Overview

Comprehensive Description

Morphologie : La munidopsis d’Antoni a une carapace et et les pattes munies de nombreux tubercules et de petites épines. Le rostre est pointu en forme d’alène ronde. Les pinces sont sub-égales. Le pédoncule oculaire a une épine mésiale droite ou légèrement concave.

Biologie : La biologie de cette espèce d’eaux profondes n’est pas connue.

Ecologie & distribution : M. antonii est une espèce abyssale sub cosmopolite que l’on trouve sur les fonds de vase blanche molle. En Europe, elle a été observée en Atlantique oriental dans le golfe de Gascogne et aux Açores. Ailleurs, elle a été signalée en Atlantique occidental dans le détroit de Davis, en Afrique du sud, dans le sud-ouest de l’Australie, au Japon et dans la mer de Bering, entre -366 m et -4.510 m de profondeur.

Interactions avec les activités humaines : aucune.

Bibliographie sommaire :
Macpherson E., Segonzac M., 2005. Species of the genus Munidopsis (Crustacea, Decapoda, Galatheidae) from the deep Atlantic Ocean, including cold-seep and hydrothermal vent areas. Zootaxa, 1095: 1-60.
Udekem d'Acoz C. d', 1999. Inventaire et distribution des crustacés décapodes de l'Atlantique nord-oriental, de la Méditerranée et des eaux continentales adjacentes au nord de 25°N. Collection Patrimoines Naturels, Service du patrimoine naturel, Muséum National d'Histoire Naturelle, Paris, vol. 40: i-x, 1-383.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

North East of Azores, 3975–4010 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Taylor, Joanne

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Data

Syntypes, 2 males, MNHN Ga 277 and 278; 1 ovigerous female, USNM 22909.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymy

Galathodes antonii Filhol, 1884: 230, fig. 2 (NE of Azores, 3975–4010 m).
Munidopsis antonii. — Henderson, 1888: 151, pl. 18, figs 1, 1a (SW of Australia, and off Juan Fernandez, 2516–3294 m). — Luke, 1977: 28 (list; Baja California, Basin off Bahia Magdalena, and off St San Juan, Peru, 3427–3676 m). — Baba, 1982a: 113, pl. 1, fig. 2 (Izu Shoto, Japan, 3420–3960 m)). — de Saint Laurent, 1985: table 2 (Bay of Biscay, 3992–4510 m). — Hendrickx & Harvey, 1999: 376 (list). — d'Udekem d'Acoz, 1999: 166 (review of occurrences). — Davie, 2002: 65 (no record). — Baba, 2005: 284 (132, 284, figs 52–54 (Mozambique Channel, off Sri Lanka, Tasman Sea, off Zamboanga, W of Costa Rica, and Gulf of Panama, 3660–3800 m, key, synonymies). — Macpherson & Segonzac, 2005: 14 (NE Atlantic, off Namibia, Gulf of Guinea, off South Africa, Azores, NW Atlantic, Bay of Biscay, 3134–4460). — Macpherson, 2007: 38 (west of Sri Lanka, 3450–3625 m). — Jones & Macpherson, 2007: 480 (off California, 4100 m). — Osawa & Takeda, 2007: 137, fig. 3C, D (south of Tosa Bay, 2739–3278 m).
Munidopsis Antonii. — A. Milne Edwards & Bouvier, 1900: 321, pl. 4, fig. 2, pl. 30, figs 20–24 (N and NE of Azores, 3975–4010 m). — Hansen, 1908: 38, pl. 3, figs 3a, 3b (southern part of Davis Straits, 2626 m). — Bouvier, 1922: 47 (Bay of Biscay, 3910 m).
Munidopsis beringana Benedict, 1902: 279, fig. 23 (type locality: Bering Sea, [55°23´00”N, 170°31´00”W], 3241 m [3 female syntypes, USNM 20557]). — Rathbun, 1904: 167 (no record). — Makarov, 1938: 101, fig. 36 (Sea of Okhotsk, 3500 m). — Ambler, 1980: 24 (Cascadia Basin and Tufts Plain off Oregon, 2800–3990 m). — Wicksten, 1989: 315 (list). — Chevaldonné & Olu, 1996: 290 (no record). — Martin & Haney, 2005: 478 (hydrothermal vents and cold seeps review).
Munidopsis antoni [lapsus]. — Haig, 1955: 40 (no record). — Andrade, 1985: 111 (Juan Fernandez islands).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Worldwide. From the Atlantic in the southern part of Davis Strait, both NE and N of Azores, and Bay of Biscay; from the Pacific Ocean in the Sea of Okhotsk, Bering Sea, off Oregon, off W coast of Baja California, off W Costa Rica, Gulf of Panama, off Peru, off Juan Fernandez W of Chile, SE of Australia, and SE of Hachijo-jima, Japan; 2516–4010 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Munidopsis beringana Benedict, 1902
Catalog Number: USNM 20557
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1895
Locality: SW Pribilof Islands, Alaska, United States, Bering Sea, North Pacific Ocean
Depth (m): 3239 to 3239
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Munidopsis antonii Filhol, 1884
Catalog Number: USNM 22909
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Talisman
Year Collected: 1883
Locality: NE Of The Azores, North Atlantic Ocean
Depth (m): 4010 to 4010
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 1522 - 4434
  Temperature range (°C): 1.230 - 2.520
  Nitrate (umol/L): 22.606 - 44.676
  Salinity (PPS): 34.448 - 34.912
  Oxygen (ml/l): 0.641 - 5.501
  Phosphate (umol/l): 1.510 - 3.177
  Silicate (umol/l): 43.061 - 215.449

Graphical representation

Depth range (m): 1522 - 4434

Temperature range (°C): 1.230 - 2.520

Nitrate (umol/L): 22.606 - 44.676

Salinity (PPS): 34.448 - 34.912

Oxygen (ml/l): 0.641 - 5.501

Phosphate (umol/l): 1.510 - 3.177

Silicate (umol/l): 43.061 - 215.449
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Munidopsis antonii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGTGACGACCA---------ATTTACAATGTAATTGTAACTGCTCACGCTTTTGTAATAATCTTTTTCATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTAATCCCACTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGACTTCTACCCCCATCTCTTACACTTTTATTAATAAGTGGAATAGTAGAGAGAGGGGTAGGAACAGGATGAACCGTTTATCCCCCTTTAGCCTCCAGTATTGCCCACGCTGGAGCCTCAGTTGACATGGCAATTTTTTCTCTTCATTTAGCGGGAGTTTCTTCAATCTTAGGGTCAGTCAACTTCATAACAACCGTAATCAACATACGAGCTAAAGGTATAACACTAGACCGAATCCCGTTATTTATTTGAGCCGTATTTATTACTACCGTACTTTTACTCCTATCTCTCCCGGTGCTAGCCGGAGCCATCACCATATTATTAACGGACCGTAACCTTAATACATCTTTCTTTGATCCG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Munidopsis antonii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!