Overview

Brief Summary

Description

The pygmy hippopotamus shares the barrel-shaped body form of the closely related common hippopotamus (Hippopotamus amphibius), but is considerably smaller. Other physical differences between the two hippopotamus species include the placing of the eyes, which are more towards the side of the head in the pygmy hippopotamus, feet that are not as webbed as in the common hippopotamus (2), and the pygmy's sloping smooth, greenish-black back (7). The sexes are similar in appearance; as males do not have a scrotum, males and females are very difficult to tell apart (7). The name hippopotamus derives from the Greek for 'river horse' (2). Genetic studies have revealed that hippopotami share a common ancestor with whales (2), while recent fossil evidence alludes to a close relationship between whales and all ungulates (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

The pygmy hippopotamus spends the day in water, and emerges at night to feed on fruits, leaves, roots and grasses (2), which it bites with the thick lips rather than with the teeth (2). Hippopotami have extraordinarily high rates of water loss (three to five times the rate in man) due to their unique skin structure; this explains why they must spend the day in water (2). Pygmy hippopotami usually live alone unless they are mating or with a calf, and they are not thought to hold territories (2). The home ranges of various individuals often overlap, but individuals seem to actively avoid encounters with others, possibly through dung marking (5). In the breeding season, males seek out females and form consortships for a time prior to mating, which tends to occur in the water but may also occur on land (2). Gestation lasts about 6.5 months, calves are suckled for six to eight months and stay with their mother until around eight years of age, when they are fully grown (2). The pygmy hippopotamus is not a particularly vocal species, but has been recorded grunting, hissing, squeaking and snorting (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Pygmy Hippopotamus according to MammalMAP

The Pygmy Hippopotamus (Choeropsis liberiensis) inhabits the cool forests and swamps of Western Africa, principally Liberia, and is an elusive creature owing to its small stature and nocturnal habits. This EDGE (Evolutionary Distinct and Globally Endangered) species stands a mere 75-100 cm tall at the shoulder and is about one fifth the weight of its larger cousin, the common hippopotamus. There are other notable differences between these two species such as the more solitary nature of the pygmy hippo compared to the common hippo as well as spending less time in water bodies (despite having webbed toes), preferring to cool off in the surrounding mud and burrows of other animals. Local legends tell of the Pygmy hippo sweating blood, but scientists believe that the red substance they secrete acts as an antibiotic and sunscreen.

This herbivorous animal can reach top speeds of 30 km/h and has a relatively long life-span of up to 40 years in the wild. However, their numbers in the wild are dwindling, predominantly as a result of habitat loss and illegal poaching, but also due to the fact that they only reach sexual maturity at 4-5 years of age and giving birth to a single calf after 7 months of gestation. 

The Pygmy hippo was listed as Endangered on the IUCN Red List of Threatened Species. A formal recent assessment of the population revealed that an estimated 2000-3000 individuals remain in the wild. In 2012, a National Action Plan for the Conservation of the Pygmy Hippopotamus in Liberia was produce with the primary goal “To assess the current status of the Pygmy hippo across its range and ensure effective  protection of, and connectivity between, known populations.

For more information on MammalMAP, visit the MammalMAP virtual museum or blog.

