and Reptiles in cooperation with the Herpetological Society of Japan
  • Tago, K. (1927). ''Notes on the habits and life history of Megalobatrachus japonicus.'' Xe Congrès International de Zoologie, tenu à Budapest 1927. Budapest, Hungary, 828-838.
  • Tochimoto, T. (1995). ''Ecological studies on the Japanese Giant Salamander, Andrias japonicus, in the Ichi River in Hyogo Prefecture. 10. An attempt to rebuild spawning places along the river.'' Journal of Japanese Association of Zoological Gardens and Aquariums, 37, 7-12.
  • Tochimoto, T. (1996). ''Amphibians, Reptiles, and Cartilaginous Fish, 5.'' The Encyclopedia of Japanese Animals. Hidaka, T., eds., Heibonsha, Tokyo, Japan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution and Habitat

The Japanese Giant Salamander is endemic to Japan, where it is found in the Chubu, Kinki and Chugoku regions of central and western Honshu, in Shikoku and in northeastern Kyushu (Tochimoto 1996).The salamander occurs in habitats ranging from relatively large rivers (20-50 m wide) to small tributary streams (1-4 m wide), with clear cool water flowing through granite and schist regions. These streams have usually rocky or gravel bottoms, and at places shallow, quietly running water. The animals keep themselves concealed in rocky caverns or in burrows on the water’s edge (Tago 1927). Vertical distribution 300 to 1000 m. Spawning nests and larvae often occur in relatively small lotic habitats, including the upper reaches of tributary streams (Okada et al. 2008).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Goka, K., Yokoyama, J., Une, Y., Kuroki, T., Suzuki, K., Nakahara, M., Kobayashi, A., Inaba, S., Mizutani, T., and Hyatt, A. D. (2009). ''Amphibian chytridiomycosis in Japan: distribution, haplotypes, and possible route of entry into Japan.'' Molecular Ecology, 18, 4757 - 4774.
  • Goris, R.C. and Maeda, N. (2004). Guide to the Amphibians and Reptiles of Japan. Krieger Publishing Company, Malabar, Florida.
  • IUCN. (2010). IUCN Red List of Threatened Species. Version 2010.2. http://www.iucnredlist.org. Accessed on 16 September 2010.
  • Japan Agency of Environment (2000). Threatened Wildlife of Japan - Red Data Book. 2nd ed. Reptilia/Amphibia. (in Japanese with English summary). Japan Wildlife Research Center, Tokyo, Japan.
  • Kato, T. and Ota, H. (1993). Endangered Wildlife of Japan. Hoikusha, Osaka, Japan.
  • Kerbert, C. (1905). ''Über die Eier und Larven von Megalobatrachus maximus Schl.'' C. R. 6e Congr. Intern. Zool., Berne, 1904, 289-294.
  • Kobara, J. (1985). The Giant Salamander (in Japanese). Doubutsu-sha, Tokyo, Japan.
  • Kuwabara, K. and Nakagoshi, N. (2009). ''Analysis on Reproductive Behavior of Japanese Giant Salamander, Andrias japonicus - Observations on the Breeding Behavior and Notes on the Video Imagery.'' Natural History of Nishi-Chugoku Mountains, 14, 11-50 + DVD.
  • Kuwabara, K., Suzuki, N., Wakabayashi, F., Ashikaga, H., Inoue, T. and Kobara, J. (1989). ''Breeding the Japanese Giant Salamander at Asa Zoological Park.'' International Zoo Yearbook, London, 28, 22-31.
  • Matsui, M., Tominaga, A., Liu, W.-Z., and Tanaka-Ueno, T. (2008). ''Reduced genetic variation in the Japanese giant salamander, Andrias japonicus (Amphibia: Caudata) .'' Molecular Phylogeny and Evolution, 49, 318-326.
  • Matsui, M., and Hayashi, T. (1992). ''Genetic uniformity in the Japanese Giant Salamander, Andrias japonicus.'' Copeia, 1992, 232-235.
  • Ministry of the Environment, Japan, (2008). ''Review of the Status of Japanese Giant Salamander (Andrias japonicus).'' Annex 2 to Periodic Review of Species Included in the CITES Appendices, Geneva 2009, 5-14.
  • Ohno, M. (1981). "Megalobatrachus japonicus." Final Report of the Reptiles and Amphibians Survey of the Second National Survey on the Natural Environment of Japan. 1978, pt. 2. Nature Conservancy Society of Japan, Tokyo., 55-70.
  • Okada, S., Utsunomiya, T., Okada, T., Felix, Z.I., and Ito, F. (2008). ''Characteristics of Japanese Giant Salamander (Andrias japonicus) populations in two small tributary streams in Hiroshima Prefecture, Western Honshu, Japan.'' Herpetological Conservation and Biology, 3, 192-202.
  • Ota, H. (2000). ''Current status of the threatened amphibians and reptiles of Japan.'' Population Ecology, 42, 5-9.
  • Sato, I. (1943). A Monograph of the Tailed Batrachians of Japan (In Japanese). Nippon Shuppan-Sha, Osaka, Japan.
  • Stejneger, L. (1907). Herpetology of Japan and Adjacent Territory. Government Printing Office, Washington. Reprinted 1996, with an introduction by M. Matsui. Society for the Study of Amphibians and Reptiles in cooperation with the Herpetological Society of Japan
  • Tago, K. (1927). ''Notes on the habits and life history of Megalobatrachus japonicus.'' Xe Congrès International de Zoologie, tenu à Budapest 1927. Budapest, Hungary, 828-838.
  • Tochimoto, T. (1995). ''Ecological studies on the Japanese Giant Salamander, Andrias japonicus, in the Ichi River in Hyogo Prefecture. 10. An attempt to rebuild spawning places along the river.'' Journal of Japanese Association of Zoological Gardens and Aquariums, 37, 7-12.
  • Tochimoto, T. (1996). ''Amphibians, Reptiles, and Cartilaginous Fish, 5.'' The Encyclopedia of Japanese Animals. Hidaka, T., eds., Heibonsha, Tokyo, Japan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to Japan and is distributed in western Honshu, Shikoku and Kyusyu.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Andrias japonicus is native to the northern region of Kyushu Island and western Honshu island of Japan.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Japan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in the rivers of northern Kyushu Island and western Honshu in Japan (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Giant Japanese salamanders (Andrias japonicus) grow to approximately 1.5 meters in length and can weigh up to 25 kg. The long body of A. japonicus is covered with a wrinkled grey, black, and green epidermis that provides camoflauge. The tail is long and wide, and there are two pairs of legs, which are close in size. Andrias japonicus is endowed with minimal vision. Small, lidless eyes sit on the top of the wide, flat head. Gas exchange occurs through the epidermis. The wrinkles of the warty epidermis provide increased surface area, facilitating the exchange of carbon dioxide and oxygen with the water. Capillaries run close to the surfaces of the skin, allowing for the easy diffusion of gases.

