Overview

Distribution

Greenland to Martha's Vineyard, Massachusetts
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7779 specimens in 2 taxa.
Water temperature and chemistry ranges based on 3185 samples.

Environmental ranges
  Depth range (m): 0 - 958.5
  Temperature range (°C): -0.589 - 12.411
  Nitrate (umol/L): 0.367 - 32.840
  Salinity (PPS): 27.525 - 35.444
  Oxygen (ml/l): 2.565 - 8.583
  Phosphate (umol/l): 0.273 - 2.545
  Silicate (umol/l): 1.599 - 55.958

Graphical representation

Depth range (m): 0 - 958.5

Temperature range (°C): -0.589 - 12.411

Nitrate (umol/L): 0.367 - 32.840

Salinity (PPS): 27.525 - 35.444

Oxygen (ml/l): 2.565 - 8.583

Phosphate (umol/l): 0.273 - 2.545

Silicate (umol/l): 1.599 - 55.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

DMS in the odor landscape of the sea

Dimethyl Sulfide or DMS is present throughout the ocean(1). It’s an important odor component of many fish and shellfish, including clams, mussels, oysters, scallops, crabs and shrimp(2-9). Where does it come from? Usually from the marine plants they feed on.

Many species of plants and algae produce DMS, but not all species produce significant amounts of it. Nearly all of these are marine, and they tend to be in closely related groups with other DMS-producers, including Chlorophyte (green) seaweeds, the Dinophyceae in the dinoflagellates, and some members of the Chrysophyceae and the Bacillariophyceae (two classes of diatoms). Other large groups, like cyanobacteria and freshwater algae, tend not to produce DMS. (10,11)

Why do these groups produce DMS? In algae, most researchers believe a related chemical, DMSP, is used by the algae for osmoregulation- by ensuring the ion concentration inside their cells stays fairly close to the salinity in the seawater outside, they prevent osmotic shock. Otherwise, after a sudden exposure to fresh water (rain at the sea surface, for instance) cells could swell up and explode. In vascular plants, like marsh grasses and sugar cane, it’s not clear what DMS is used for. (12,13)

Freshly harvested shellfish can smell like DMS because DMSP has accumulated in their tissue from the algae in their diet. Some animals, including giant Tridacna clams and the intertidal flatworm Convoluta roscoffensis, harbor symbiotic algae in their tissues, which produce DMSP; this may not be important to their symbioses, but for Tridacna, the high DMS levels can be a problem for marketing the clams to human consumers. After death, DMSP begins to break down into DMS. A little DMS creates a pleasant flavor, but high concentrations offend the human palate.(2,14)

Not all grazers retain DMS in their tissues, though. At sea, DMS is released when zooplankton feed on algae. It’s been shown in the marine copepods Labidocera aestiva and Centropages hamatus feeding on the dinoflagellate Gymnodinium nelson that nearly all the DMS in the consumed algae is quickly released during feeding and digestion.(15) This has a disadvantage for the grazing zooplankton. Marine predators, like procellariiform seabirds, harbor seals, penguins, whale sharks, cod, and coral reef fishes like brown chromis, Creole wrasse and boga, can use the smell of DMS to locate zooplankton to feed on. (8,16,17)

It’s not easy to measure how much DMS is released from the Ocean into the air every year. Recent estimates suggest 13-37 Teragrams, or 1.3-3.7 billion kilograms. This accounts for about half the natural transport of Sulfur into the atmosphere, is the conveyor belt by which Sulfur cycles from the ocean back to land. In the atmosphere, DMS is oxidized into several compounds that serve as Cloud Condensation Nuclei (CCN). The presence of CCN in the air determines when and where clouds form, which affects not only the Water cycle, but the reflection of sunlight away from the Earth. This is why climate scientists believe DMS plays an important role in regulating the Earth’s climate. (12,18)

