Overview

Distribution

Greenland to Martha's Vineyard, Massachusetts
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 7779 specimens in 2 taxa.
Water temperature and chemistry ranges based on 3185 samples.

Environmental ranges
  Depth range (m): 0 - 958.5
  Temperature range (°C): -0.589 - 12.411
  Nitrate (umol/L): 0.367 - 32.840
  Salinity (PPS): 27.525 - 35.444
  Oxygen (ml/l): 2.565 - 8.583
  Phosphate (umol/l): 0.273 - 2.545
  Silicate (umol/l): 1.599 - 55.958

Graphical representation

Depth range (m): 0 - 958.5

Temperature range (°C): -0.589 - 12.411

Nitrate (umol/L): 0.367 - 32.840

Salinity (PPS): 27.525 - 35.444

Oxygen (ml/l): 2.565 - 8.583

Phosphate (umol/l): 0.273 - 2.545

Silicate (umol/l): 1.599 - 55.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

bathyal, infralittoral and circalittoral of the Gulf and estuary
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7779 specimens in 2 taxa.
Water temperature and chemistry ranges based on 3185 samples.

Environmental ranges
  Depth range (m): 0 - 958.5
  Temperature range (°C): -0.589 - 12.411
  Nitrate (umol/L): 0.367 - 32.840
  Salinity (PPS): 27.525 - 35.444
  Oxygen (ml/l): 2.565 - 8.583
  Phosphate (umol/l): 0.273 - 2.545
  Silicate (umol/l): 1.599 - 55.958

Graphical representation

Depth range (m): 0 - 958.5

Temperature range (°C): -0.589 - 12.411

Nitrate (umol/L): 0.367 - 32.840

Salinity (PPS): 27.525 - 35.444

Oxygen (ml/l): 2.565 - 8.583

Phosphate (umol/l): 0.273 - 2.545

Silicate (umol/l): 1.599 - 55.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandalus borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAGCTTGGTCTGGGATAGTGGGAACTTCCTTAAGACTTTTAATTCGAGCTGAGTTAGGTCAACCAGGTAGGTTGGTTGGAAACGACCAAATTTATAATGTTGTAGTTACAGCCCATGCTTTTGTAATAATTTTTTTTATGGTAATACCAATTATAATTGGGGGCTTCGGAAACTGACTTGTGCCCCTAATATTAGGCGCCCCAGACATGGCCTTCCCCCGAATAAACAACATAAGATTTTGACTTTTACCCCCCTCCCTTACACTCCTTCTCTCCAGTGGAATGGTAGANAGGGGGGTGGGNACTGGTTGGACAGTGTACCCCCCTTTATCAGCNGGGATTGCACATGCCGGGGCCTCAGTGGACCTTGGGATTTTCTCACTCCACCTAGCAGGAGTGTCTTCTATCTTAGGAGCCGTTAATTTTATAACTACAGTTATTAANATACGAAGAAGAGGAATATCTATAGACCGGATGCCTTTGTTTGTTTGATCTGTTTTTTTAACAGCTCTTTTACTACTCCTATCACTACCGGTTCTTGCTGGAGCAATTACAATNTTATTAACAGACCGAAACCTGAATACCTCCTTCTTCGACCCAGCTGGGGGTGGGGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pandalus borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pandalus borealis

Pandalus borealis is a species of caridean shrimp found in cold parts of the Atlantic and Pacific Oceans. The FAO refers to them as the northern prawn.[1] Other common names include pink shrimp, deepwater prawn, deep-sea prawn, great northern prawn, crevette nordique and northern shrimp.[1]

Distribution[edit]

P. borealis lives at depths of 20–1,330 m (66–4,364 ft), usually on soft muddy bottoms,[1] in waters with a temperature of 2–14 °C (36–57 °F). The distribution of the nominate subspecies P. b. borealis in the Atlantic ranges from New England, Canada's eastern seaboard (off Newfoundland and Labrador and eastern Baffin Island in Nunavut), southern and eastern Greenland, Iceland, Svalbard, Norway and the North Sea as far south as the English Channel. In the Pacific, P. b. eous is found from Japan, through the Sea of Okhotsk, across the Bering Strait, and as far south in North America as Washington state.

Physiology[edit]

In their 8-year lifespan,[2] males can reach a length of 120 mm (4.7 in), while females can reach 165 mm (6.5 in) long.[1]

The shrimp are hermaphroditic. They start out male, but after a year or two, their testicles turn to ovaries and they complete their lives as females.[2]

Commercial fishing[edit]

Global capture of Pandalus borealis in tonnes reported by the FAO, 1950–2010 [3]
Hauled aboard a shrimp boat

P. borealis is an important food resource, and has been widely fished since the early 1900s in Norway, and later in other countries following Johan Hjort's practical discoveries of how to locate them. In Canada, these shrimp are sold peeled, cooked and frozen in bags in supermarkets, and are consumed as appetizers.

Northern shrimp have a short life, which contributes to a variable stock on a yearly basis. However, the species is not considered overfished due to a large amount reported and a large amount harvested.

In Canada, the annual harvest limit is set to 164,000 tonnes (2008).[2] The Canadian fishery began in the 1980s and expanded in 1990s.

In 2013 the Atlantic States Marine Fisheries Commission determined that stocks of P. borealis were too low and shut down the New England fishery. This was the first cancellation in 35 years.[4]

Uses[edit]

Beyond human consumption, shrimp alkaline phosphatase (SAP), an enzyme used in molecular biology, is obtained from Pandalus borealis, and the species' carapace is a source of chitosan, a versatile chemical used for such different applications as treating bleeding wounds, filtering wine or improving the soil in organic farming.

References[edit]

  1. ^ a b c d "Pandalus borealis (Krøyer, 1838)". Species Fact Sheet. Food and Agriculture Organization. Retrieved November 2, 2010. 
  2. ^ a b c "Guide to Responsible Sourcing Guide. Cold-water prawns". Seafish. April 2007. Retrieved November 2, 2010. 
  3. ^ Based on data sourced from the FishStat database, FAO.
  4. ^ Porter, Tom (7 December 2013). "Fishery Closure Puts New England's Shrimp Season On Ice". National Public Radio. Retrieved 10 December 2013. 

External links[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!