The slow metabolism of Japanese salamanders allows these amphibians to live without consuming food for weeks at a time. Giant Japanese salamanders differ from other closely related species in that these particular salamanders lack gill openings and also have unique modifications with their branchial structures.

Range mass: 25 (high) kg.

Range length: 1.5 (high) m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Parker, G. 2001. Giant salamanders lurk in Japan. The Newsletter of the Colorado Herpetological Society, 28.
  • Pough, H., R. Andrews, J. Cadle, M. Crump, K. Wells. 2001. Herpetology. New Jersey: Prentice Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives and breeds in small to large rivers, preferring clear water, usually in forested areas. It has occasionally been found in rivers in urban areas. The adults can tolerate a wide variety of habitats, but are not necessarily able to breed in these habitats. Females lay their eggs in a string underwater and the larvae then develop in the streams. It is estimated to take at least five years for the young to reach maturity.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Andrias japonicus is found at elevations between 180 and 1,350 meters. These salamanders reside in and around the cold, swift, mountain streams of the Japanese islands. These waters provide enough oxygen to diffuse through the epidermis of A. japonicus, facilitating an aquatic lifestyle. As with other cryptobranchid salamanders, A. japonicus tends not to leave the water and is thus particularly sensitive to receding mountain streams.

Range elevation: 180 to 1,350 m.

Habitat Regions: temperate ; freshwater

Terrestrial Biomes: mountains

Aquatic Biomes: rivers and streams

  • Semlitsch, R. 2003. Amphibian conservation. Washington: Smithsonian Books.
  • Gadow, H. 1901. Amphibia and Reptiles. New York: The MacMillan Company.
  • 2004. "Arkive--Images of Life" (On-line). Japanese giant salamander. Accessed October 07, 2005 at http://www.arkive.org/species/GES/amphibians/Andrias_japonicus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits cold, fast flowing freshwater mountain streams and rivers (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Andrias japonicus is a carnivorous dietary generalist which engulfs prey by quickly opening and closing its warty mouth while sucking. By creating negative pressure within the mouth, A. japonicus produces asymmetrical suction. Assuming that A. japonicus follows the same suction habits as other cryptobranchid salamanders that suck asymmetrically, Giant Japanese salamanders drop one side of their jaw 10 to 40 degrees in order to suck in their prey. Because these salamanders feed in water, saliva is not needed.

These salamanders are known to consume:

Fish (Class Osteichthyes).

Insects (Class Insecta).

Crustaceans (Subphylum Crustarea).

Giant Japanese salamanders also eat worms, although details on the types of worms consumed are not available.

Animal Foods: fish; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Andrias japonicus serves as host for parasites. Studies have shown that giant Japanese salamanders can house parasitic roundworms, specifically Spiroxys hanzaki.

Commensal/Parasitic Species:

  • Parasitic roundworms (Spiroxys hanzaki)

  • Hasegawa, H., A. Miyata, T. Doi. 1998. Spiroxys hanzaki n. sp. (Nematoda: Gnathostomatidae) collected from the giant salamander, Andrias japonicus (Caudata: Cryptobranchidae), in Japan. The Journal of Parasitology, 69: 33-42.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Fish (Class Osteichthyes) are a main predator of A. japonicus eggs.