  • 1) BATES, T. S., J. D. Cline, R. H. Gammon, and S. R. Kelly-Hansen. 1987. Regional and seasonal variations in the flux of oceanic dimethylsulfide to the atmosphere. J. Geophys. Res.92: 2930- 2938
  • 2) Hill, RW, Dacey, JW and A Edward. 2000. Dimethylsulfoniopropionate in giant clams (Tridacnidae). The Biological Bulletin, 199(2):108-115
  • 3) Brooke, R.O., Mendelsohn, J.M., King, F.J. 1968. Significance of Dimethyl Sulfide to the Odor of Soft-Shell Clams. Journal of the Fisheries Research Board of Canada, 25:(11) 2453-2460
  • 4) Linder, M., Ackman, R.G. 2002. Volatile Compounds Recovered by Solid-Phase Microextraction from Fresh Adductor Muscle and Total Lipids of Sea Scallop (Placopecten magellanicus) from Georges Bank (Nova Scotia). Journal of Food Science, 67(6): 2032–2037
  • 5) Le Guen, S., Prost, C., Demaimay, M. 2000. Critical Comparison of Three Olfactometric Methods for the Identification of the Most Potent Odorants in Cooked Mussels (Mytilus edulis). J. Agric. Food Chem., 48(4): 1307–1314
  • 6) Piveteau, F., Le Guen, S., Gandemer, G., Baud, J.P., Prost, C., Demaimay, M. 2000. Aroma of Fresh Oysters Crassostrea gigas: Composition and Aroma Notes. J. Agric. Food Chem., 48(10): 4851–4857
  • 7) Tanchotikul, U., Hsieh, T.C.Y. 2006. Analysis of Volatile Flavor Components in Steamed Rangia Clam by Dynamic Headspace Sampling and Simultaneous Distillation and Extraction. Journal of Food Science, 56(2): 327–331
  • 8) Ellingsen, O.F., Doving, K.B. 1986. Chemical fractionation of shrimp extracts inducing bottom food search behavior in cod (Gadus morhua L.). J. Chem. Ecol., 12(1): 155-168
  • 9) Sarnoski, P.J., O’Keefe, S.F., Jahncke, M.L., Mallikarjunan, P., Flick, G. 2010. Analysis of crab meat volatiles as possible spoilage indicators for blue crab (Callinectes sapidus) meat by gas chromatography–mass spectrometry. Food Chemistry, 122(3):930–935
  • 10) Malin, G., Kirst, G.O. 1997. Algal Production of Dimethyl Sulfide and its Atmospheric Role. J. Phycol., 33:889-896
  • 11) Keller, M.D., Bellows, W.K., Guillard, R.L. 1989. Dimethyl Sulfide Production in Marine Phytoplankton. Biogenic Sulfur in the Environment. Chapter 11, pp 167–182. ACS Symposium Series, Vol. 393. ISBN13: 9780841216129eISBN: 9780841212442.
  • 12) Yoch, D.C. 2002. Dimethylsulfoniopropionate: Its Sources, Role in the Marine Food Web, and Biological Degradation to Dimethylsulfide. Appl Environ Microbiol., 68(12):5804–5815.
  • 13) Otte ML, Wilson G, Morris JT, Moran BM. 2004. Dimethylsulphoniopropionate (DMSP) and related compounds in higher plants. J Exp Bot., 55(404):1919-25
  • 14) Van Bergeijk, S.A., Stal, L.J. 2001. Dimethylsulfonopropionate and dimethylsulfide in the marine flatworm Convoluta roscoffensis and its algal symbiont. Marine Biology, 138:209-216
  • 15) Dacey , J.W.H. and Stuart G. Wakeham. 1986. Oceanic Dimethylsulfide: Production during Zooplankton Grazing on Phytoplankton. Science, 233( 4770):1314-1316
  • 16) Nevitt, G. A., Veit, R. R. & Kareiva, P. (1995) Dimethyl Sulphide as a Foraging Cue for Antarctic Procellariiform Seabirds. Nature 376, 680-682.
  • 17) Debose, J.L., Lema, S.C., & Nevitt, G.A. (2008). Dimethylsulfionoproprianate as a foraging cue for reef fishes. Science, 319, 1356.
  • 18) Charlson, R.J., Lovelock, J.E., Andraea, M.O., Warren, S.G. 1987. Oceanic phytoplankton, atmospheric sulphur, cloud albedo and climate. Nature, 326:655-661
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pandalus borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Pandalus borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAGCTTGGTCTGGGATAGTGGGAACTTCCTTAAGACTTTTAATTCGAGCTGAGTTAGGTCAACCAGGTAGGTTGGTTGGAAACGACCAAATTTATAATGTTGTAGTTACAGCCCATGCTTTTGTAATAATTTTTTTTATGGTAATACCAATTATAATTGGGGGCTTCGGAAACTGACTTGTGCCCCTAATATTAGGCGCCCCAGACATGGCCTTCCCCCGAATAAACAACATAAGATTTTGACTTTTACCCCCCTCCCTTACACTCCTTCTCTCCAGTGGAATGGTAGANAGGGGGGTGGGNACTGGTTGGACAGTGTACCCCCCTTTATCAGCNGGGATTGCACATGCCGGGGCCTCAGTGGACCTTGGGATTTTCTCACTCCACCTAGCAGGAGTGTCTTCTATCTTAGGAGCCGTTAATTTTATAACTACAGTTATTAANATACGAAGAAGAGGAATATCTATAGACCGGATGCCTTTGTTTGTTTGATCTGTTTTTTTAACAGCTCTTTTACTACTCCTATCACTACCGGTTCTTGCTGGAGCAATTACAATNTTATTAACAGACCGAAACCTGAATACCTCCTTCTTCGACCCAGCTGGGGGTGGGGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pandalus borealis

