Overview

Distribution

Geographic Range

Homarus americanus, the American lobster, is found along the Atlantic coast of North America in the region from Labrador, Canada to North Carolina, United States. They are most prevalent along the New England coast. The American lobster is found in shallow waters but is more abundant in deeper waters and can live as far deep as 365 m.

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Cobscook Bay, FAO fishing area 21, Gulf of Maine, Gulf of St. Lawrence, New Jersey, North Sea, North West Atlantic, Swedish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species range extends from Labrador, Canada to North Carolina, USA (Cobb and Castro 2006). Van der Meeren et al. (2006) also note that it has been found in Iceland during the 1960s and more recently in Norway (2005). The Icelandic presence was not genetically verified, and it is believed that the waters are too limnic for this species to survive (van der Meeren et al. 2006). The Norwegian specimens are thought to have been introduced by imports of the species (van der Meeren et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Labrador to Rich Inlet, near Wilmington, NC
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Homarus americanus is the largest species of lobster and can reach a length of up to 1.1 m and a weight of 20 kg. However, the size of a lobster which is commonly caught is approximately 25 cm in length and weighs about 0.5 kg.

A lobster's body is divided into twenty-one segments: six segments from the head region, eight segments compose the thorax (mid-section), and seven segments make up the abdomen (often called the tail). Commonly thought of as being red, the body is really blackish-green or brownish-green. The red color results when a lobster is boiled and is a result of pigments in the shell breaking down.

The eyes are on the first segment of the head and are stalked. They can only detect motion in dim light. The second segment of the head has anntenules with delicate hairs that have more than 400 types of chemoreceptors. The lobsters can detect other species, potential mates, prey and predators with the receptors.

Being in the Order Decapoda (meaning "ten feet"), the lobster has ten legs. Five pairs of jointed legs extend from the thorax region. The first pair of these legs extends towards the head and has claws (chela) on the end. One claw is usually larger than the other and has thick teeth which are used to crush objects. The other claw usually is smaller and has sharp teeth used for cutting.

Lobsters go through exceptional growth during their lifetime. When they first hatch, a lobster weighs less than one tenth of a gram. By the time they are full adults, they can reach a weight of up to 10 kilograms. This growth is an increase of 100,000 times. Lobsters achieve this growth by going through periods called molts. When a lobster is ready to molt, its body absorbs the mineral salts that had hardened its shell, drawing the salts further into its skin. When the shell softens, the lobster is able to break it and slide out. The lobster takes in more water and thus swells in size. The new shell is already covering its body but takes a few days to harden. During this period the lobster stays in seclusion to avoid predators. Each time a lobster molts its body can grow 10-15% in size. Newly hatched lobsters molt for the first time within the first week, and three more times within the first month.

Range mass: .0001 to 20 kg.

Range length: 1.1 (high) m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Whale, R. July 1993. Gimme Shelter. Natural History, Vol 102 Issue 7: 42-48.
  • Romanowsky, K. 2000a. "The American Lobster: Overview of Homarus americanus: The American Lobster" (On-line). Accessed May 7, 2003 at http://www.parl.ns.ca/lobster/overview.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species lives in a wide variety of habitats, but is reliant on shelter. It is most commonly found on rocky reefs, but at depths of 700 m it can be found inhabiting burrows in the walls of submarine canyons (Cobb and Castro 2006); however, it is most commonly found between depths of 0-50m. Post larvae settle in shallow water (less than 30m) and are associated with cobble/boulder habitats. As they grow that asscoation relaxes, and they undergo short distance movements with expansion into longer distance movements. Deep water populations are derived from shallow water recruitement. Deeper water individuals are typically found on mud habitats, peat reefs, seagrass beds, and sandy depressions (Lawton and Lavalli 1995). Deep water individuals are typically found on similar substrates as well as clay substrates. They are found at temperatures ranging from 5º C to 20º C; but can tolerate a temperature range of 1º C to 30.5º C (van der Meeren et al. 2009).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The American Lobster lives on the bottom of the ocean. They can be found in sandy and muddy areas, but prefer rocky bottoms with more places to hide. Young lobsters seem to prefer settling in areas with cobble. The lobster spends most of the day inside its burrow and will only leave it if food is nearby. At night it wanders the ocean floor, and may venture into the intertidal zone when tides are high. If a predator approaches, it quickly retreats back into the safe cover of its burrow.

Range depth: 365 (high) m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic ; coastal

Other Habitat Features: intertidal or littoral

  • Author unknown, 2001. The World Book Encyclopedia. Chicago, IL: World Book Inc..
  • Gulf of Maine Aquarium, 1999. "Lobsters" (On-line). Accessed May 7, 2003 at http://www.gma.org/lobsters/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is found at depths of 0-800 m over hard substrate from near shoreline to continental shelf.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13763 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7682 samples.

Environmental ranges
  Depth range (m): -1.55 - 470
  Temperature range (°C): 0.086 - 20.754
  Nitrate (umol/L): 1.522 - 25.613
  Salinity (PPS): 30.218 - 36.286
  Oxygen (ml/l): 3.415 - 7.766
  Phosphate (umol/l): 0.323 - 1.677
  Silicate (umol/l): 1.599 - 17.288

Graphical representation

Depth range (m): -1.55 - 470

Temperature range (°C): 0.086 - 20.754

Nitrate (umol/L): 1.522 - 25.613

Salinity (PPS): 30.218 - 36.286

Oxygen (ml/l): 3.415 - 7.766

Phosphate (umol/l): 0.323 - 1.677

Silicate (umol/l): 1.599 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Benthic Community

 

The species associated with this article partially comprise the benthic community of Stellwagen Bank, an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachusetts. Protected since 1993 as part of the Stellwagen Bank National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

The benthic community of Stellwagen Bank is diverse and varied, depending largely on the grain size of the substrate. Sessile organisms such as bryozoans, ascidians, tunicates, sponges, and tube worms prefer gravelly and rocky bottoms, while burrowing worms, burrowing anemones, and many mollusks prefer sand or mud surfaces (NOAA 2010). Macroalgae, such as kelps, are exceedingly rare in the area — most biogenic structure along the bottom is provided by sponges, cnidarians, and worms. The dominant phyla of the regional benthos are Annelida, Mollusca, Arthropoda, and Echinodermata (NOAA 2010). 