Humans have also used these salamanders as a source of food. They may still be used some traditional medicinal practices.

The long bodies of A. japonicus are covered with a wrinkled grey, black, and green epidermis in the adult stage that allows them to blend into the surrounding area and avoid potential predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

With small eyes that provide little visual acuity, these nocturnal amphibians use the senses of smell and touch to perceive their environments. Little is known about the communication methods of A. japonicus. Tactile communication is apparently important between rival males, as well as between a male and female during breeding. The "smelly" expulsion produced under threat suggests that chemical communication may have some role in this species. The role of auditory cues in communication is unknown.

Communication Channels: tactile ; chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Andrias japonicus grows continously throughout life. As with other amphibians, A. japonicus undergoes three developmental stages, including egg, larva, and adult forms. Hatching occurs 12 to 15 weeks after fertilization. Eggs usually measure 6 mm by 4 mm, and are mostly yellow in color.

Metamorphosis in this species is incomplete. Adults do not develop eyelids, and retain a single pair of closed gill slits on the neck. Andrias japonicus retains its larval teeth for life, and has lungs which are vestigial, performing no gas exchange.

Development - Life Cycle: neotenic/paedomorphic; metamorphosis ; indeterminate growth

  • Sleeper, B. 1997. Giant (really big) salamanders. Pacific Discovery, 50: 36-37.
  • Zug, G., L. Vitt, J. Caldwell. 2001. Herpetology. San Diego: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Giant Japanese salamanders can live for over fifty years. However, it is unlikely that most individuals live this long. Large numbers of offspring are produced each season, so mortality early in life is probably high.

Range lifespan

Status: wild:
50+ (high) months.

Range lifespan

Status: captivity:
50+ (high) years.

Average lifespan

Status: captivity:
55.0 years.

Average lifespan

Status: captivity:
16.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 55 years (captivity) Observations: The longest-lived amphibians on record, it is possible that these animals feature negligible senescence. Their longevity may be underestimated and there are anecdotal claims that these animals live up to 80 or even 100 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Andrias japonicus begins the reproductive process in early autumn. In late August, the salamanders congregate at nesting sites, or spawning pits, which simply consist of rocky caverns, burrows, or hollowed impressions within the sandy streambed. Males aggressively compete to occupy these spawning pits. Once males have secured the nesting sites, females enter the nesting site to begin the fertilization process. Females approach males and proceed to make a spin-like motion. The female then releases her eggs within the spawning pit while the male fertilizes them. More than one female may release eggs into the same spawning pit. Males guard the eggs in the spawning pits until they hatch, 12 to 15 weeks after fertilization. This protects the eggs from other male salamanders and possible predators such as fish. Males ferociously defend and occupy a particular spawning pit for many years. Smaller males have been killed and eaten by larger males during the reproductive season.

Mating System: polygynous

Females release 400 to 500 eggs in the spawning pit protected by a male. These eggs are held together with a string-like substance and resemble threaded beads on a string. Fertilization is external. Eggs hatch 12 to 15 weeks after fertilization. The age at sexual maturity for A. japonicus is not known, although given male competition, it is likely that at least for males, successful breeding requires a large size.

Breeding interval: Breeding occurs once yearly.

Breeding season: Breeding begins in early August.

Range number of offspring: 400 to 500.

Range time to hatching: 12 to 15 weeks.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

The exact amount of parental investment found in A. japonicus has not been thoroughly investigated. Females provision eggs with large quantities of nutrients, ensuring their survival. Males may contribute to the survival of the young through their protection of spawning pits. A male protects his spawning pit from predatory fish and other male A. japonicus. Males tend to protect these spawning pits until the eggs have hatched, 12 to 15 weeks after fertilization.

Parental Investment: pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Female, Protecting: Male)

