Articles on this page are available in 2 other languages: Spanish (15), Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Description

Before the United Nations established a moratorium on the use of high seas drift nets in 1993, Pacific white-sided dolphins were frequently caught in the nets of Japanese and Korean squid fisheries. Today the species is better protected, and the total North Pacific population is estimated to approach one million. They are often seen swimming with seals and sea lions, and sometimes with other cetaceans, especially the northern right whale dolphin, perhaps because they are all pursuing the same prey. Females are mature and ready to reproduce when they are about 10 or 11 years old, and gestation lasts about 10 months. A newborn calf is about a meter long.

Links:
Mammal Species of the World
  • Original description: Gill, 1865.  Proceedings of the Academy of Natural Sciences of Philadelphia, 17:177.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific white-sided dolphins have a primarily temperate distribution, remaining north of the tropics and south of the colder waters caused by arctic currents. Their range is from the Aleutian Islands through the Gulf of Alaska to the tip of Baja California in the eastern Pacific; and from Japan to the Kuril Islnads in the western Pacific.

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Pacific White-sided Dolphins inhabit temperate waters of the North Pacific and some adjacent seas (Sea of Japan, southern Okhotsk Sea, the southern Bering Sea and southern Gulf of California) (Brownell et al. 1999, Van Waerebeek and Würsig 2002). Their range includes continental slope waters of the Western North Pacific as far south as southern China, shelf and slope waters of the eastern North Pacific from the Gulf of Alaska southward to Baja California, Mexico, and deep offshore waters of the North Pacific between about 35˚N and 47˚N latitude (Hobbs and Jones 1993).

The map shows where the species may occur based on oceanography. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Kamchatka Peninsula, Amchitka Island, and Kodiak Island south into Sea of Japan and along entire Pacific coast of Japan, and south to tip of Baja California in the eastern Pacific.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Pacific white-sided dolphins have torpedo-shaped bodies which help them move quickly through water. Body length of Pacific white-sided dolphins ranges from 150 to 310 cm. Their coloration is one of their most distinguishing features, they are black or dark gray on the dorsal surface with a white underside, and have bicolored fins and flippers. This coloration is believed to act as a form of camouflage in their aquatic environment.

Range mass: 82 to 124 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 2700 cm

Weight: 150000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger than females.

Length:
Range: "1.7-2.5 m "

Weight:
Range: 75-200 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Lagenorhynchus obliquidens Gill, 1865
Catalog Number: USNM A3886
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): Collector Unknown
Locality: Locality Unknown, Locality Unknown, North Pacific Ocean
  • Type: Cope, E. D. 1866. Proc. Acad. Nat. Sci. Philadelphia. 18: 295.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Lagenorhynchus obliquidens Gill, 1865
Catalog Number: USNM A1962
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): W. Froubridge
Locality: Locality Unknown, California, United States, North America, North Pacific Ocean
  • Syntype: Gill. 1865. Proc. Acad. Nat. Sci. Philadelphia. 1865: 177.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Lagenorhynchus obliquidens Gill, 1865
Catalog Number: USNM A1961
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): W. Trowbridge
Locality: Locality Unknown, California, United States, North America, North Pacific Ocean
  • Syntype: Gill. 1865. Proc. Acad. Nat. Sci. Philadelphia. 1865: 177.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Lagenorhynchus obliquidens Gill, 1865
Catalog Number: USNM A1963
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): Collector Unknown
Locality: Locality Unknown, California, United States, North America, North Pacific Ocean
  • Syntype: Gill. 1865. Proc. Acad. Nat. Sci. Philadelphia. 1865: 177.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

They are usually seen in deep waters up to 160 km (100 miles ) offshore. There seem to be local migrations inshore in the winter months.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Pacific White-sided Dolphins inhabit temperate oceanic waters across the North Pacific, as well as shelf and slope waters of the North Pacific continental margins (see distribution plots in Carretta et al. 2006), and in some inland waterways (e.g. British Columbia; Heise 1997).

Pacific White-sided Dolphins feed on a wide variety of small pelagic schooling fish (e.g., lanternfish, anchovies, saury, horse mackerel, and hake), as well as cephalopods. They are commonly associated with other marine mammal species, particularly Northern Right Whale Dolphins, Risso's Dolphins, and California Sea Lions (Brownell et al. 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Mostly between seaward edge of continental slope and 100-fathom contour; sometimes closer to shore if there is deep water nearby (Leatherwood and Reeves 1983). In Canada, depth of water at sighting locations ranged from 10 to 2000 fathoms, with mean, median, and modal depths of 617, 400, and 100 fathoms, respectively (Stacey and Baird 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

offshore waters, sometimes near shore
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1350 specimens in 1 taxon.
Water temperature and chemistry ranges based on 785 samples.