Ecologically, the Stellwagen Bank benthos contributes a number of functions to the wider ecosystem. Biogenic structure provided by sessile benthic organisms is critical for the survivorship of juveniles of many fish species, including flounders, hake, and Atlantic cod. The benthic community includes a greater than average proportion of detritivores — many crabs and filter-feeding mollusks — recycling debris which descends from the water column above (NOAA 2010). Finally, the organisms of the sea-bed are an important source of food for many free-swimming organisms. Creatures as large as the hump-backed whale rely on the benthos for food — either catching organisms off the surface or, in the whale’s case, stirring up and feeding on organisms which burrow in sandy bottoms (Hain et al 1995). 

As a U.S. National Marine Sanctuary, Stellwagen Bank is nominally protected from dredging, dumping, major external sources of pollution, and extraction of mammals, birds or reptiles (Eldredge 1993). The benthic habitat remains threatened, however, by destructive trawling practices. Trawl nets are often weighted in order that they be held against the bottom, flattening soft surfaces, destroying biogenic structure, and killing large numbers of benthic organisms. There is also occasional threat from contaminated sediments dredged from Boston harbor and deposited elsewhere in the region (NOAA 2010). The region benefits from close observation by NOAA and the Woods Hole Oceanographic Institute, however, and NOAA did not feel the need to make any special recommendations for the preservation of benthic communities in their 2010 Management Plan and Environmental Assessment. 

  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Hain JHW, Ellis SL, Kenney RD, Clapham PJ, Gray BK, Weinrich MT, Babb IG. 1995. Apparent bottom feeding by humpback-whales on Stellwagen Bank. Marine Mammal Science 11, 4:464-479.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Appendix J: Preliminary Species List for the SBNMS” pp. 370-381. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Three stomachs make up the digestive system, which is within the cephalothorax (the head and thorax). The first stomach (forgut) grinds food into small particles with grinding teeth. The second stomach (midgut) has glands to digest particles. The glands are the green portion of the lobster eaten by some humans (called the "tomalley"). The third stomach (hindgut) receives non-absorbed particles which are passed to the retum and anus.

Homarus americanus does the majority of its eating at night. It is usually a scavenger, feeding on dead animals, but is also capable of capturing its own prey. The lobster's diet consists mostly of clams, crabs, snails, small fish, algae and other plants called eelgrass. Since lobsters sometimes eat their own molted shell they were thought to be cannabalistic, but this has never been recorded in the wild. However, they will eat other lobsters when in captivity.

Animal Foods: fish; carrion ; mollusks; aquatic crustaceans

Plant Foods: algae; macroalgae

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore , Scavenger ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Humans are the main predators. Cod, flounder, sculpins, ells, rock gunnels, crabs and seals also eat lobsters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 100 years (wild) Observations: Lobsters grow throughout their lifespan. Molting appears to prevent the accumulation of wear and tear. The biggest lobsters ever caught have been estimated to be at least 50-100 years old, and may be even older. Egg production appears to increase with age. Therefore, this could be a species with negligible senescence (Caleb Finch 1990).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

A female is ready to mate at about 5 years of age. Mating must occur within 48 hours after the female molts, and the process usually lasts about a minute. The female will spawn her eggs between one month and two years after mating, at which time they become fertilized by sperm that has been stored. The number of eggs the female spawns is dependent on body size, where an 18 cm lobster will lay about 3,000 eggs and a 45 cm lobster will lay around 75,000 eggs. The female will then carry the eggs underneath her tail for about 10 to 11 months until they hatch. Only about 1/10 of 1 per cent of the young survive after four weeks, mainly due to predation. The young will move about the water column for about 12 days, then move to the bottom.

Average age at sexual or reproductive maturity (female): 5 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous ; sperm-storing