  • Sleeper, B. 1997. Giant (really big) salamanders. Pacific Discovery, 50: 36-37.
  • Pough, H., R. Andrews, J. Cadle, M. Crump, K. Wells. 2001. Herpetology. New Jersey: Prentice Hall.
  • 2004. "Arkive--Images of Life" (On-line). Japanese giant salamander. Accessed October 07, 2005 at http://www.arkive.org/species/GES/amphibians/Andrias_japonicus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Andrias japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGATGGTTATTTTCAACAAATCATAAAGATATTGGCACTCTATATTTAGTATTCGGTGCTTGGGCTGGGATGGTTGGTACCGCCTTAAGTCTATTAATTCGGGCAGAATTAAGCCAGCCGGGGACTTTACTTGGTGAT---GATCAGATTTATAATGTTATCGTAACAGCCCATGCCTTTGTAATAATTTTTTTCATAGTTATGCCAATTATAATCGGCGGCTTTGGCAATTGGCTCGTTCCCTTAATAATTGGCGCCCCAGATATGGCCTTTCCTCGTATAAATAATATAAGCTTTTGATTACTTCCTCCATCCTTCTTACTATTACTGGCATCCTCCGGCATTGAAGCAGGCGCCGGGACCGGATGAACAGTTTACCCGCCTCTGGCTAGTAATTTAGCCCACGCAGGGGCTTCTGTTGATCTTACAATTTTTTCACTTCACCTAGCTGGTATTTCATCAATTCTTGGAGCAATTAATTTTATTACTACTTCAATTAATATAAAGCCCCCAGCTATGACACAATATCAAACCCCTTTGTTTGTCTGATCCGTATTAATTACAGCGATTTTGCTATTGTTATCCCTTCCCGTTCTAGCTGCTGGTATTACTATACTATTAACAGACCGTAATCTTAATACAACTTTCTTTGACCCGTCTGGAGGGGGGGACCCTGTCTTATACCAACACCTTTTCTGATTTTTTGGGCACCCTGAGGTGTATATTTTAATTCTCCCAGGCTTTGGTATAATTTCGCATATTGTCACATATTATTCTGCCAAAAAAGAACCATTCGGTTATATAGGAATGGTGTGAGCAATAATATCTATTGGTTTATTAGGCTTTATTGTATGAGCGCATCATATATTTACAGTTGACCTTAATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Andrias japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Yoshio Kaneko, Masafumi Matsui

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Near Threatened since the species depends on streams in forest, and so its Area of Occupancy is probably not much greater than 2,000 km2, and the extent and quality of its habitat is declining, thus making the species close to qualifying for Vulnerable.

History
  • 1996
    Vulnerable
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The IUCN Red List of Threatened Species lists A. japonicus as a near threatened or lower risk species.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Andrias japonicus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Spawning occurs in late August to early September. Eggs are deposited in long strings, containing 400-600 eggs. Diameter of egg 5 mm; diameter of external gelatinous capsule 8 to 15 mm. At water temperatures between 8° and 18° C embryonic development takes 40 to 60 days (Kuwabara et al. 1989). Larvae hatch in October-November at a total length of 30 mm and start feeding after absorption of yolk. One year old larvae measure about 100 mm, three year olds some 200 mm. At this size larvae start losing their gills. Males reach sexual maturity at 30 cm, females at 40 cm. The larval period is about 4-5 years, and it takes another 10 years to reach adulthood (Ministry of the Environment, Japan 2008).The salamanders are entirely aquatic and nocturnal. They feed on fresh-water crabs, fish, small amphibians (Tago 1927), and additionally on aquatic insects and small mammals (Goris and Maeda 2005). Males and females have overlapping home ranges and are more or less sedentary outside the spawning period. During the breeding season, in August-September, both sexes congregate at underwater nest sites, consisting of 100 to 150 cm long burrows into or near the river bank. Nests have a single entrance opening underwater. Favorable nest sites may be used during successive years. Both males and females may occupy more than one nest at the time, with large and heavy males ("den-masters") attempting to monopolize occupancy of the nest sites. Nests are guarded from inside by males, attacking other males who try to enter. Males may also patrol around the nest area, chasing and attacking other males. Females enter the nests more than once and lay their eggs in the cavity, where they are fertilized by the male. At this stage several other males may intrude and try to fertilize the eggs. After spawning, den-masters remain at the nests for more than one month and aggressively guard the eggs until hatching occurs or until late October. Dominance rank of den-masters among males attempting to breed appears to be strong. Dead and heavily injured males have often been found during September (Kawamichi and Ueda 1998).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Goka, K., Yokoyama, J., Une, Y., Kuroki, T., Suzuki, K., Nakahara, M., Kobayashi, A., Inaba, S., Mizutani, T., and Hyatt, A. D. (2009). ''Amphibian chytridiomycosis in Japan: distribution, haplotypes, and possible route of entry into Japan.'' Molecular Ecology, 18, 4757 - 4774.
