Overview

Comprehensive Description

Biology/Natural History: Predators include sand and kelp bass and sculpin (on juveniles) and seabirds such as gulls and pigeon guillemots. Prey include barnacles and smaller crabs, amphipods, sea cucumbers, polychaetes, many other intertidal invertebrates, as well as dead fish. At least 42 prey species have been noted. Are an important threat to commercial oyster beds. Crabs raised on thick-shelled species such as Mytilus californianus developed even stronger claws. Mating occurs in summer after a female has molted. Males will often guard a female who is preparing to molt, by holding her under his abdomen. This may last for several weeks until she molts. He then guards her until her exoskeleton hardens again. Gravid females may be found from October to June. Females may carry from 172,000 to 597,000 eggs on the pleopods of the abdomen. Males overwinter in shallow areas, while females seem to overwinter in deeper water. Red rock crabs cannot osmoregulate and so are not found in areas of low salinity. Near Vancouver Island, adults have more epibionts than do juveniles (McGraw, 2006). Common epibionts include barnacles (especially Balanus crenatus) on the dorsal surface, green, red, and brown algae (especially on the antennae), tube-dwelling polychaetes (mainly on the ventral surfaces), hydrozoans (mainly on ventral surfaces and limbs), bryozoans (especially Membranipora membranacea) on any region of the carapace. A few have sponge, tunicate, or mollusk epibionts.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This cancer crab has a dark tip to the dactyl of the chela (photo). The carapace is much wider than it is long, and its dorsal surface is nearly smooth and not covered with large bumps or tubercles. The propodus of the chela usually has several tubercles (photo). The widest point of the carapace is at the 8th (next to the last) lateral tooth (photo). Dorsal carapace is usually brick red, and up to 20 cm wide in males and 17 cm in females. The series of five points between the eyes are nearly equal in size and extend slightly farther out than does that of most cancer crabs, leading to the productus in the name. The dactyls of the walking legs have short setae. The carapace color pattern of juveniles is very different from that of adults (photo), often white or with red and white stripes.
  • Wicksten,Mary K., 2009. ; Decapod Crustacea of the Californian and OregonianZoogeographic Provinces. ; UC San Diego Scripps Institution of OceanographyLibrary, Scripps Institution of Oceanography. ; http://escholarship.org/uc/item/7sk92dz ;418 pages. ; Published online only. ; This excellent key coversdecapods (crustaceans such as crabs, shrimp, spiny lobsters, hermit crabs,and crayfish) from shallow and deep water from Puget Sound south to thePacific coast of Baja California. ; Includes many subkeys, drawings,and photos. ; No glossary, table of contents, or index. ; Thisis the place to go for the most up-to-date key for decapods. ; MaryWicksten plans to publish an updated version of this key soon.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Wicksten+2009 External link.
  • Jensen, Gregory C., 1995. ;Pacific Coast Crabs and Shrimps. ; Sea Challengers, Monterey, CA. ;87 pp. ; ISBN 0-930118-20-0. ; This paperback contains excellentpictures and brief descriptions of many crabs and shrimp from along thePacific coast. ; Sections are arranged by animal group. ; Includesa short glossary.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Jensen+1995 External link.
  • Hart, Josephine F.L., 1982. ;Crabs and their relatives of British Columbia. ; British Columbia ProvincialMuseum Handbook 40. ; Paperback. ; 267 pages. ; This smallpaperback contains keys and individual descriptions and drawings of 95species of true crabs, hermit crabs, other anomurans, mud and ghost shrimp(but not shrimp or prawns) found off British Columbia. ; An introductiongives an extensive discussion of the general biology and anatomy of crabsand other similar crustaceans, including topics such as sexual dimorphism,larvae, and parasites. ; A variety of drawings and tables are included. ;The general characteristics of each of the families included in the bookare discussed. ; Keys to the families of each section (Thalassinidea,Anomura, Brachyrua) are included but one needs to know beforehand whichsection the animal is in. ; Keys are also included for the membersof each family. ; A useful key for the serious student wanting to identifycrabs.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Hart+1982 External link.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean, USA
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Alaska to San Diego

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: The other large, common cancer crab species in the Rosario area is C. magister, which does not have a dark tip to the dactyl of the chela, and its carapace is widest at the 10th and last lateral tooth. C. antennarius has red spots on the underside of the carapace.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 181 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): -1 - 1061
  Temperature range (°C): 7.261 - 10.151
  Nitrate (umol/L): 6.582 - 26.963
  Salinity (PPS): 31.460 - 33.771
  Oxygen (ml/l): 3.157 - 6.649
  Phosphate (umol/l): 0.929 - 2.219
  Silicate (umol/l): 13.303 - 40.988