Parental Investment: female parental care

  • Author unknown, 2001. The World Book Encyclopedia. Chicago, IL: World Book Inc..
  • Bliss, D. 1990. Shrimps, Lobsters and Crabs; Thier Fascinating Life Story. New York City, New York: Columbia University Press.
  • Gulf of Maine Aquarium, 1999. "Lobsters" (On-line). Accessed May 7, 2003 at http://www.gma.org/lobsters/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Homarus americanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATCACGCAACGATGACTCTTTTCAACAAATCATAAAGACATTGGTACCCTATATTTTATCTTCGGAGCATGAGCAGGCATAGTAGGGACTTCATTAAGACTGGTAATTCGTGCTGAATTAGGTCAACCAGGAAGCCTCATTGGTGACGATCAAATCTACAATGTAGTTGTAACCGCCCACGCTTTTGTTATAATTTTCTTCATAGTTATACCCATTATAATTGGAGGCTTTGGAAACTGACTTGTACCACTTATACTAGGAGCTCCAGATATAGCATTTCCCCGTATGAACAATATAAGATTTTGACTTCTTCCTTTTTCTTTAACATTATTATTAACAAGAGGAATAGTAGAAAGTGGAGTAGGAACTGGATGAACTGTCTACCCTCCACTCTCAGCAGCAATTGCTCACGCAGGTGCTTCCGTTGACTTAGGAATTTTCTCGCTTCATCTGGCTGGGGTCTCATCTATTTTGGGTGCAGTAAATTTTATGACAACTGCCATTAATATACGAAGAAAAGGTATAACAATAGACCGAATACCCTTATTTGTGTGATCAGTATTTATTACAGCAGTTCTTTTACTACTCTCGCTTCCTGTTTTAGCAGGAGCTATTACTATACTCTTAACAGATCGAAATTTAAATACTTCATTCTTCGATCCAGCTGGAGGTGGAGACCCAGTTCTTTACCAACATTTATTCTGGTTTTTTGGACATCCTGAAGTTTACATTCTTATTCTTCCTGCTTTTGGTATAATCTCCCACATTGTAACACAAGAATCCGGGAAAAAAGAAGCCTTTGGAACTCTAGGAATAATTTATGCTATGATAGCAATTGGAATTCTTGGCTTCGTTGTTTGAGCACACCACATATTTACTGTAGGAATGGATGTAGACACTCGAGCTTATTTTACTTCTGCAACAATAATTATTGCAGTTCCTACAGGAATTAAAATTTTTAGATGATTAGGCACCCTTCAAGGTACCCAAATCAATTACAGTCCATCACTTCTCTGAGCTCTTGGTTTTATTTTTCTCTTTACAGTTGGTGGTCTTACAGGAGTAGTTCTTGCTAATTCATCTATTGATATTATTCTTCATGACACATATTATGTTGTTGCTCACTTTCATTACGTTCTATCTATAGGTGCAGTTTTTGGCATCTTTGCAGGAATTGCTCACTGATTCCCTCTATTTACGGGCTTATCTATAAATCCTAAATGATCAAAAATTCACTTTTTAACTATATTTACAGGAGTAAATATCACTTTCTTCCCACAACATTTCTTAGGATTAAATGGAATACCACGACGATACTCTGACTATCCTGACGCATTCACCGCATGAAATGTTCTATCTTCAATTGGATCAATAATTTCTCTTGTAGCCGTTCTTAGATTCATCATTATTGTATGAGAGGCTTTAGTAGTTAAACGAACAGTTATATTTTCTTTATTCTTACCTACTTCGATTGAATGACAGCATGCTTATCCCCCAGCTGACCACAGTTATATAGAAATCCCTATAATCACTAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Homarus americanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Wahle, R., Butler, M., Cockcroft, A. & MacDiarmid, A.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, HT, Soulsby, A.-M. & Whitton, F.

Justification
Homarus americanus has been assessed as Least Concern. This species has a broad geographic range and is found in a range of habitat types. There appears to have been no significant overall declines in the population of this species. The slight observed declines appear to be related to warm temperatures, low oxygen and shell disease near shore, in Southern New England. These changes in environmental conditions may be related to climate change.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although this species is not endangered, conservation efforts have been implemented to preserve lobster populations from overfishing. Laws regulate the size of lobsters taken, which increases the number of females reaching sexual maturity and reproducing before being harvested. Other regulations include limiting the number of traps set, limits on lobstering licenses, and times of the year when lobsters are harvested. Another volunteer program implemented is cutting a "V" notch in the tail when a female carrying eggs is trapped. She is returned to the sea and if caught again is not supposed to be harvested since she is a known egg producer.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Due to widespread exploitation of this species, accurate assessments of abundance are hard to produce (Forgarty 1995). This said, it is believed this species’ population has been “relatively robust under exploitation” (Forgarty 1995:132). Causes for this resilience are unknown, although Anthony and Caddy (1980) suggest the “role of refugia of lightly exploited groups that provide a larval subsidy to more heavily exploited groups.” (Fogarty 1995:132).

A more detailed picture of the population dynamics can be ascertained by sectioning the population by fisheries. In the United States of America there are three recognised fisheries: Gulf of Maine, Georges Bank, and Southern New England. These fisheries are managed by the Atlantic States Marine Fisheries Commission (ASMFC), under amendment 3 to the Interstate Fishery Management Plan. Comparatively, the Canadian fishery is managed through a network of 28 inshore Lobster Fishing Areas (LFA) and on offshore LFA (Fisheries Resource Conservation Council 2007).

United States Fisheries

Gulf of Maine Population

The commercial landings of this species have generally shown an upward trend since 1981; from around 15,000 mt to a peak of 36,500 mt in 2004 (Idoine 2006). Abundance indices indicate a large degree of inter-annual variation in both male and female abundance; however there is a general upward trend until 2005 when there is a sharp decline from around 2.0- 2.5 down to 0.5-1.0 (stratified mean number per tow, Idoine 2006). However, the 2006 data shows an increase again to between 1.0-1.5 stratified mean number per tow (Idoine 2006).

Abundance estimates are currently well above the target of 69.62 million lobsters (Idoine 2006). In 2003, the abundance was estimated at around 100 million individuals (Idoine 2006).

Georges Bank Fishery

Between 1982 and 2000, landings in this fishery were relatively stable and fluctuated between 1,000 mt and 1,700 mt. In 2000 they then increased up to a peak of 2,300 mt in 2005.

Abundance indices for males and females have shown similar trends since 1981 with female index increasing from around 0.72 to 1.51 stratified mean number per tow in 2002, and the male index increasing from around 0.62 to 0.98 stratified mean number per tow (Idoine 2006). However, both indices have since declined to around 1.04 and 0.23 (stratified mean number per tow) for females and males respectively in 2006. Abundance of lobsters has also shown considerable fluctuations since 1982 between 6 million and 9.5 million lobsters (Target = 8.61 million, threshold = 7.95 million, Idoine 2006). Since 2001 abundance has been above the target at about 9 million lobsters (Idoine 2006).

Southern New England Fishery

Landings from this fishery started at around 2,500 mt in 1982, and peaked at 10,100 mt in 1997. They have since declined to around their 3,000 mt in 2005, which is around the 1982 level.

Survey indices conducted by Connecticut show a greater number of males than females in the tows, with both peaking at 25 and 12 respectively in 1997. Subsequently there has since been a decline to 1.31 for females and 2.88 for males (stratified mean number per tow, Idoine 2006).

Abundance estimates for this species were low in the 1980s and below the threshold of 22.31 million lobsters, but peaked at 45 million lobsters in 1997 (above the target of 23.9 million lobsters, Idoine 2006). They have subsequently declined again to a record low of 12.3 million in 2003 and are currently estimated at around 14 million (Idoine 2006).