  • Goris, R.C. and Maeda, N. (2004). Guide to the Amphibians and Reptiles of Japan. Krieger Publishing Company, Malabar, Florida.
  • IUCN. (2010). IUCN Red List of Threatened Species. Version 2010.2. http://www.iucnredlist.org. Accessed on 16 September 2010.
  • Japan Agency of Environment (2000). Threatened Wildlife of Japan - Red Data Book. 2nd ed. Reptilia/Amphibia. (in Japanese with English summary). Japan Wildlife Research Center, Tokyo, Japan.
  • Kato, T. and Ota, H. (1993). Endangered Wildlife of Japan. Hoikusha, Osaka, Japan.
  • Kerbert, C. (1905). ''Über die Eier und Larven von Megalobatrachus maximus Schl.'' C. R. 6e Congr. Intern. Zool., Berne, 1904, 289-294.
  • Kobara, J. (1985). The Giant Salamander (in Japanese). Doubutsu-sha, Tokyo, Japan.
  • Kuwabara, K. and Nakagoshi, N. (2009). ''Analysis on Reproductive Behavior of Japanese Giant Salamander, Andrias japonicus - Observations on the Breeding Behavior and Notes on the Video Imagery.'' Natural History of Nishi-Chugoku Mountains, 14, 11-50 + DVD.
  • Kuwabara, K., Suzuki, N., Wakabayashi, F., Ashikaga, H., Inoue, T. and Kobara, J. (1989). ''Breeding the Japanese Giant Salamander at Asa Zoological Park.'' International Zoo Yearbook, London, 28, 22-31.
  • Matsui, M., Tominaga, A., Liu, W.-Z., and Tanaka-Ueno, T. (2008). ''Reduced genetic variation in the Japanese giant salamander, Andrias japonicus (Amphibia: Caudata) .'' Molecular Phylogeny and Evolution, 49, 318-326.
  • Matsui, M., and Hayashi, T. (1992). ''Genetic uniformity in the Japanese Giant Salamander, Andrias japonicus.'' Copeia, 1992, 232-235.
  • Ministry of the Environment, Japan, (2008). ''Review of the Status of Japanese Giant Salamander (Andrias japonicus).'' Annex 2 to Periodic Review of Species Included in the CITES Appendices, Geneva 2009, 5-14.
  • Ohno, M. (1981). "Megalobatrachus japonicus." Final Report of the Reptiles and Amphibians Survey of the Second National Survey on the Natural Environment of Japan. 1978, pt. 2. Nature Conservancy Society of Japan, Tokyo., 55-70.
  • Okada, S., Utsunomiya, T., Okada, T., Felix, Z.I., and Ito, F. (2008). ''Characteristics of Japanese Giant Salamander (Andrias japonicus) populations in two small tributary streams in Hiroshima Prefecture, Western Honshu, Japan.'' Herpetological Conservation and Biology, 3, 192-202.
  • Ota, H. (2000). ''Current status of the threatened amphibians and reptiles of Japan.'' Population Ecology, 42, 5-9.
  • Sato, I. (1943). A Monograph of the Tailed Batrachians of Japan (In Japanese). Nippon Shuppan-Sha, Osaka, Japan.
  • Stejneger, L. (1907). Herpetology of Japan and Adjacent Territory. Government Printing Office, Washington. Reprinted 1996, with an introduction by M. Matsui. Society for the Study of Amphibians and Reptiles in cooperation with the Herpetological Society of Japan
  • Tago, K. (1927). ''Notes on the habits and life history of Megalobatrachus japonicus.'' Xe Congrès International de Zoologie, tenu à Budapest 1927. Budapest, Hungary, 828-838.
  • Tochimoto, T. (1995). ''Ecological studies on the Japanese Giant Salamander, Andrias japonicus, in the Ichi River in Hyogo Prefecture. 10. An attempt to rebuild spawning places along the river.'' Journal of Japanese Association of Zoological Gardens and Aquariums, 37, 7-12.
  • Tochimoto, T. (1996). ''Amphibians, Reptiles, and Cartilaginous Fish, 5.'' The Encyclopedia of Japanese Animals. Hidaka, T., eds., Heibonsha, Tokyo, Japan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is an uncommon species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Life History, Abundance, Activity, and Special Behaviors