Environmental ranges
  Depth range (m): 0 - 500.83
  Temperature range (°C): 4.730 - 21.311
  Nitrate (umol/L): 0.082 - 40.485
  Salinity (PPS): 30.381 - 34.257
  Oxygen (ml/l): 0.435 - 7.358
  Phosphate (umol/l): 0.330 - 3.118
  Silicate (umol/l): 1.436 - 78.143

Graphical representation

Depth range (m): 0 - 500.83

Temperature range (°C): 4.730 - 21.311

Nitrate (umol/L): 0.082 - 40.485

Salinity (PPS): 30.381 - 34.257

Oxygen (ml/l): 0.435 - 7.358

Phosphate (umol/l): 0.330 - 3.118

Silicate (umol/l): 1.436 - 78.143
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal movements not well understood in most areas. Off southern and central California and northwestern Baja California, apparently resident pods are augmented during fall through spring by influxes of animals possibly from north and offshore (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pacific white-sided dolphins eat fish that live in large schools, such as anchovies, herring, smelt, capelin, and mackerel. They feed in groups of 10-20 dolphins, each adult eating about 9 kilograms (20 lbs ) of food each day.

Animal Foods: fish

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats various fishes (anchovies, hake, sauries) and squid. Apparently feeds primarily at night. Has been seen at dawn and dusk feeding with gulls on small surfacing balls of unidentified bait fishes. (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Two 1970s estimates: 30,000-50,000 in Japanese waters; about 24,000 in 1.5 million sq km off California and Baja California (see IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Gregarious. Forms herds of a thousand or more, though usually groups are of several hundred or less; herds generally are of all age classes and both sexes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Feeding may occur mainly at night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 46 years (captivity) Observations: It has been estimated that these animals live up to 46 years (Don Wilson and Sue Ruff 1999). One wild born specimen was about 36-37 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Pods are made up of one dominant male and a number of other males and females. The dominant male mates with reproductively available females.

Mating System: polygynous

Female Pacific white-sided dolphins reach sexual maturity around 5-6 years of age, males are sexually mature at 8-10 years. Generally breeding occurs in the summer or fall, and gestation lasts approximately 11-12 months. Females give brith to a single calf, which is almost 3 feet long and can weigh up to 14 pounds.

Breeding season: Generally breeding occurs in the summer or fall.

Average number of offspring: 1.

Range gestation period: 11 to 12 months.

Range age at sexual or reproductive maturity (female): 5 to 6 years.

Range age at sexual or reproductive maturity (male): 8 to 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 14000 g.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Calving season has been reported to be summer, but in recent studies calves have been found primarily in early fall (Leatherwood and Reeves 1983).

High seas drift net samples in Central North Pacific (Ferrero and Walker 1996): a calving period preceded sampling during late winter and spring; estimated gestation period 11-12 months; males sexually mature in 10-11 years, females in 8-11 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lagenorhynchus obliquidens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTGTATTTACTATTTGGCGCTTGAGCAGGAATAGTGGGTACTGGCCTAAGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGACGACCAACTTTATAACGTTCTAGTAACAGCTCACGCCTTCGTAATAATTTTCTTTATGGTTATACCTATCATAATTGGGGGTTTCGGAAACTGATTAGTTCCTTTAATAATCGGAGCCCCCGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGGCTACTCCCCCCTTCCTTCCTACTACTGATAGCATCTTCGATAATTGAAGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTTACTATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGGGCTATTAACTTCATTACAACTATCATTAATATAAAACCACCCGCTATAACCCAATATCAAACGCCTCTCTTCGTCTGATCGGTCTTGGTCACAGCAGTCTTACTTTTACTATCATTGCCTGTCTTAGCAGCCGGAATTACCATATTATTAACTGATCGAAATCTAAACACAACCTTTTTCGACCCGGCAGGAGGAGGTGACCCAATCTTATATCAACACTTGTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lagenorhynchus obliquidens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Pacific white-sided dolphins are not considered to be endangered. A recent estimate of the population of these mammals in the central North Pacific ranged between a minimum of about 500,000, to a maximum of 930,000. Therefore there is not any immediate danger for the extiction of these animals. They are hunted by Japanese coastal fishermen in the East China and Japan seas and taken accidentally in the North Pacific purse-seine fishery.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K.A., Karkzmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y. , Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D.

Contributor/s

Justification
The species is widespread and abundant, with current range-wide population estimates in the hundreds of thousands. Although bycatch in high-seas drift gillnet fisheries during the 1970s and 1980s may have caused population declines, these fisheries have been banned since 1993. Current takes and threats are small relative to reported global population size.