Canadian Fisheries

Gulf of St. Lawrence - LFAs 23, 24, 25, 26a, 26b

Landings in this fishery were at around 8,000 tonnes in the 1950s and peaked in the 1990s at around 18,731 tonnes. There has since been a decline in the landings to ~17,012 tonnes in 2001. Landings per unit area (LPUA) are considered an index of productivity within a given fishing area. From the 1970s through to the 1990s all fishing areas showed an increase in LPUA. There was a decline in landings in 2000; apart from LFA 24, which showed a further increase. Information on fishing effort from each of the separate fishing grounds indicates that fishing effort in all regions has remained relatively constant between 1984 and 2001. Exploitation rates are high in all fishing areas at around 70% (Fisheries and Oceans Canada 2002).

Quebec

Lobster landings is Quebec have shown an upward trend since the 1970s and rose to 3,135 tonnes in 2003. Sixty six percent of these landings came from: Magdalen Island (28.5%), Gaspé Peninsula (3.6%), Anticosti Island, and the North Shore (1.3%). Exploitation rates are high at: 75% in the Magdalen Islands, 85% in the Gaspé Peninsula, and 20% at Anticosti Island.

Magdalen Islands

Catch per Unit Effort (CPUE) data for the Magdalen Islands indicates a peak in 1992 at around 1.1 numbers/trap or 0.55 kg/trap with a subsequent decline. However, CPUE has remained relatively stable since 1994/1995. This trend is said to generally reflect the trend in the southern archipelago.

Gaspé Peninsula

CPUE data for this region shows an increase from around 0.5 numbers/trap in 1988 to ~0.85 numbers/trap in 1996. There has since been a decline to around 0.45 numbers per trap in 2004 which is below the average for 1986-2002.

North Shore

CPUE ranged between 0.2 and 0.4 numbers/ trap between 1993 and 2003; with the lowest value being recorded in 2002. In 2003 it rose again, but is still below the average.

Eastern Cape Breton - LFAs 27-30

Landings of this species have fluctuated greatly over time. They peaked at around 4000 tonnes in 1990 and subsequently declined to between 1,480 tonnes in the late 1990?s. They have since shown an increase in 2001 to 1,987 tonnes. Mean catch rates (expressed as kg per trap haul) have generally remained stable in all fishing areas other than a noted decline in LFA 27 and LFA 30 in 1997, however these have since stabilized (Fisheries and Oceans Canada 2004a).

Eastern Shore Fishery - LFAs 31A, 31B, 32

Landings data shows an upward trend in all areas between 1993 and 2000 with a very slight decline in 2001. The catch rate (expressed as kg/trap haul) has also shown an increase in all areas between 1996 and 2002. There was no overall increase in the median size of individuals in each area and no overall increase in the number of observed berried females despite put-backs (Fisheries and Oceans Canada 2004b).

Nova Scotia - LFA 33

Since 1989 the landings of this species have increased to around 2,753 mt in 2001/2002. Indicators of pre recruit numbers/trap haul showed no overall change or a negative trend between 2000 and 2003. The number of observed berried females however, has increased from 2000. Exploitation levels also declined during the period 1999-2003 (Fisheries and Oceans Canada 2004c).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In the nearshore Southern New England stock there have been prevalence rates of shell disease of about 30%. This threat is localized to warmer water regions.

This is the largest commercial fishery of any lobster fishery in the world (R. Wahle pers. comm. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are a number of management restrictions in place for this species though these vary according to fishing area. Restrictions include: closed fishing seasons and areas, prohibition of removal of berried females, minimum legal size limits, restrictions on gear type and number of fishing vessels, and annual quotas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative consequences for humans by the lobster.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The American Lobster is commercially valuable as food. Its white meat is considered a delicacy. The meat is found in the claws, legs, and its large abdominal muscle commonly called the tail.

Positive Impacts: food

  • Banister, K., A. Campbell. 1985. The Encyclopedia of Aquatic Life. New York City, New York: Facts On File, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American lobster

The American lobster, Homarus americanus, is a species of lobster found on the Atlantic coast of North America, chiefly from Labrador to New Jersey. Within North America, it is also known as the northern lobster or Maine lobster. It can reach a body length of 64 cm (25 in), and a mass of over 20 kilograms (44 lb), making it the heaviest crustacean in the world. Its closest relative is the European lobster Homarus gammarus, which can be distinguished by its coloration and the lack of spines on the underside of the rostrum. American lobsters are usually bluish green to brown with red spines, but a number of color variations have been observed.

Contents

Distribution [edit]

Homarus americanus is distributed along the Atlantic coast of North America, from Labrador in the north to Cape Hatteras, North Carolina in the south.[3] South of New Jersey, the species is uncommon, and landings in Delaware, Maryland, Virginia and North Carolina usually make up less than 0.1% of all landings.[4] A fossil claw assigned to Homarus americanus was found at Nantucket, dating from the Pleistocene.[5][6]

Description [edit]

Profile of the anterior part of an American lobster

Homarus americanus commonly reaches 8–24 inches (200–610 mm) long and weighs 1–9 pounds (0.45–4.1 kg) in weight, but has been known to weigh as much as 44 lb (20 kg), making this the heaviest crustacean in the world.[7] Together with Sagmariasus verreauxi, it is also the longest decapod crustacean in the world;[2] an average adult is about 9 in (230 mm) long and weighs 1.5 to 2 lb (680 to 910 g). The longest American lobsters have a body (excluding claws) 64 cm (25 in) long.[2] According to Guinness World Records, the heaviest crustacean ever recorded was an American lobster caught off Nova Scotia, Canada, weighing 44.4 lb (20.1 kg).[7][8]

The closest relative of H. americanus is the European lobster, Homarus gammarus. The two species are very similar, and can be crossed artificially, although hybrids are unlikely to occur in the wild since their ranges do not overlap.[9] The two species can be distinguished by a number of characteristics:[10]

  • The rostrum of H. americanus bears one or more spines on the underside, which are lacking in H. gammarus.
  • The spines on the claws of H. americanus are red or red-tipped, while those of H. gammarus are white or white-tipped.
  • The underside of the claw of H. americanus is orange or red, while that of H. gammarus is creamy white or very pale red.