Pandalus borealis is a species of caridean shrimp found in cold parts of the Atlantic and Pacific Oceans. The FAO refers to them as the northern prawn.[1] Other common names include pink shrimp, deepwater prawn, deep-sea prawn, great northern prawn, crevette nordique and northern shrimp.[1]

Distribution[edit]

P. borealis lives at depths of 20–1,330 m (66–4,364 ft), usually on soft muddy bottoms,[1] in waters with a temperature of 2–14 °C (36–57 °F). The distribution of the nominate subspecies P. b. borealis in the Atlantic ranges from New England, Canada's eastern seaboard (off Newfoundland and Labrador and eastern Baffin Island in Nunavut), southern and eastern Greenland, Iceland, Svalbard, Norway and the North Sea as far south as the English Channel. In the Pacific, P. b. eous is found from Japan, through the Sea of Okhotsk, across the Bering Strait, and as far south in North America as Washington state.

Physiology[edit]

In their 8 year lifespan,[2] males can reach a length of 120 mm (4.7 in), while females can reach 165 mm (6.5 in) long.[1]

The shrimp are hermaphroditic. They start out male, but after a year or two, their testicles turn to ovaries and they complete their lives as females.[2]

Commercial fishing[edit]

Global capture of Pandalus borealis in tonnes reported by the FAO, 1950–2010 [3]
Hauled aboard a shrimp boat

P. borealis is an important food resource, and has been widely fished since the early 1900s in Norway, and later in other countries following Johan Hjort's practical discoveries of how to locate them. In Canada, these shrimp are sold peeled, cooked and frozen in bags in supermarkets, and are consumed as appetizers.

Northern shrimp have a short life, which contributes to a variable stock on a yearly basis. However, the species is not considered overfished due to a large amount reported and a large amount harvested.

In Canada, the annual harvest limit is set to 164,000 tonnes (2008).[2] The Canadian fishery began in the 1980s and expanded in 1990s.

In 2013 the Atlantic States Marine Fisheries Commission determined that stocks of P. borealis were too low and shut down the New England fishery. This was the first cancellation in 35 years.[4]

Uses[edit]

Beyond human consumption, shrimp alkaline phosphatase (SAP), an enzyme used in molecular biology, is obtained from Pandalus borealis, and the species' carapace is a source of chitosan, a versatile chemical used for such different applications as treating bleeding wounds, filtering wine or improving the soil in organic farming.

References[edit]

  1. ^ a b c d "Pandalus borealis (Krøyer, 1838)". Species Fact Sheet. Food and Agriculture Organization. Retrieved November 2, 2010. 
  2. ^ a b c "Guide to Responsible Sourcing Guide. Cold-water prawns". Seafish. April 2007. Retrieved November 2, 2010. 
  3. ^ Based on data sourced from the FishStat database, FAO.
  4. ^ Porter, Tom (7 December 2013). "Fishery Closure Puts New England's Shrimp Season On Ice". National Public Radio. Retrieved 10 December 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!