Overview

Distribution

Distribution includes South Africa & Indo-Pacific <91>. Widely distributed in the Atlantic and Indo-West Pacific Oceans <276>.
  • Crosnier, A., 1987b. Oplophoridae (Crustacea Decapoda) récoltés de 1971 à 1982 par les navires françaises dans l’océan Indien occidental sud.— Bulletin du Muséum national d’Histoire naturelle (4) section A, Zoologie, Biologie et Écologie animales 9: 695-726.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Labrador Basin to Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 719 specimens in 1 taxon.
Water temperature and chemistry ranges based on 679 samples.

Environmental ranges
  Depth range (m): 0 - 5500
  Temperature range (°C): 0.494 - 27.179
  Nitrate (umol/L): 0.051 - 38.589
  Salinity (PPS): 34.209 - 37.328
  Oxygen (ml/l): 0.764 - 6.238
  Phosphate (umol/l): 0.023 - 2.864
  Silicate (umol/l): 0.638 - 137.175

Graphical representation

Depth range (m): 0 - 5500

Temperature range (°C): 0.494 - 27.179

Nitrate (umol/L): 0.051 - 38.589

Salinity (PPS): 34.209 - 37.328

Oxygen (ml/l): 0.764 - 6.238

Phosphate (umol/l): 0.023 - 2.864

Silicate (umol/l): 0.638 - 137.175
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Systellaspis debilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTGTATTTTGTATTGGGGACATGGTCCGGTATAGTTGGAACTTCTCTTAGTTTATTAATTCGGGCTGAGCTAGGTCAACCTGGAAGATTAATCGGTAATGATCAAATTTACAATGTTATTGTAACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTTATACCTATCATGATCGGAGGGTTTGGAAATTGGCTTCTTCCTTTAATATTGGGGGCTCCAGATATGGCATTTCCTCGTATAAATAATATGAGATTTTGGCTCTTACCTCCGTCTTTAACTCTTCTTTTGTCTAGAGGTTTAGTGGAGAGTGGAATTGGGACAGGGTGGACAGTGTATCCTCCGTTAGCTGGGGGTATTGCTCATGCTGGGGCTTCGGTAGATATGGGAATTTTTTCTCTTCATTTAGCCGGGGTTTCCTCAATTTTGGGGGCTGTTAATTTTATTACAACTGTTATTAACATGCGGAGGACGGGGATGGCTATAGACCGAATTCCTTTGTTTGTTTGATCTATTTTTTTAACTACTATTCTTCTTCTGCTTTCTTTGCCTGTGCTAGCGGGGGCAATTACTATGCTTCTCACAGACCGAAATTTAAATACTTCTTTTTTTGACCCGATTGGGGGTGGAGATCCTATTTTATAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Systellaspis debilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!