Head [edit]

The antennae measure about 2 in (51 mm) long and split into Y-shaped structures with pointed tips. Each tip exhibits a dense zone of hair tufts staggered in a zigzag arrangement. These hairs are covered with multiple nerve cells that can detect odors. Larger, thicker hairs found along the edges control the flow of water, containing odor molecules, to the inner sensory hairs.[11] The shorter antennules provide a further sense of smell. By having a pair of olfactory organs, a lobster can locate the direction a smell comes from, much the same way humans can hear the direction a sound comes from. In addition to sensing smells, the antennules can judge water speed to improve direction finding.

Lobsters have two urinary bladders, located on either side of the head. Lobsters use scents to communicate what and where they are, and those scents are in the urine. They project long plumes of urine 1–2 meters (3 ft 3 in–6 ft 7 in) in front of them, and do so when they detect a rival or a potential mate in the area.[12]

Thorax [edit]

The first pair of pereiopods (legs) is armed with a large, asymmetrical pair of claws.[2] The larger one is the "crusher", and has rounded nodules used for crushing prey; the other is the "cutter", which has sharp inner edges, and is used for holding or tearing the prey.[10]

Coloration [edit]

The normal coloration of Homarus americanus is "dark bluish green to greenish brown", redder on the body and claws, and greener on the legs.[3] This coloration is produced by mixing yellow, blue, and red pigments.[13] Despite the rarity of strangely colored lobsters, many more of them are reported being caught. It is unclear as to whether this is an artifact of social media (i.e. it is easier to report catching a strangely colored lobster), or if it is due to a drop in predator populations.[14]

Color variants

Blue
Yellow

An estimated one in 2 million lobsters are blue.[15] A genetic mutation causes a blue lobster to produce an excessive amount of a particular protein.[16] The protein and a red carotenoid molecule known as astaxanthin combine to form a blue complex known as crustacyanin, giving the lobster its blue color.[17] In 2009 a blue lobster was caught in New Hampshire;[18] in 2011, two blue lobsters were caught in Canada, one off of Prince Edward Island,[19] and another in the Esgenoôpetitj First Nation territory in New Brunswick;[19] another was caught in May 2012 off Nova Scotia.[20]

Yellow lobsters are the result of a rare genetic mutation and the odds of finding one are estimated to be 1 in 30 million.[15][21] Reports of yellow lobsters include one off Whaleback Island (at the mouth of the Kennebec River), Maine, on August 1, 2006,[22] off Prince Edward Island, Canada, on June 11, 2009,[23] one discovered in Wainani Kai Seafoods in Kalihi, Hawaii in a shipment from Nova Scotia on April 30, 2010,[24] in Narragansett Bay off Rhode Island on July 31, 2010.[13]

In July 2010, an albino lobster was reportedly caught in Gloucester.[25] An estimated only one in 100 million lobsters is albino — lacking in colored pigments.[15][25]

On August 28, 2010, a calico lobster with a mottled orange and black shell was reported to have been caught in Maine.[26] Diane Cowan, a lobster scientist and founder of the Lobster Conservancy in Friendship stated only albino lobsters are rarer, and orange lobsters such as these are a 1 in 30 million catch.[15][27]

Several lobsters have been caught with different colorings on their left and right halves.[28] For instance, on July 13, 2006, a Maine fisherman caught a brown and orange lobster, and submitted it to the local oceanarium,[29] which had only seen three lobsters of this kind in 35 years. The chance of finding one is estimated at 1 in 50 million.[15][23] All split-colored lobsters observed by Bob Bayer of the Lobster Institute in Maine have been hermaphroditic.[30]

Red lobsters are the usual result of a lobster being cooked. According to the Gulf of Maine Institute, however, there is a 1 in 10 million chance of catching one alive with that color.[15][31]

Life cycle [edit]

A female lobster carrying eggs on her pleopods. Note the notched tail flipper, second from left, indicating an active breeding female.

The life cycle of H. americanus is well understood.[32] Mating only takes place shortly after the female has molted, and her exoskeleton is still soft.[33] The female releases a pheromone which causes the males to become less aggressive and to begin courtship, which involves a courtship dance with claws closed.[33] Eventually, the male inserts spermatophores (sperm packets) into the female's seminal receptacle using his first pleopods; the female may store the sperm for up to 15 months.[33]

The female releases eggs through her oviducts, and they pass the seminal receptacle and are fertilized by the stored sperm.[33] They are then attached to the female's pleopods (swimmerets) using an adhesive, where they are cared for until they are ready to hatch.[33] The female cleans the eggs regularly, and fans them with water to keep them oxygenated.[34] The large telolecithal[32] eggs may resemble the segments of a raspberry,[33] and a female carrying eggs is said to be "in berry".[33] Since this period lasts 10–11 months, berried females can be found at any time of year.[2] In the waters off New England, the eggs are typically laid in July or August, and hatch the following May or June.[32] The developing embryo passes through several molts within the egg, before hatching as a metanauplius larva. When the eggs hatch, the female releases them by waving her tail in the water, setting batches of larvae free.[34]

The metanauplius of H. americanus is 13 in (8.5 mm) long, transparent, with large eyes and a long spine projecting from its head.[33] It quickly molts, and the next three stages are similar, but larger.[33] These molts take 10–20 days, during which the planktonic larvae are vulnerable to predation; only 1 in 1,000 is thought to survive to the juvenile stage.[33] To reach the fourth stage – the post-larva – the larva undergoes metamorphosis, and subsequently shows a much greater resemblance to the adult lobster,[32] is around 12 in (13 mm) long,[33] and swims with its pleopods.[32]