  • Pigs, Peccaries, and Hippos: Status Survey and Conservation Action Plan. Edited by William L. R. Oliver, IUCN/SSC Pigs and Peccaries Specialist Group, IUCN/SSC Hippo Specialist Group.
  • G. B. Corbet (1969) The taxonomic status of the Pygmy hippopotamus, Choeropsis liberiensis, from the Niger Delta, Journal of Zoology, 158, 387-394.
  • FFI and FDA (2013) National Action Plan for the Conservation of the Pygmy Hippopotamus in Liberia. Fauna & Flora International, Cambridge, UK and Forestry Development Authority, Monrovia, Liberia.
  • http://a-z-animals.com/animals/pygmy-hippopotamus/
  • http://www.lpzoo.org/animals/factsheet/pygmy-hippopotamus
Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Pygmy Hippopotamuses range in weight from 160 to 275 kg (352-605 lbs.). Their skin color is dark brown on top, fading to a lighter color underneath. Large glands in the skin produce a glossy, brownish-red secretion that is referred to as “blood sweat,” which protects their sensitive skin from sun.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Pygmy Hippo is endemic to West Africa. Known populations (of the nominate subspecies, H. l. liberiensis) occur in four African countries (in order of ascending population sizes): Sierra Leone, Guinea, Côte d'Ivoire, and Liberia. A record from the Corubal River in Guinea-Bissau by Cristino (1958), who claimed to have shot an individual, almost certainly represented a young Common Hippopotamus. The overall past distribution of the Pygmy Hippo was not very different from what it is today, but the populations have become much more fragmented and have disappeared from many former sites. The distribution of the species is centered on Liberia, which includes the bulk of the population (Anstey 1991), with occurrence in the other three countries mainly close to the shared borders with Liberia. Sierra Leone has remnant Pygmy Hippo populations in the Gola Forest region bordering Liberia, Tiwai Island, and the Loma Mountains. Populations reported from other forests in Sierra Leone in the late 1960s are now presumed to be extinct, leaving the Gola Forest as the country’s last main refuge. The Republic of Guinea contains fragmented Pygmy Hippo populations along the Liberian and Ivoirian border in the Reserve de Ziama. There were also reports of Pygmy Hippopotamus populations in Dere Forêt, but more recent reports suggest that this area has been degraded and converted into farmland. However, there was evidence of Pygmy Hippo found in Diécké Forest Reserve, south-east of Ziama (Alonso et al. 2005). In 1994, populations in Ziama and Diécké forests were estimated at 32–96 and 18–54 individuals, respectively (Butzler 1999). Côte d'Ivoire has lost most of its historical forest cover and is likely to be home to fragmented Pygmy Hippo populations along its border with Liberia in the Fresco region; populations are likely found throughout Tai National Park and may occur in Cavally Forest Reserve (north-west of Tai N.P.), Mount Nimba Reserve, N’Zo Forest Reserve, Taipleu Forêt, Tatigbo Lagoon, and along the Dagbe, Bolo, and Niouniourou Rivers. In Côte D'ivoire, it has previously been recorded as far east as between the Sasandra and Bandama Rivers (Dekeyser 1954), but Bosman and Hall-Martin (1989) reported it from the Azagny National Park in the south-east corner of the country. Whether it naturally occurs there or has been introduced is not clear. The largest Pygmy Hippo populations are believed to be in central and south-eastern Liberia, although population sizes are unknown. Liberian Pygmy Hippo populations are believed to occur in Sapo National Park, the Cestos-Senkwehn Forests, Krahn-Bassa National Forest, Gbi National Forest, Grebo National Forest and in Grand Kru County. No recent information is available on the populations of north-west Liberia, which may still sustain a substantial number of Pygmy Hippos.

The second subspecies, H. l. heslopi, is known only from the Niger Delta east to the vicinity of the Cross River in Nigeria (Corbet 1969). This second, isolated population in Nigeria is some 1,800 km to the east of the known populations, on the other side of the Dahomey Gap. Such a discontinuous distribution is very rare amongst forest vertebrates in West Africa and Robinson (1970) considers that there is insufficient evidence to confirm that the species ever existed in Nigeria, despite the account by Heslop (1945), who shot one near Omoku in the vicinity of the Niger Delta. This putative Pygmy Hippo subspecies was identified in 1945 based on morphological features of skulls collected in the late 1930s in Nigeria. Others have been equally skeptical, but Ritchie (1930) gave measurements of two skulls that were obtained in 1928 from the Niger Delta so there seems little doubt that the species did once occur in the country. It may be extinct, but Oates (in litt. 1993) reported that residents in the Niger Delta still knew of the species. Although the 1993 Action Plan posits that H. l. heslopi individuals may still occur in the Niger Delta, the existence of this subspecies has not been confirmed or reported. There is little possibility that this Niger delta population still survives, although it is surprising that the existence was so poorly known or documented.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The range of current populations of Hexaprotodon liberiensis is limited to just four West African countries: Liberia, Ivory Coast, Sierra Leone, and Guinea. The majority of the estimated total population of 2,000 to 3,000 is concentrated in Liberia. Smaller populations occur in the other three countries in national forests and reserves. Other than its more recent habitat loss due to human development, the range of H. liberiensis is speculated to have never been much larger than it is today.

The range of H. liberiensis and that of its closest living relative, Hippopotamus amphibius, do not overlap.

The skull of a subspecies, H. l. heslopi, was described in the 1940's from the Niger Delta, Nigeria. Whether this subspecies is still in existence there is unknown, although it is highly unlikely since there is no other documented evidence of its presence.

