Overview

Distribution

Range Description

This species is found around southern Africa, from Cape Cross in Namibia to Algoa Bay in Cape Province, South Africa (Holthuis 1991). The bulk of the population is found from Cape Point to Luderitz in Namibia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found at a depth range of 5-200 m on rocky bottoms. They are typically found in deep crevices (Pollock 1979). It's diet includes a mix of mussels, barnacles, small molluscs and crustaceans (Barkai and Branch 1988).

Female age at maturity is estimated at five years (Pollock 1986). Longevity is approximately 30-40 years (A.C. Cockcroft pers. comm. 2009).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 372 specimens in 1 taxon.
Water temperature and chemistry ranges based on 146 samples.

Environmental ranges
  Depth range (m): 30 - 480
  Temperature range (°C): 8.781 - 13.737
  Nitrate (umol/L): 11.515 - 20.821
  Salinity (PPS): 34.635 - 35.143
  Oxygen (ml/l): 3.323 - 4.972
  Phosphate (umol/l): 1.091 - 1.746
  Silicate (umol/l): 10.734 - 17.735

Graphical representation

Depth range (m): 30 - 480

Temperature range (°C): 8.781 - 13.737

Nitrate (umol/L): 11.515 - 20.821

Salinity (PPS): 34.635 - 35.143

Oxygen (ml/l): 3.323 - 4.972

Phosphate (umol/l): 1.091 - 1.746

Silicate (umol/l): 10.734 - 17.735
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Jasus lalandii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTATAGTCGGGACTCCTTTAAGTCTCATTATTCGTGCTGAATTGGGACAACCAGGCAGGCTAATCGGAGAC---GATCAAATTTACAACGTAGTAGTAACTGCCCACGCATTTGTAATAATTTTTTTTATGGTAATGCCAATTATAATTGGGGGGTTTGGAAACTGATTAGTACCTCTAATATTGGGGGCCCCANACATGGCCTTTCCTCGTATAAACAACATAAGATTTTGACTTTTACCCCCTTCTCTAACACTTTTGCTAACTAGTGGTATAGTAAAAAGANGCGTGGGGACAGGTTGAACAGTATACCCTCCCCTANCANCAGCCGTNNCGCACGCCGGAGCCTCAGTAAATCTTGGGATTTTCTCACTTCACTTAGCTGGTGTTTCTTCTATTTTAGGGGCTGTGAATTTCATAACCACAGTTATTAACATGCGGTCTTCAGGAATAACTATAGACCGCATACCTTTATTTGTTTGGTCCGTATTCATCACAGCTATCTTGCTACTTTTATCTCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Jasus lalandii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Cockcroft, A., Butler, M., MacDiarmid, A. & Wahle, R.

Reviewer/s
Collen, B., Livingstone, S. & Richman, N.

Contributor/s
Batchelor, A., De Silva, R., Dyer, E., Kasthala, G., Lutz, M.L., McGuinness, S., Milligan, H.T., Soulsby, A.-M. & Whitton, F.

Justification

Jasus lalandii has been assessed as Least Concern. Although there have been population declines in the past, it is predicted due to continuing fisheries management that this species' population is stable. Fluctuations are driven by recruitment rates, and for this species, fisheries are managed according to estimated yield. This is still an abundant and common species, and its distribution overlaps with marine protected areas where dense populations are found with full size range. Despite being listed as Least Concern, this species is susceptible to environmental effects on settlement and growth making well-managed fisheries essential.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no specific population data for this species, however, it is considered common and abundant and is of significant commercial importance, being harvested as a food source using lobster pots and hoop nets (Holthuis 1991).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Over-exploitation was a previous threat which caused 60-70 % declines in the past. However, the fisheries are now well managed, in an attempt to increase the biomass (reference?).

Environmental fluctuations is another possible threat resulting in decreased settlement of post-larvae and pre-recruit growth (reference?).

Another threat is sperm limited fertilisation due to the skewed sex ratio in the fished population (reference?).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In South Africa there are a number of fishery management measures including a closed season from 1st June to 15th November; minimum size limit of 75 mm (CL) for commercial fishermen and 80 mm (CL) for recreational fishermen; prohibition of retaining berried females; inspection of landings; recreational bag limits; Total Allowable Catch; restricted fishing zones. Total Allowable Catch (TAC) limits steadily declined in response to declining stock (FAO 2001), but the TAC have now stabilised. Additionally its distribution overlaps with marine protected areas where dense populations are found with full size range (reference?).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Jasus lalandii

Jasus lalandii (also called the Cape rock lobster or West Coast rock lobster) is a species of spiny lobster found off the coast of Southern Africa. It is not known whom the specific epithet lalandii commemorates, although it may be the French astronomer Jérôme Lalande.[2]

Distribution[edit source | edit]

J. lalandii occurs in shallow waters from Cape Cross, Namibia to Algoa Bay, South Africa, straddling the Cape of Good Hope. It may be found as deep as 46 metres (150 ft) and is usually found on rocky bottoms.[3]

Description[edit source | edit]

Orange to red-brown, with long antennae extending from the front of the head. Tail fan orange, blue and green. Thorax spiny. Eyes black and stalked.[4]

Ecology[edit source | edit]

Generally found on rocky reefs, where it prefers the shelter of crevices. Often seen in groups with antennae protruding from the shelter. Swims backwards in emergencies using the tail., but generally crawls around on the reef. Feeds on mussels, urchins and barnacles, but also a scavenger. Predators include seals, sharks and large fish. Susceptible to low oxygen levels in the water which may cause mass strandings.[4]

Fishery[edit source | edit]

J. lalandii may grow up to a total length of 46 centimetres (18 in), with a carapace length of 18 cm (7.1 in). It is widely caught for its meat, with over 6,500 t being caught annually in lobster pots and hoop nets.[3] In order to prevent overfishing, individual fishing quotas are allocated by the Republic of South Africa to fishermen and companies, totalling 1,700 t.[5] There is also a closed season from 1 June to 15 November, a size limit of 80 mm (carapace length) and a ban on catching ovigerous females (females which are brooding their eggs).[6]

See also[edit source | edit]

References[edit source | edit]

  1. ^ A. Cockcroft, M. Butler, A. MacDiarmid & R. Wahle (2009). "Jasus lalandii". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. Retrieved August 22, 2011. 
  2. ^ Hans G. Hanssen. "Biographical Etymology of Marine Organism Names". Tjärnö Marine Biological Laboratory, Göteborg University & Stockholm University. Retrieved August 22, 2007. 
  3. ^ a b Lipke Holthuis (1991). "Jasus lalandii (Cape rock lobster)". Marine Lobsters of the World. Food and Agriculture Organization. pp. 99–100. ISBN 92-5-103027-8. 
  4. ^ a b Jones, Georgina. A field guide to the marine animals of the Cape Peninsula. SURG, Cape Town, 2008. ISBN 978-0-620-41639-9
  5. ^ "Information on fisheries management in the Republic of South Africa". Food and Agriculture Organization. Retrieved August 22, 2007. 
  6. ^ "Regulations for fishing of West Coast rock lobster (Jasus lalandii)". South African Department of Environmental Affairs and Tourism. Retrieved August 22, 2007. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!