After the next molt, the lobster sinks to the ocean floor, and adopts a benthic lifestyle.[34] It molts more and more infrequently, from an initial rate of ten times per year to once every few years.[33] After one year, it is around 1–1.5 in (25–38 mm) long, and after six years, it may weigh 1 pound (0.45 kg).[33] By the time it reaches the minimum landing size, an individual may have molted 25–27 times, and thereafter each molt may signal a 40%–50% increase in weight, and a 14% increase in carapace length.[34]

As food [edit]

Global capture production in tonnes by year
Lobster meal

American lobsters are a popular food, with an image of refinement.[35] They are commonly boiled or steamed. Hardshells (lobsters that are several months past their last molt) can survive out of water for up to two days if kept refrigerated. Softshells (lobsters that have only recently molted) do not survive more than a few hours out of water. Lobsters are usually cooked alive,[36] which some people consider inhumane.[37][38]

One common way of serving lobster 'tail' (actually the abdomen) is with beef, known as surf and turf.[39] Lobsters have a greenish or brownish organ called the tomalley that performs the functions of the liver and pancreas in a human, i.e., it filters out toxins from the body.[40] Some diners consider it a delicacy, but others avoid it because they consider it a toxin source or dislike eating innards.

A set of nutcrackers and a long, thin tool for pulling meat from inaccessible areas are suggested as basics, although more experienced diners can eat the animal with their bare hands or a simple tool (a fork, knife or rock). Eating a lobster can get messy, and most restaurants offer a lobster bib.[41] Meat is generally contained in the larger claws and tails, and stays warm quite a while after being served. There is some meat in the legs and in the arms that connect the large claws to the body. There is also some small amount of meat just below the carapace around the thorax and in the smaller legs.

North American lobster industry [edit]

Most lobsters come from the northeastern coast of North America, with the Atlantic Provinces of Canada and the U.S. state of Maine being the largest producers. They are caught primarily using lobster traps, although lobsters are also harvested as bycatch by bottom trawlers, fishermen using gillnets, and by scuba divers in some areas. Maine completely prohibits scuba divers from catching lobsters (violations could result in up to a $1000 fine). Maine also strictly prohibits the landing of lobsters caught by bottom trawlers and other "mobile gear".[42] Massachusetts offers scuba divers lobster licenses for a fee, and they are only available to state residents. Rhode Island also requires divers to acquire a permit.

Lobster traps are rectangular cages made of vinyl-coated galvanized steel mesh or wood, with woven mesh entrances. These are baited and lowered to the sea floor. They allow a lobster to enter, but make it difficult for the larger specimens to turn around and exit. This allows the creatures to be captured alive. The traps, sometimes referred to as "pots", have a buoy floating on the surface, and lobstermen check their traps between one and seven days after setting them. The inefficiency of the trapping system has inadvertently prevented the lobster population from being overfished. Lobsters can easily escape the trap, and will defend the trap against other lobsters because it is a source of food. An estimated 10% of lobsters that encounter a trap enter, and of those that enter only 6% will actually be caught.[43]

In the United States, the lobster industry is regulated. Every lobsterman is required to use a lobster gauge to measure the distance from the lobster's eye socket to the end of its carapace: if the lobster is less than 3.25 inches (83 mm) long, it is too young to be sold and must be released back to the sea. There is also a legal maximum size of 5 in (130 mm) in Maine, meant to ensure the survival of a healthy breeding stock of adult males, but in parts of some states, such as Massachusetts, there is none. Also, traps must contain an escape hole or "vent", which allows juvenile lobsters and bycatch species to escape. The law in Maine and other states dictates a second large escape hole or "ghost panel" must be installed. This hole is held shut through use of biodegradable clips made of ferrous metal. Should the trap become lost, the trap eventually opens, allowing the catch to escape.[44]

To protect known breeding females, lobsters caught carrying eggs are to be notched on a tail flipper (second from the right, if the lobster is right-side up and the tail is fully extended). Following this, the female cannot be kept or sold, and is commonly referred to as a "punch-tail" or as "v-notched". This notch remains for two molts of the lobster exoskeleton, providing harvest protection and continued breeding availability for up to five years.[45]

Canada [edit]

Fishing boats in Yarmouth, Nova Scotia

In the late 1990s and early 21st century, lobster fishing was the cause of troubles between Acadians and Mi'kmaq First Nations in the Canadian Maritimes. The Acadian economy (and identity) relied substantially on fisheries, especially lobster. In 1998, the Supreme Court of Canada ruled in favor of the First Nations and granted them unlimited rights to natural resources, based on an 18th-century treaty. The federal government tried to take licenses and quotas from the traditional fishermen, whose fishing quota had already dropped dramatically in the years before, and give them to the natives. Burnt Church, a reserve between Miramichi and the Acadian town of Neguac, was the hub of these troubles. The tension increased and decreased with each fishing season, reaching its climax in April 2003, when a riot broke in the port of Shippagan, where three native-owned fishing ships and a fish processing plant were burnt down. Since then, efforts have been made to bring Acadians and natives closer together, and the tension has slowly abated.[46]

Management [edit]

American lobster tends to have a stable stock in northern (colder) waters, but gradually decreases in abundance moving southward. To manage lobster populations, more regulations and restrictions, geared towards achieving sustainable populations, are implemented gradually southward.[47]

Ecology [edit]

The American lobster thrives in cold, shallow waters where there are many rocks and other places to hide from predators. It typically lives at a depth of 4–50 m (13–160 ft), but can be found up to 480 m (1,570 ft) below the surface.[2]

Diet [edit]

The natural diet of H. americanus is relatively consistent across different habitats. It is dominated by mollusks (especially mussels), echinoderms and polychaetes, although a wide range of other prey items may be eaten, including other crustaceans, brittle stars and cnidarians.[48]

Diseases [edit]

Gaffkemia or red-tail is an extremely virulent infectious disease of lobsters caused by the bacterium Aerococcus viridans.[49] It only requires a few bacterial cells to cause death of otherwise healthy lobsters. The "red tail" common name refers to a dark orange discoloration of the ventral abdomen of affected lobsters. This is, in fact, the hemolymph or blood seen through the thin ventral arthrodial membranes. The red discoloration comes from astaxanthin, a carotenoid pigment exported to the blood during times of stress. The same sign is also seen in other diseases of lobsters and appears to be a nonspecific stress response, possibly relating to the antioxidant and immunostimulatory properties of the astaxanthin molecule.