History
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Two separate estimates of abundance have been made for waters of the central North Pacific, suggesting that 900,000–1,000,000 Pacific White-sided Dolphins may inhabit this oceanic region (Buckland et al. 1993, Miyashita 1993); however, precision was low for both studies, and vessel attraction probably resulted in a substantial overestimation of population size (Buckland et al. 1993). In the eastern North Pacific, the distribution of this species has been documented to vary dramatically with oceanographic conditions (Heise 1997, Forney and Barlow 1998), and abundance estimates along the U.S. West Coast have ranged from about 13,000 to 122,000 (Forney et al 1995, Barlow and Forney, in press). The average abundance in this region during 1996–2001 was estimated to be about 24,000 (Barlow and Forney, in press).

Separate subpopulations have been identified in the southern portions of the species range, off the west coast of North America (Lux et al. 1997) and in Japan (Hayano et al. 2004).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Historically, the greatest threats to Pacific White-sided Dolphins were the high-seas drift gillnet fisheries for salmon and squid, which operated throughout the central and western North Pacific between about 35˚N and 47˚N (Hobbs and Jones 1993). Effort in these fisheries increased during the 1970s and peaked during the 1980s before an United Nations moratorium went into effect in January 1993. Bycatch estimates are only available for a subset of the total fishing effort. The Japanese squid driftnet fishery killed an estimated 6,100 animals during 1989, and all fisheries combined killed an estimated 5,759 during 1990 (Hobbs and Jones 1993). During the 1970s and 1980s, the combined high-seas driftnet fisheries likely killed on the order of 100,000 Pacific White-sided Dolphins. Although there is great uncertainty in the total population size, these bycatch levels may have caused some, but not substantial, population depletion (Hobbs and Jones 1993).

Smaller catches (e.g., at least 194 in 1987) are reported from the Japanese land-based salmon drift net fishery, and small numbers are taken yearly in seines, set nets, and trap nets around Japan (Brownell et al. 1999). Pacific White-sided Dolphins have never been primary targets of Japanese drive fisheries, but they were harpooned in Japanese waters during the 1940s, and cull programs killed at least 466 Pacific White-sided Dolphins in Japanese waters between 1976 and 1980. The Japanese government is currently (2007) considering a renewed direct harvest of this species (Kasuya pers. comm.). The potential for renewed directed takes in Japanese waters, coupled with evidence for population substructure, particularly at the southern ends of this species' range, may require the re-examination of the threat to this species.

In the eastern Pacific, a total of 424 Pacific White-sided Dolphins were estimated killed in the U.S. West Coast shark and swordfish driftnet fishery between 1988 and 2002 (Perkins et al. 1994; Julian and Beeson 1998, Carretta et al. 2005). Additional low levels of mortality have been documented for bottom-set gillnets in California coastal waters, for drift gill nets in British Columbia and Alaska, and for trawl fisheries in Alaska; however, no overall mortality estimates are available for these fisheries. Pacific White-sided Dolphins are rarely taken in the tuna purse seine fishery in the eastern tropical Pacific, because most of the fishing takes place south of the range of these dolphins (Brownell et al. 1999). None of these sources of eastern North Pacific mortality appears of a sufficient magnitude to have caused a population decline in this region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Taken directly and incidently in small numbers in various fisheries through the range, but apparently not seriously threatened (Stacey and Baird 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

The most significant international conservation measure for this species was the United Nations (U.N.) moratorium on high-seas driftnet fishing implemented in 1993. In the eastern North Pacific, the U.S drift gillnet fishery has been required since 1996 to use acoustic warning devices (pingers) to reduce cetacean bycatch; however, low levels of bycatch of Lagenorhynchus obliquidens have continued (Carretta et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Taken in small numbers for human consumption in Japan (IUCN 1991). Sometimes displayed in marine aquaria.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pacific white-sided dolphin

The Pacific white-sided dolphin (Lagenorhynchus obliquidens) is a very active dolphin found in the cool to temperate waters of the North Pacific Ocean.

Taxonomy[edit]

The Pacific white-sided dolphin was named by Smithsonian mammalogist Theodore Nicholas Gill in 1865. It is morphologically similar to the dusky dolphin, which is found in the southern Pacific. Genetic analysis by Frank Cipriano suggests the two species diverged about two million years ago.

Though both are traditionally placed in the genus Lagenorhynchus, molecular analyses indicate they are closer to dolphins of the genus Cephalorhynchus. The new genus Sagmatias has been proposed for these species.[3]

Physical description[edit]

Photo of dual-hemisphered brain
Pacific white-sided dolphin's brain at Okinawa Churaumi Aquarium

The Pacific white-sided dolphin has three colors. The chin, throat and belly are creamy white. The beak, flippers, back, and dorsal fin are a dark gray. Light gray patches are seen on the sides and a further light gray stripe runs from above the eye to below the dorsal fin, where it thickens along the tail stock. A dark gray ring surrounds the eyes.