Biogeographic Regions: ethiopian (Native )

  • Eltringham, S. 1999. The Hippos. San Diego, California: Academic Press.
  • Oliver, W. 1993. Status Survey and Conservation Action Plan: Pigs, Peccaries, and Hippos. Gland, Switzerland: IUCN.
  • Lang, E. 1990. Pygmy Hippoptamuses. Pp. 58-64 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals, Vol. 5, 1 Edition. New York: McGraw-Hill Publishing Company.
  • Lewison, R., W. Oliver. 2008. "2008 IUCN Red List of Threatened Species" (On-line). IUCN 2008 Red List. Accessed September 03, 2008 at http://www.iucnredlist.org/details/10032.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The pygmy hippopotamus is found in western Africa, mainly in Liberia but also in Sierra Leone, Guinea, and the Ivory Coast (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pygmy hippopotamuses range in mass from 160 to 275 kg. Body lengths are 1.5to 1.75 m and tail lengths are 0.2 m. Height is 0.7 to 1.0 m at the shoulder. Despite the name "Hexaprotodon," these hippopotamuses have only two pairs of upper and one pair of lower incisors. The dental formula is 2/1, 1/1, 3/3, 3/3; 34 teeth in all. The canines are ever-growing. The skin color is dark brown on top, fading to a lighter, fleshy color on the belly and throat. Large glands in the dermis produce a glossy, brownish-red secretion that is referred to as “blood sweat”. These secretions protect the sensitive skin from sun. It may be an adaptive replacement of sweat since the production of the blood sweat has been observed to increase when intense physical exertion such as running or mating takes place.

Hexaprotodon liberiensis is most commonly compared to its larger relative Hippopotamus amphibius. While pygmy hippopotamuses are obviously smaller in body size, they also have some rather distinct physical adaptations that distinguish them from H. amphibius individuals. Proportionally, the legs and neck of H. liberiensis are longer, and the head is smaller relative to body size. The digits of pygmy hippos are more spread out and have less webbing between digits than common hippos.  In general, pygmy hippos have many adaptations that are thought to be advantageous to terrestrial mobility. Their orbits are positioned on the sides of the head rather than on top. Their backs are forward sloping, a trait thought to enhance movement through thick vegetation. A feature that they share with their larger relative is the muscular valves of the ears and nose, which are capable of closing under water.

Range mass: 160 to 275 kg.

Range length: 1.50 to 1.75 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Prothero, D., S. Foss. 2007. The Evolution of Artiodactyls. Baltimore, Maryland: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Pygmy Hippo is rarely seen because of its secretive, nocturnal habits and consequently not much is known of its ecology. The most detailed field study is that of Robinson (1970) and a general account of its biology is given by Lang (1975). The Pygmy Hippo is much less gregarious than the larger species, being usually found either solitary or in pairs. As it is largely nocturnal it tends to spend the day hidden in swamps, wallows or rivers and sometimes in hollows under the banks of streams, which it is said to enlarge. It favors heavily forested regions, but it is dependent on water and usually remains close to streams. It also used to frequent forests fringing the rivers that extend into Transitional Woodland and the southern Guinea savanna, further inland. However, it seems likely to have been hunted out of most of these areas. Within the forest it follows well defined trails or tunnel-like paths through swamp vegetation, which it marks by spreading its dung by vigorously wagging its tail while defecating, like its larger relative.

The species is exclusively vegetarian, feeding on leaves and roots of forest plants (including semi-aquatic plants and forest herbs) as well as on fallen fruit. The stomach has four chambers (Langer 1988). The first three are covered with tough keratinized epithelium, only the last containing glandular epithelial tissue. There is evidence that microbial breakdown of plant material takes place in the first three stomach chambers, no caecum being present in this species. This mode of digestion is usually considered an adaptation to a highly fibrous, generally "low-quality" vegetable diet. The droppings are poorly formed and similar to those of the common hippo.

It is not known how far individual Pygmy Hippos roam in the wild, or whether they keep to well-defined home ranges, but their habit of fecal marking implies they may be at least partly territorial in defending particular areas against incursions from other members of the species. However, during the rainy season (May–September), animals are reported by hunters to disperse over wide areas in the forest zone. The effects of predators on pygmy hippo populations are unknown, but the principal carnivore capable of attacking an animal this size is the leopard.