Paramoebiasis is an infectious disease of lobsters caused by infection with the sarcomastigophoran (ameba) Neoparamoeba pemaquidensis. This organism also causes amebic gill disease in farmed Atlantic salmon, Salmo salar. Infection occurs throughout the tissues, causing granuloma-like lesions, especially within the ventral nerve cord, the interstices of the hepatopancreas and the antennal gland. Paramoebiasis is strongly suspected to play a prominent role in the rapid die-off of American lobsters in Long Island Sound that occurred in the summer of 1999.[49]

Systemic infections by the bacterium Vibrio fluvialis (or similar organisms) are reported to cause "limp lobster disease", wherein lobsters become lethargic and die.[49][50]

Excretory calcinosis in American lobsters in Long Island Sound was described from an epizootic in 2002. The disease causes mineralized calculi to form in the antennal glands and gills. These cause a loss of surface area around the gills, and the lobster eventually asphyxiates. Several reasons have been proposed for the cause of a recent outbreak of the disease. The most generally attributed factor is an increased duration of warmer temperatures in the bottom of the Long Island Sound.[51][52]

Taxonomy [edit]

The American lobster was first described by Thomas Say in 1817, with a type locality of "Long-branch, part of the coast of New Jersey".[2] The name Say chose, however – "Astacus marinus" – was invalid as a junior homonym of Astacus marinus Fabricius, 1775, which is in turn a junior synonym of Homarus gammarus.[2] The American lobster was given its current scientific name of Homarus americanus by Henri Milne-Edwards in his 1837 work Histoire naturelle des Crustacés ("Natural History of the Crustacea").[2] The common name preferred by the Food and Agriculture Organization is "American lobster", but the species is also known locally as the "northern lobster", "Maine lobster" or simply "lobster".[2]

References [edit]