The species is an average-sized oceanic dolphin. Females weigh up to 150 kg (330 lb) and males 200 kg (440 lb) with males reaching 2.5 m (8.2 ft) and females 2.3 m (7.5 ft) in length. Pacific white-sided dolphins tend to be larger than dusky dolphins. Females reach maturity at seven years. The gestation period is one year. Individuals live 40 years or more.

The Pacific white-sided dolphin is extremely active and mixes with many of the other north Pacific cetacean species. It readily approaches boats and bow-rides. Large groups are common, averaging 90 individuals, with supergroups of more than 300. Prey is mainly hake, anchovies, squid, herring, salmon, and cod.

They have an average of 60 teeth.[4]

Range and habitat[edit]

The range of the Pacific white-sided dolphin arcs across the cool to temperate waters of the north Pacific. Sightings go no further south than the South China Sea on the western side and the Baja California peninsula on the eastern. Populations may also be found in the Sea of Japan and the Sea of Okhotsk. In the northern part of the range, some individuals may be found in the Bering Sea. The dolphins appear to follow some sort of migratory pattern — on the eastern side they are most abundant in the Southern California Bight in winter, but further north (Oregon, Washington) in summer. Their preference for off-shore deep waters appears to be year-round.

The total population may be as many as 1 million. However, the tendency of Pacific white-sided dolphins to approach boats complicates precise estimates via sampling.

Behavior[edit]

These dolphins keep close company. White-sided dolphins swim in groups of 10 to 100, and can often be seen bow-riding and doing somersaults. Members form a close-knit group and will often care for a sick or injured dolphin. Animals that live in such big social groups develop ways to keep in touch — each dolphin identifies itself by a unique name-whistle. Staying close helps, too. Young dolphins communicate with a touch of a flipper as they swim beside adults.

Relation to humans[edit]

Left: High-jump during Pacific white-sided dolphin show at the Vancouver Aquarium
Right: Pacific white-sided dolphin named Spinnaker at Vancouver Aquarium

Protection[edit]

Until the United Nations banned certain types of fishing nets in 1993, many Pacific white-sided dolphins were killed in drift nets. One researcher estimated 50,000–89,000 individuals were killed in the 12 years to 1990. Some animals are still killed each year by Japanese hunting drives.

Captivity[edit]

Although overshadowed in popularity by bottlenose dolphins, Pacific white-sided dolphins are also a part of some marine theme park shows. Almost 50 reside in dolphinaria in North America and Japan. Many held in Japan have come from the drive-hunts in Taiji, Japan.

See also[edit]

References[edit]

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Lagenorhynchus obliquidens. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 October 2008.
  3. ^ Shirihai, H. and Jarrett, B. (2006). Whales, Dolphins and Other Marine Mammals of the World. Princeton Field Guides. pp. 202–205. ISBN 9780691127569. 
  4. ^ Black, Nancy A. (2009). Perrin, William F.; Würsig, Bernd; Thewissen, J. G. M., eds. Encyclopedia of Marine Mammals (2 ed.). Burlington Ma.: Academic Press. ISBN 978-0-12-373553-9. 
  • van Waerebeek, Koen; Würsig, Bernd. "Pacific White-sided Dolphin and Dusky Dolphin". In Perrin, William R; Wiirsig, Bernd; Thewissen, J G M. Encyclopedia of Marine Mammals. pp. 859–60. ISBN 0-12-551340-2. 
  • National Audubon Society: Guide to Marine Mammals of the World ISBN 0-375-41141-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Lagenorhynchus obliquidens may be a Northern Hemisphere form of L. obscurus (Mead and Brownell, in Wilson and Reeder 1993, 2005). "Morphological differences exist between animals in the northeastern Pacific north of southern California and those 'resident' off Baja California" (IUCN 1991).

LeDuc et al. (1999) used cytochrome b gene sequences to examine phylogenetic relationships among delphinids and found that Lagenorhynchus albirostris (type species for the genus) and L. acutus are not closely related to each other or to nominal congeners; acutus was therefore assigned to the genus Leucopleurus. The remaining four Lagenorhynchus species are closely related to Lissodelphis and Cephalorhynchus and were placed in the genus Sagmatias. However, this revision has not been widely accepted and, pending further evidence, the mammal checklists by Baker et al. (2003) and Mead and Brownell (in Wilson and Reeder 2005) maintained acutus and obliquidens in the genus Lagenorhynchus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!