The range of this species is severely fragmented (Ohno 1981). A continuing decline is observed in extent and quality of habitat and in the number of locations where the animal is found (Matsui and Hayashi 1992). Weirs, dams and river bank reinforcements constructed for flood and erosion control, agriculture, hydraulic power generation and road construction severely impact a large part of A. japonicus's riverine habitat (Okada et al. 2008). The animal used to be hunted for food and medical purposes. In Japan the species is fully protected by law since 1952; it is classified as rare (Kato and Ota 1993) and considered to be Near Threatened (Environment Agency of Japan 2000, Ota 2000). The species is listed under Appendix I of the Convention on International Trade of Endangered Species (CITES) (Ministry of the Environment, Japan 2008, IUCN 2010).Although the prevalence of chytrid infection appears to be high in wild individuals (47 of 126 animals sampled, or 37.3%, were infected with Batrachochytrium dendrobatidis, or Bd), neither infected wild nor infected captive A. japonicus have been reported to show any signs of disease (Goka et al. 2009). Examination of formalin-fixed A. japonicus museum specimens has revealed the presence of Bd infection in specimens collected as early as 1902 (Goka et al. 2009). In addition, Bd haplotypes found on wild A. japonicus are genetically distinct from other strains, including those found on introduced bullfrogs, and Bd genetic variation is higher in Japanese endemic strains of Bd than for strains found in the U.S.A., Ecuador, or Italy (Goka et al. 2009). Taken together, the evidence suggests that Bd is endemic to Japan (as well as having been introduced on non-native species such as bullfrogs) and that host-parasite co-evolution has occurred in the case of A. japonicus and Bd (Goka et al. 2009).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Goka, K., Yokoyama, J., Une, Y., Kuroki, T., Suzuki, K., Nakahara, M., Kobayashi, A., Inaba, S., Mizutani, T., and Hyatt, A. D. (2009). ''Amphibian chytridiomycosis in Japan: distribution, haplotypes, and possible route of entry into Japan.'' Molecular Ecology, 18, 4757 - 4774.
  • Goris, R.C. and Maeda, N. (2004). Guide to the Amphibians and Reptiles of Japan. Krieger Publishing Company, Malabar, Florida.
  • IUCN. (2010). IUCN Red List of Threatened Species. Version 2010.2. http://www.iucnredlist.org. Accessed on 16 September 2010.
  • Japan Agency of Environment (2000). Threatened Wildlife of Japan - Red Data Book. 2nd ed. Reptilia/Amphibia. (in Japanese with English summary). Japan Wildlife Research Center, Tokyo, Japan.
  • Kato, T. and Ota, H. (1993). Endangered Wildlife of Japan. Hoikusha, Osaka, Japan.
  • Kerbert, C. (1905). ''Über die Eier und Larven von Megalobatrachus maximus Schl.'' C. R. 6e Congr. Intern. Zool., Berne, 1904, 289-294.
  • Kobara, J. (1985). The Giant Salamander (in Japanese). Doubutsu-sha, Tokyo, Japan.
  • Kuwabara, K. and Nakagoshi, N. (2009). ''Analysis on Reproductive Behavior of Japanese Giant Salamander, Andrias japonicus - Observations on the Breeding Behavior and Notes on the Video Imagery.'' Natural History of Nishi-Chugoku Mountains, 14, 11-50 + DVD.
  • Kuwabara, K., Suzuki, N., Wakabayashi, F., Ashikaga, H., Inoue, T. and Kobara, J. (1989). ''Breeding the Japanese Giant Salamander at Asa Zoological Park.'' International Zoo Yearbook, London, 28, 22-31.
  • Matsui, M., Tominaga, A., Liu, W.-Z., and Tanaka-Ueno, T. (2008). ''Reduced genetic variation in the Japanese giant salamander, Andrias japonicus (Amphibia: Caudata) .'' Molecular Phylogeny and Evolution, 49, 318-326.
  • Matsui, M., and Hayashi, T. (1992). ''Genetic uniformity in the Japanese Giant Salamander, Andrias japonicus.'' Copeia, 1992, 232-235.
  • Ministry of the Environment, Japan, (2008). ''Review of the Status of Japanese Giant Salamander (Andrias japonicus).'' Annex 2 to Periodic Review of Species Included in the CITES Appendices, Geneva 2009, 5-14.
  • Ohno, M. (1981). "Megalobatrachus japonicus." Final Report of the Reptiles and Amphibians Survey of the Second National Survey on the Natural Environment of Japan. 1978, pt. 2. Nature Conservancy Society of Japan, Tokyo., 55-70.
  • Okada, S., Utsunomiya, T., Okada, T., Felix, Z.I., and Ito, F. (2008). ''Characteristics of Japanese Giant Salamander (Andrias japonicus) populations in two small tributary streams in Hiroshima Prefecture, Western Honshu, Japan.'' Herpetological Conservation and Biology, 3, 192-202.
  • Ota, H. (2000). ''Current status of the threatened amphibians and reptiles of Japan.'' Population Ecology, 42, 5-9.
  • Sato, I. (1943). A Monograph of the Tailed Batrachians of Japan (In Japanese). Nippon Shuppan-Sha, Osaka, Japan.
  • Stejneger, L. (1907). Herpetology of Japan and Adjacent Territory. Government Printing Office, Washington. Reprinted 1996, with an introduction by M. Matsui. Society for the Study of Amphibians and Reptiles in cooperation with the Herpetological Society of Japan
  • Tago, K. (1927). ''Notes on the habits and life history of Megalobatrachus japonicus.'' Xe Congrès International de Zoologie, tenu à Budapest 1927. Budapest, Hungary, 828-838.
  • Tochimoto, T. (1995). ''Ecological studies on the Japanese Giant Salamander, Andrias japonicus, in the Ichi River in Hyogo Prefecture. 10. An attempt to rebuild spawning places along the river.'' Journal of Japanese Association of Zoological Gardens and Aquariums, 37, 7-12.
  • Tochimoto, T. (1996). ''Amphibians, Reptiles, and Cartilaginous Fish, 5.'' The Encyclopedia of Japanese Animals. Hidaka, T., eds., Heibonsha, Tokyo, Japan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is threatened by dam construction, the construction of artificial concrete riverbanks, and the alteration of river courses. Suitable habitats are therefore becoming increasingly fragmented. It might also be facing competition from the introduced Chinese Giant Salamander (Andrias davidianus). Genetic uniformity in this species is high, which increases its vulnerability to threatening processes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is threatened by hunting, as its flesh is a delicacy in Asia. A more recent and worrying threat is the silting up of rivers in Japan where it is found, due to deforestation creating soil erosion and runoff (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It has been designated as a special natural monument in Japan and is totally protected, and its habitats are protected in some areas. Asa Zoo has been breeding this species in captivity since 1979 (although no re-introductions have been performed), and it also rescues individuals from degraded habitats. It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Japanese giant salamander is now protected from international trade by its listing on Appendix I of the Convention of International Trade of Endangered Species (CITES) which hopefully will reduce the hunting threat facing this animal (4). Conservation efforts to reforest and protect this ancient species' habitat are also essential for the survival of this species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Local fishermen of the Japanese islands claim that A. japonicus consumes small sweetfish that inhabit the same mountain streams. Many locals fear that their fishing economy is damaged by the salamanders predation of small fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Andrias japonicus is occasionally hunted and is sold for profit in Asia as a delicacy. There are reports that this species may be used in some traditional medicines.