Graphical representation

Depth range (m): -1 - 1061

Temperature range (°C): 7.261 - 10.151

Nitrate (umol/L): 6.582 - 26.963

Salinity (PPS): 31.460 - 33.771

Oxygen (ml/l): 3.157 - 6.649

Phosphate (umol/l): 0.929 - 2.219

Silicate (umol/l): 13.303 - 40.988
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Low intertidal to 90 m

Habitat: Rocky and soft bottoms. Most common around rocks. Often found half-buried in sand under rocks during the day; more active at night.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cancer productus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCCCCTGATATAGCTTTCCCGCGTATAAACAACATAAGGTTTTGATTATTACCCCCTTCTCTAACCCTTCTTCTTATAAGAGGATTAGTAGAAAGAGGTGTTGGAACTGGCTGAACTGTCTACCCTCCTTTAGCAGGTGCTATTGCCCATGCAGGTGCCTCAGTAGATATAGGGATCTTTTCGCTTCACTTGGCAGGAGTTTCCTCAATCTTAGGAGCTGTAAATTTTATAACAACCGTAATTAATATACGATCATTTGGAATAACTCTAGACCAAATACCACTTTTTGTTTGAGCCGTATTTATTACTGCCATCCTTTTACTTTTATCTCTCCCAGTATTAGCAGGAGCTATTACTATACTTCTCACTGACCGAAATCTTAATACTTCTTTCTTCGATCCAGCAGGAGNGGGAGATCCTGTTCTCTATCAACATCTCTTCTGATTTTTTGGGCACCCTGAAGTATATATTCTTATTTTACCGGCTTTTGGAATAATTTCTCATATTGTAAGCCAAGAATCTGGGAAAAAAGAATCTTTTGGGACCCTAGGGATAATCTATGCTATATTAGCCATCGGTATTTTAGGCTTTGTTGTCTGAGCCCACCATATATTTACAGTTGGAATAGATGTTGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cancer productus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cancer productus

Cancer productus, one of several species known as red rock crabs, is a crab of the genus Cancer found on the western coast of North America.

Contents

Description

Juveniles may be variously patterned

Cancer productus has carapace teeth that are somewhat broad and rounded with teeth between the eyes of nearly equal size and shape. The carapace of C. productus is widest at the posterior-most tooth, up to 20.0 cm wide. The pincers are large with distinctive black tips. This species lacks serrations or projections on the ventral side of the claws. Adults have a brick-red coloration throughout. The coloration of juveniles is diverse, often white, sometimes with red spots, or zebra-striped.[1]

Similar species

Dungeness crab (Metacarcinus magister) has serrations on the dorsal side of the chelipeds and lacks black tips. The graceful rock crab (Metacarcinus gracilis) has a single projection on the dorsal side of the chelipeds and also lacks black tips, and the widest point of carapace is at the second posterior-most tooth. The pygmy rock crab (Glebocarcinus oregonensis) has black-tipped chelipeds, but has large tubercles on the dorsum. G. oregonensis is also much smaller, such that a C. productus of similar size would generally have the striking juvenile coloration.[1]

Range and habitat

Closeup of a red rock crab

C. productus ranges from Kodiak Island, Alaska to Isla San Martine, Baja California. It inhabits mid-intertidal waters to 79 m depth.[2]

Biology

Cancer productus is carnivorous; in Puget Sound it will crush barnacles with its large pincers for consumption. Small living crabs and dead fish are also eaten. Mating in this species occurs when the female is soft-shelled from October to June in Puget Sound. The male can often been seen guarding females until molting during this time.[3] This species is known to be a favorite prey item of Enteroctopus dofleini, the giant Pacific octopus.[4]

Fishery

Although C. productus is harvested by sport fishermen, there is no commercial fishery. It is not as sought after as Dungeness crab due to the considerably lower amount of flesh. However, the flesh has a delicate flavor and slightly sweet taste. The similar Cancer pagurus has a major commercial fishery in western Europe. Both males and females with a carapace exceeding 5 inches (130 mm) may be harvested in Washington, when in season.

References

  1. ^ a b Eugene N. Kozloff (1987). Marine Invertebrates of the Pacific Northwest. University of Washington Press, Seattle, WA. pp. 511 pp.
  2. ^ Gregory C. Jensen (1995). Pacific Coast Crabs and Shrimps. Sea Challengers, Monterey, CA. pp. 87 pp.
  3. ^ R. H. Morris, D. P. Abbot and E. C. Haderlie (1980). Intertidal Invertebrates of California. Stanford University Press, Stanford, CA. pp. 690 pp.
  4. ^ E. B. Hartwick, L. Tulloch and S. MacDonald (1981). "Feeding and growth of Octopus dofleini". The Veliger 24 (2): 129–138.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!