  1. ^ R. Wahle, M. Butler, A. Cockcroft & A. MacDiarmid (2011). "Homarus americanus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved January 1, 2012. 
  2. ^ a b c d e f g h i j Lipke B. Holthuis (1991). "Homarus americanus". FAO Species Catalogue, Volume 13. Marine Lobsters of the World. FAO Fisheries Synopsis No. 125. Food and Agriculture Organization. p. 58. ISBN 92-5-103027-8. 
  3. ^ a b Gro I. van der Meeren, Josianne Støttrup, Mats Ulmestrand & Jan Atle Knutsen (2006). "Invasive Alien Species Fact Sheet: Homarus americanus" (PDF). Online Database of the North European and Baltic Network on Invasive Alien Species. NOBANIS. Retrieved May 4, 2011. 
  4. ^ Eric M. Thunberg (October 2007). "Demographic and Economic Trends in the Northeastern United States Lobster (Homarus americanus) Fishery, 1970–2005" (PDF). Northeast Fisheries Science Center Reference Document 07-17. National Marine Fisheries Service. Retrieved May 4, 2011. 
  5. ^ J. D. Davis (1967). "Note on a fossil lobster claw from Nantucket Island, Massachusetts". Turtox News 45 (7): 166–167. 
  6. ^ Dale Tshudy (2003). "Clawed lobster (Nephropidae) diversity through time". Journal of Crustacean Biology 23 (1): 178–186. doi:10.1651/0278-0372(2003)023[0178:CLNDTT]2.0.CO;2. JSTOR 1549871. 
  7. ^ a b "Heaviest marine crustacean". Guinness World Records. Archived from the original on May 28, 2006. Retrieved August 3, 2006. 
  8. ^ "Giant lobster landed by boy, 16". BBC News. June 26, 2006. 
  9. ^ Marie Hauge (May 2010). "Unique lobster hybrid". Norwegian Institute of Marine Research. Retrieved September 30, 2010. 
  10. ^ a b T. W. Beard & D. McGregor (2004). "Storage and care of live lobsters" (PDF). Laboratory Leaflet Number 66 (Revised). Lowestoft: Centre for Environment, Fisheries and Aquaculture Science. 
  11. ^ "ScienceNotes2002". University of California, Santa Cruz. Archived from the original on 20 September 2010. Retrieved September 21, 2010. 
  12. ^ Tristram D. Wyatt (2003). "Sex pheromones: finding and choosing mates". Pheromones and Animal Behaviour: Communication by Smell and Taste. Cambridge University Press. pp. 37–73. ISBN 978-0-521-48526-5. 
  13. ^ a b Peter Lord (August 13, 2010). "Yellow lobster caught in bay, one in 30 million". Providence Journal. 
  14. ^ Jennifer Viegas (July 23, 2012). "Mysterious, colorful lobsters being caught". Discovery News. Retrieved July 24, 2012. 
  15. ^ a b c d e f "One In A Million?" (PDF). University of Maine Lobster Institute. Retrieved January 22, 2012. 
  16. ^ "Blue lobster avoids the cooker". China Daily. June 13, 2007. 
  17. ^ Dennis Hoey (May 4, 2005). "Professor finds key to rare lobster color". Maine Today. 
  18. ^ Kelly Burgess (August 24, 2009). "Rare blue lobster caught by New Hampshire fisherman last week". Los Angeles Times. Retrieved August 21, 2010. 
  19. ^ a b Justine Sterling (June 9, 2011). "Blue lobsters found in Canada, not eaten". Houston Chronicle. Retrieved August 29, 2011. 
  20. ^ Jim Kavanagh (June 11, 2012). "A catch straight out of the deep blue sea". CNN. Retrieved July 24, 2012. 
  21. ^ "Yellow lobster 1 in 30 million rarity". USA Today. August 12, 2010. 
  22. ^ "Man finds rare yellow lobster". local6.com. August 2, 2006. 
  23. ^ a b Nandini Jayakrishna (June 11, 2009). "Yellow lobster with a side of intrigue". Boston Globe. 
  24. ^ "Rare yellow lobster appears at Honolulu restaurant". Hawaii News Now. May 1, 2010. 
  25. ^ a b "Albino lobster pulled from sea". WCBV-TV. July 28, 2010. 
  26. ^ "Rare Lobster Caught Off Maine Coast". WMTW. August 28, 2010. 
  27. ^ Associated Press (August 28, 2010). "Rare calico lobster caught in Maine spared". 
  28. ^ Fenner A. Chace, Jr. & George M. Moore (1959). "A bicolored gynandromorph of the lobster, Homarus americanus" (PDF). The Biological Bulletin 116 (2): 226–231. JSTOR 1539207. 
  29. ^ "Rare 1 in 50 million 2-toned lobster caught off the coast of Newport". LiveLeak. Retrieved November 15, 2012. 
  30. ^ "A lobster tale". Plenty Magazine. April 14, 2009. Retrieved September 21, 2010. 
  31. ^ Holly Anderson (August 13, 2010). "They call him Mr. Blu Genes". oysterriverlobsters.com. 
  32. ^ a b c d e S. M. Helluy and B. S. Beltz (1991). "Embryonic development of the American lobster (Homarus americanus): quantitative staging and characterization of an embryonic molt cycle" (PDF). The Biological Bulletin 180 (3): 355–371. JSTOR 1542337. 
  33. ^ a b c d e f g h i j k l m Eleanor Ely (June 3, 1998). "The American Lobster". Rhode Island Sea Grant Fact Sheet. University of Rhode Island. Retrieved May 8, 2011. 
  34. ^ a b c d Jessica McKay (July 2009). "A Guide to Lobstering in Maine". Maine Department of Marine Resources. Retrieved May 8, 2011. 
  35. ^ John S. Burk (2011). "Northern lobster (Homarus americanus)". The Wildlife of New England: A Viewer's Guide. University Press of New England. pp. 265–266. ISBN 978-1-58465-834-4. 
  36. ^ Lulu Grimes (2009). "Seafood". Cook's Book of Everything. Murdoch Books. pp. 180–255. ISBN 978-1-74196-033-4. 
  37. ^ Howard Hillman (2003). "What is the best way to kill a obster?". The New Kitchen Science: a Guide to Know the Hows and Whys for Fun and Success in the Kitchen. Houghton Mifflin Harcourt. pp. 96–97. ISBN 9780618249633. 
  38. ^ Susannah Blake, Craig Robertson, Mari Mererid Williams, Lucy McKelvie & Stella Sargeson (2007). "Preparing lobsters". Good Housekeeping: Step-by-Step Cookbook. Anova Books. p. 85. ISBN 9781843404132. 
  39. ^ "Surf and turf". 1,001 Foods to Die For. Madison Books. 2007. pp. 348–349. ISBN 978-0-7407-7043-2. 
  40. ^ John F. Wickins, Daniel O'C. Lee (2002). "Markets". Crustacean Farming: Ranching and Culture (2nd ed.). John Wiley and Sons. pp. 35–69. ISBN 978-0-632-05464-0. 
  41. ^ Kahrin Deines (July 9, 2008). "Time to put on the lobster bib: Provincetown's restaurants stand at the ready". Provincetown.com. 
  42. ^ Janice M. Plante (February 2007). "Maine to revisit lobsters on draggers ban". Commercial Fisheries News 34 (6). 
  43. ^ "Lobster Trap Video". University of New Hampshire. 
  44. ^ "Noncommercial Lobster/Crab Harvesters". Maine Department of Marine Resources. 
  45. ^ "V-Notching Regulations". Division of Fisheries and Wildlife (Massachusetts). 
  46. ^ Herménégilde Chiasson (director, narrator), Cécile Chevrier (producer) (2002) (in French). Ceux qui Attendent [Those Who Wait] (Documentary). National Film Board of Canada. http://www.onf-nfb.gc.ca/eng/collection/film/?id=51073.
  47. ^ "Atlantic States Marine Fisheries Commission: American Lobster". Retrieved June 30, 2009. 
  48. ^ Robert W. Elner & Alan Campbell (1987). "Natural diets of lobster Homarus americanus from barren ground and macroalgal habitats off southwestern Nova Scotia, Canada" (PDF). Marine Ecology Progress Series 37: 131–140. 
  49. ^ a b c Richard J. Cawthorn (2011). "Diseases of American lobsters (Homarus americanus): a review". Journal of Invertebrate Pathology 106 (1): 71–78. doi:10.1016/j.jip.2010.09.010. PMID 21215356. 
  50. ^ B. D. Tall, S. Fall, M. R. Pereira, M. Ramos-Valle, S. K. Curtis, M. H. Kothary, D. M. Chu, S. R. Monday, L. Kornegay, T. Donkar, D. Prince, R. L. Thunberg, K. A. Shangraw, D. E. Hanes, F. M. Khambaty, K. A. Lampel, J. W. Bier & R. C. Bayer (2003). "Characterization of Vibrio fluvialis-like strains implicated in limp lobster disease". Applied and Environmental Microbiology 69 (12): 7435–7446. doi:10.1128/AEM.69.12.7435-7446.2003. PMC 309894. PMID 14660396. 
  51. ^ A. D. M. Dove (2005). "Ultrastructural features of excretory calcinosis in the lobster, Homarus americanus Milne-Edwards". Journal of Fish Diseases 28 (5): 313–316. doi:10.1111/j.1365-2761.2005.00632.x. PMID 15892758. 
  52. ^ A. D. Dove, C. LoBue, P. Bowser & M. Powell (2004). "Excretory calcinosis: a new fatal disease of wild American lobsters Homarus americanus". Diseases of Aquatic Organisms 58 (2–3): 215–221. PMID 15109145. 

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!