Positive Impacts: food ; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Relation to Humans

The species was first bred in captivity in the Amsterdam Zoo (Kerbert 1905). The Japanese Giant Salamander is extremely long lived. A specimen in the Amsterdam Zoo lived for 52 years (Tago 1927). Since 1979, Hiroshima City Asa Zoological Park is successfully breeding A. japonicus (Kuwabara et al. 1989). Presently (2010) the third generation is being raised in captivity. Researchers of Asa Zoo study Giant Salamander reproductive behavior by observing salamanders breeding in man-made holes in branches of the Shijihara River in Hiroshima Prefecture (Kuwabara and Nakagoshi 2009).Eco-friendly works for habitat conservation have begun in some areas and attempts have been made to rebuild spawning places along the Ichi River (Tochimoto 1995, 1996).

  • Stuart, S., Hoffmann, M., Chanson, J., Cox, N., Berridge, R., Ramani, P., and Young, B. (eds) (2008). Threatened Amphibians of the World. Lynx Edicions, IUCN, and Conservation International, Barcelona, Spain; Gland, Switzerland; and Arlington, Virginia, USA.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Goka, K., Yokoyama, J., Une, Y., Kuroki, T., Suzuki, K., Nakahara, M., Kobayashi, A., Inaba, S., Mizutani, T., and Hyatt, A. D. (2009). ''Amphibian chytridiomycosis in Japan: distribution, haplotypes, and possible route of entry into Japan.'' Molecular Ecology, 18, 4757 - 4774.
  • Goris, R.C. and Maeda, N. (2004). Guide to the Amphibians and Reptiles of Japan. Krieger Publishing Company, Malabar, Florida.
  • IUCN. (2010). IUCN Red List of Threatened Species. Version 2010.2. http://www.iucnredlist.org. Accessed on 16 September 2010.
  • Japan Agency of Environment (2000). Threatened Wildlife of Japan - Red Data Book. 2nd ed. Reptilia/Amphibia. (in Japanese with English summary). Japan Wildlife Research Center, Tokyo, Japan.
  • Kato, T. and Ota, H. (1993). Endangered Wildlife of Japan. Hoikusha, Osaka, Japan.
  • Kerbert, C. (1905). ''Über die Eier und Larven von Megalobatrachus maximus Schl.'' C. R. 6e Congr. Intern. Zool., Berne, 1904, 289-294.
  • Kobara, J. (1985). The Giant Salamander (in Japanese). Doubutsu-sha, Tokyo, Japan.
  • Kuwabara, K. and Nakagoshi, N. (2009). ''Analysis on Reproductive Behavior of Japanese Giant Salamander, Andrias japonicus - Observations on the Breeding Behavior and Notes on the Video Imagery.'' Natural History of Nishi-Chugoku Mountains, 14, 11-50 + DVD.
  • Kuwabara, K., Suzuki, N., Wakabayashi, F., Ashikaga, H., Inoue, T. and Kobara, J. (1989). ''Breeding the Japanese Giant Salamander at Asa Zoological Park.'' International Zoo Yearbook, London, 28, 22-31.
  • Matsui, M., Tominaga, A., Liu, W.-Z., and Tanaka-Ueno, T. (2008). ''Reduced genetic variation in the Japanese giant salamander, Andrias japonicus (Amphibia: Caudata) .'' Molecular Phylogeny and Evolution, 49, 318-326.
  • Matsui, M., and Hayashi, T. (1992). ''Genetic uniformity in the Japanese Giant Salamander, Andrias japonicus.'' Copeia, 1992, 232-235.
  • Ministry of the Environment, Japan, (2008). ''Review of the Status of Japanese Giant Salamander (Andrias japonicus).'' Annex 2 to Periodic Review of Species Included in the CITES Appendices, Geneva 2009, 5-14.
  • Ohno, M. (1981). "Megalobatrachus japonicus." Final Report of the Reptiles and Amphibians Survey of the Second National Survey on the Natural Environment of Japan. 1978, pt. 2. Nature Conservancy Society of Japan, Tokyo., 55-70.
  • Okada, S., Utsunomiya, T., Okada, T., Felix, Z.I., and Ito, F. (2008). ''Characteristics of Japanese Giant Salamander (Andrias japonicus) populations in two small tributary streams in Hiroshima Prefecture, Western Honshu, Japan.'' Herpetological Conservation and Biology, 3, 192-202.
  • Ota, H. (2000). ''Current status of the threatened amphibians and reptiles of Japan.'' Population Ecology, 42, 5-9.
  • Sato, I. (1943). A Monograph of the Tailed Batrachians of Japan (In Japanese). Nippon Shuppan-Sha, Osaka, Japan.
  • Stejneger, L. (1907). Herpetology of Japan and Adjacent Territory. Government Printing Office, Washington. Reprinted 1996, with an introduction by M. Matsui. Society for the Study of Amphibians and Reptiles in cooperation with the Herpetological Society of Japan
  • Tago, K. (1927). ''Notes on the habits and life history of Megalobatrachus japonicus.'' Xe Congrès International de Zoologie, tenu à Budapest 1927. Budapest, Hungary, 828-838.
  • Tochimoto, T. (1995). ''Ecological studies on the Japanese Giant Salamander, Andrias japonicus, in the Ichi River in Hyogo Prefecture. 10. An attempt to rebuild spawning places along the river.'' Journal of Japanese Association of Zoological Gardens and Aquariums, 37, 7-12.
  • Tochimoto, T. (1996). ''Amphibians, Reptiles, and Cartilaginous Fish, 5.'' The Encyclopedia of Japanese Animals. Hidaka, T., eds., Heibonsha, Tokyo, Japan.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Japanese giant salamander