No accurate data on reproduction, including breeding season, have been published for the wild populations. Sexual maturity occurs at about four to five years of age. From studies of captive animals (Lang 1975; Tobler 1991), the oestrous cycle has been shown to average 35.5 days with oestrus itself being 24–48 hours long. The average gestation length is 188 days after which a singleton young is born weighing about 5.7 kg. Twins are born very rarely, the incidence being approximately one in every 200 births. The young are born on land (although can readily swim), and there is no evidence from captive births that a nest constructed. A survey of over 800 births indicates that these occur throughout the year (Tobler 1991).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hexaprotodon liberiensis is only found in low-lying, forested areas, never far from a source of water. Pygmy hippopotamuses use swamps, streams, and rivers as refuges from danger and to keep their sensitive skin moist. Open areas are completely avoided and most travel is limited to worn-down, tunnel-like paths through dense vegetation on land. Narrow waterways are also used to navigate through swampy areas. Pygmy hippopotamuses have been found in burrows deep in the sides of river banks. It is unlikely that they dig burrows themselves, but they may enlarge existing ones. Because entrances of these burrow open toward the river and are mostly submerged below the water level, they are ideal for the semi-aquatic lifestyle of H. liberiensis.

Habitat Regions: tropical ; terrestrial ; freshwater

Terrestrial Biomes: forest ; rainforest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: swamp

Other Habitat Features: caves

  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. San Diego, California: Academic Press.
  • Leidy, 1991. Pygmy Hippopotamus. Pp. 1350-1351 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, 5 Edition. Baltimore Maryland: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current populations of the Pygmy Hippoptamus are limited to just four West African countries: Liberia, Ivory Coast, Sierra Leone and Guinea. The majority of the total estimated population of 2,000 to 3,000 is concentrated in Liberia in patches of lowland forest near sources of water.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits rivers and swamps in a handful of dense lowland forest patches (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Pygmy hippos are strictly vegetarian, or herbivorous. They eat a wide variety of plant foods including herbs, broad-leaved plants, grasses, semi-aquatic plants, herbaceous shoots, forbs, sedges, ferns, and fallen fruit. Considered a pseudo-ruminant, pygmy hippos have a four-chambered stomach but do not ferment food or use microbes in the same way as true ruminants. They also do not chew their cud.

Plant Foods: leaves; roots and tubers; fruit

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Specific ecosystem roles of pygmy hippos are unknown but their herbivorous diet probably has an effect on plant populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The main predators of pygmy hippos are leopards (Panthera pardus). Other potential predators include large African rock pythons and crocodiles. When startled, pygmy hippos flee a short distance into vegetation, where they hide.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Pygmy hippos use scent marking with their feces to alert other hippos to their presence. Like other mammals, they may use scent cues to advertise reproductive status as well. Pygmy hippos are typically silent, but do make snorts, grunts, hisses, and squeaks occasionally. Otherwise, little is known about how pygmy hippos communicate.

Communication Channels: chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

  • Boitani, L., S. Bartoli. 1982. Simon & Schuster's Guide to Mammals. New York: Fireside/Simon & Schuster, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pygmy Hippopotamuses are strictly herbivorous. They feed on a wide variety of plant foods including herbs, broad-leaved plants, grasses, semi-aquatic plants, herbaceous shoots, forbs, sedges, ferns, and fallen fruit.

The Pygmy Hippopotamus is generally solitary, scent marking with feces to alert intruders to its presence. Mothers leave their newborn calves alone while searching for food, returning about three times a day for suckling. Calves are ready to forage with their mother at about three months of age.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of Hexaprotodon liberiensis individuals in the wild is unknown. In captivity individuals have lived up to 43 years.

Range lifespan

Status: captivity:
43 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 42.3 years (captivity) Observations: One captive specimen lived 42.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system of H. liberiensis has only been observed in captive individuals. In captivity only monogamous mating has occurred. This is very unlikely in the wild, however, because the home range of a single male overlaps the home ranges of several females. Mating in captivity has been observed both on land and in water and can take place one to four times during the female's estrous period, which lasts one or two days.

Mating System: monogamous ; polygynous

Very little is known about the reproductive behavior of H. liberiensis in the wild. All of the information here is based on observations of captive animals. The breeding season is unknown in the wild but in captivity can occur at any time of the year. The breeding interval is between 7 and 9 months. The gestation period lasts as little as 184 days or as long as 210 days. One offspring is normally produced; the occurrence of twins is very rare. Offspring weigh 3.4 to 6.4 kg and are generally well developed. Newborn males weigh slightly more than females. Weaning occurs between 6 and 8 months and an individual reaches sexual maturity in 3 to 5 years.  Births have occurred both on land and in water in captivity. Births taking place in deep water almost always result in the newborn drowning.

Breeding interval: Breeding can occur as often as every 7 to 9 months.

Breeding season: Breeding occurs year round in captivity. Seasonality in the wild is unknown.

Average number of offspring: 1.

Range gestation period: 184 to 210 days.

Range birth mass: 3.4 to 6.4 kg.

