Overview

Comprehensive Description

Biology/Natural History: Diet is largely small crustaceans. Pandalids capture their prey by trapping it among their legs. Predators include dogfish, Pacific cod, hake, and turbot. Parasites include the isopod Bopyroides hippolytes and the rhizocephalan barnacle Sylon hippolytes. This species is a protandric hermaphrodite. Larvae hatch in March and April and remain pelagic for 6 instars before settling to the bottom. Become sexually mature at about 18 months at a carapace length of 1.6 cm. At that time there is about a 50/50 ratio of males to females (if few females are present in the population, more males turn to females sooner). Breed in mid-November. Females carry eggs through the winter (average about 1600-2100 eggs). In their second spring most males turn into females. By 30 months all individuals are females and average just over 2 cm carapace length. Live about 3-4 years. Has been an important commercially harvested shrimp in British Columbia and Alaska.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As with other pandalids, the pereopods have no exopodites. The first pereopod is not chelate. The carpus of pereopod 2 is subdivided into many (more than 7) units (multiarticulated) (photo). The rostrum is prominent and has movable dorsal spines. Pandalus borealis has a first antenna only slightly longer than the carapace (characteristic of genus Pandalus). The rostrum arches near the eyes, the distal end curves upward, and the tip is bifid. Dorsal spines are found all along the rostrum, including on the distal half. All but the most distal dorsal rostral spines are movable. The body is slender and compressed. Abdominal segment 3 has a median dorsal ridge with a spine definitely anterior to the posterior margin of the segment and another spine at the posterior margin (photo). Abdominal segment 4 also has a mid-dorsal spine on the posterior margin (photo). The telson is narrow, tapers to a blunt tip, and has 6-10 pairs of dorsolateral spines (photo). The uropods are usually slightly shorter than the telson. The color is a translucent pinkish hue with darker regions largely caused by numerous fine red dots over the entire body. The red dots are especially concentrated on the dorsal surface and ventral margin of the carapace, the distal part of the rostrum, and the dorsal abdomen especially on segments 3-6. Total length: Males to 12 cm, females to 15 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: In the Pacific, from the Sea of Japan and Korea to the Columbia River. The very similar species, P. borealis, is found In the Atlantic from Maine to Scandinavia and around Greenland

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Pandalus jordani has similar coloration and morphology but has at most a rounded posterodorsal margin on abdominal segment 3 (but no posterodorsal spine) and no posterodorsal spine on segment 4. Most other pandalids such as P. danae do not have dorsal spines that continue out onto the distal half of the rostrum, plus have more striped coloration. P. platyceros has dorsal spines on the distal half of the rostrum but has white stripes on the carapace and white spots on the abdomen.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 140 - 199

Graphical representation

Depth range (m): 140 - 199
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Subtidal. 16-1380 m depth. Common in this area from 50-90 m depths

Habitat: Soft bottoms (may migrate upward at night)

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pandalus eous

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTGCATGAGCTGGGATAGTAGGTACTTCACTAAGGTTAATTATTCGAGCTGAATTAGGCCAACCAGGAAGACTTATTGGAGAT---GATCAAATTTACAATGTGGTAGTTACAGCACATGCTTTTGTTATAATTTTTTTTATAGTAATGCCTATCATAATTGGTGGGTTTGGTAATTGACTAGTACCTCTTATATTAGGAGCACCAGATATGGCTTTCCCTCGGATAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACTCTTTTACTAGGGAGTGGACTTGTAGAAAGAGGTGTTGGTACAGGATGAACAGTCTACCCACCCTTATCAGCTGGTATTGCACATGCTGGAGCCTCTGTTGATATAGGAATTTTTTCTTTACATATTGCTGGAGCTTCATCTATTTTAGGAGCAGTAAATTTTATTACTACTGTAATTAATATACGATCTGCAGGAATAACAATAGACCGAATTCCTTTATTTGTATGGTCAGTATTTATTACAGCTATTTTACTTTTATTATCTTTACCGGTTCTAGCAGGAGCTATTACTATACTTTTAACAGACCGTAATTTAAATACCTCTTTTTTTGATCCTGCCGGAGGAGGAGATCCTATTTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pandalus eous

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!