The Japanese giant salamander (Andrias japonicus) is endemic to Japan, where it is known as Ōsanshōuo (オオサンショウウオ/大山椒魚?), literally meaning "giant pepper fish". With a length of up to almost 1.5 m (5 ft),[2] it is the second-largest salamander in the world, only being surpassed by the very similar and closely related Chinese giant salamander (A. davidianus).

Contents

Behavior

The Japanese giant salamander, being restricted to streams with clear, cool water, is entirely aquatic and nocturnal. Unlike other salamanders, which lose their gills early in their lifecycles, they only breach their heads above the surface to obtain air without venturing out of the water and onto land. Also due to their large size and lack of gills, they are confined to flowing water where oxygen is abundant.[3] When threatened, these salamanders can excrete a strong-smelling, milky substance with an odor resembling Japanese pepper (hence its common Japanese name, giant pepper fish). It has very poor eyesight, and possesses special sensory cells covering its skin, running from head to toe, the lateral line system. These sensory cells' hair-like shapes detect minute vibrations in the environment, and are quite similar to the hair cells of the human inner ear. This feature is essential for its hunting because of its poor eyesight. It feeds mainly on insects, frogs and fish. It has a very slow metabolism and lacks natural competitors. It is a long-lived species, with the captive record being an individual that lived in the Natura Artis Magistra, the Netherlands, for 52 years.[2] In the wild, they may live for nearly 80 years.

A pair of captive Japanese giant salamanders

History

The Japanese giant salamander (hanzaki) was first catalogued by Europeans when the resident physician of Dejima Island in Nagasaki, Philipp Franz von Siebold, captured an individual and shipped it back to Leiden in the Netherlands, in the 1820s. The species was designated as a special natural monument in 1951, and has been protected.[4] It is a survivor from the Upper Jurassic period, some 140 million years ago.

Status

The Japanese giant salamander is threatened by pollution, habitat loss (among other changes, by the silting up of the rivers where it lives), and overcollection. It is considered near threatened by IUCN, and is included on CITES Appendix I.[5] It can be found on the islands of Kyushu, Honshu, and Shikoku in Japan. In the past, they were fished out of rivers and streams as a source of food, but hunting has ceased because of protection acts.

Life cycle

The life cycle is similar to that of an amphibious salamander except it does not emerge from the water onto land, and remains under water during adulthood. Specifically, the Japanese giant salamander travels up stream into the mountains to spawn and lay eggs. Larvae emerge from the eggs, and lose their gills when they become adults.

Reproduction

Hynobiid salamanders practice external fertilization, or spawning. And, unlike other salamander families which reproduce internally, male hynobiids focus on egg sacs rather than females during breeding. The female lays two egg sacs at a time, each containing up to 70 eggs. Parental care is common.[6] See Asiatic salamander.

Cultural references

Ukiyo-e print by Utagawa Kuniyoshi depicting a giant salamander being stabbed by the samurai Hanagami Danjō no jō Arakage

The Japanese giant salamander has been the subject of legend and artwork in Japan, for example, in the ukiyo-e work by Utagawa Kuniyoshi. The well-known Japanese mythological creature known as the kappa may be the Japanese giant salamander.[7]

See also

References

  1. ^ "Amphibian Species of the World - Andrias japonicus (Temminck, 1836)". Research.amnh.org. Retrieved 2010-02-04. 
  2. ^ a b Andrias japonicus - Amphibiaweb
  3. ^ The Encyclopedia of Reptiles and Amphibians. Facts on File Inc. 1986. ISBN 0-8160-1359-4. 
  4. ^ "オオサンショウウオ". The Agency for Cultural Affairs. Retrieved 2011-09-24. (Japanese)
  5. ^ Japanese giant salamander. ARKive. Retrieved 2008-09-19.
  6. ^ (Hasumi 2002).
  7. ^ "River Monsters" programme 6 Series 3 directed by Duncan Chard, screened in UK on ITV1 14.02.2012 at 19.30
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!