Range weaning age: 6 to 8 months.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Hexaprotodon liberiensis is considered a K-selected species, which means it produces few offspring and invests a lot of energy into offspring development. Newborn calves are left in one place while the mother searches for food, returning about three times a day for suckling. They young are usually able to feed on vegetation after three months. These behaviors have been observed both in captivity and in the wild.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Kingdon, J. 1997. The Kingdon Field Guide to African Mammals. San Diego, California: Academic Press.
  • Eltringham, S. 1999. The Hippos. San Diego, California: Academic Press.
  • Lang, E. 1990. Pygmy Hippoptamuses. Pp. 58-64 in B Grzimek, ed. Grzimek's Encyclopedia of Mammals, Vol. 5, 1 Edition. New York: McGraw-Hill Publishing Company.
  • Leidy, 1991. Pygmy Hippopotamus. Pp. 1350-1351 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, 5 Edition. Baltimore Maryland: Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hexaprotodon liberiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATAAACCGCTGACTATTCTCAACTAACCACAAAGACATCGGTACATTATATCTACTATTCGGTGCCTGAGCTGGCATAGCAGGCACTGCCCTAAGCCTACTAATCCGTGCCGAACTAGGCCAACCTGGTACACTACTAGGAGATGACCAAATTTATAACGTAGTCGTCACAGCTCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATAATCGGCGGGTTCGGAAACTGACTTGTTCCACTAATAATCGGAGCCCCTGATATAGCCTTTCCTCGAATAAATAACATAAGCTTCTGACTACTTCCCCCCTCTTTCCTACTATTATTAGCATCCTCCATAGTAGAAGCAGGAGCAGGAACAGGCTGGACCGTCTATCCCCCTTTAGCTGGAAATTTAGCCCATGCTGGAGCCTCCGTAGACCTTACAATTTTCTCCCTCCACCTGGCCGGAGTTTCCTCTATTCTAGGTGCAATCAATTTCATTACAACCATCATTAACATAAAACCACCCGCCATATCCCAATATCAAACCCCACTGTTCGTCTGATCAGTTCTAATCACAGCCGTACTACTTCTACTCTCCCTACCCGTTCTAGCAGCAGGTATTACTATGCTACTTACAGACCGAAACCTAAATACCACCTTCTTTGACCCTGCGGGAGGAGGTGACCCTGTCCTTTATCAACACTTATTCTGATTCTTCGGACACCCCGAAGTATACATCCTCATCCTCCCCGGCTTCGGAATGATCTCACACATTGTAACCTATTACTCCGGAAAAAAAGAACCCTTTGGATACATAGGCATGGTTTGAGCCATGATATCCATCGGATTCCTAGGATTTATTGTATGGGCCCATCACATATTTACAGTAGGTATAGATGTGGACACCCGAGCATACTTTACATCCGCCACTATAATTATTGCCATCCCCACAGGAGTAAAAGTATTTAGCTGATTAGCAACACTACATGGAGGGAACATCAAGTGATCCCCTGCTATGATATGAGCCCTAGGCTTTATTTTCCTATTCACAGTGGGTGGCCTAACAGGTATTGTTTTAGCCAACTCATCCCTAGACATCGTCCTCCATGACACCTATTACGTAGTAGCCCACTTCCATTATGTACTCTCAATAGGCGCCGTCTTCGCTATCATAGGAGGCTTCGTACACTGATTCCCACTATTTTCGGGGTATACACTCAATGACACATGAGCAAAAATCCACTTCGTAATTATATTCGTGGGGGTCAATCTAACTTTCTTCCCACAACATTTCTTAGGTCTATCCGGAATACCTCGACGATACTCCGACTACCCAGACGCCTATACAACATGAAATACTATCTCCTCAATAGGCTCATTTATCTCACTGACAGCTGTAGTACTAATAGTATTTATCATTTGAGAGGCATTTGTCTCCAAACGAGAAGTCTTAGCTGTAGATCTAACTACGACGAACCTAGAGTGACTAAACGGATGCCCTCCACCATACCACACATTTGAAGAACCCGCATAYGTGAGCTTAACTAACCAAAACAAGAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hexaprotodon liberiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C1

Version
3.1

Year Assessed
2008

Assessor/s
Lewison, R. & Oliver, W. (IUCN SSC Hippo Specialist Subgroup)

Reviewer/s
Lewison, R., Oliver, W. ( Pig, Peccary & Hippo Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
The population estimate in the early 1990s suggested that there may be less than 3,000 individuals total. While the true population size is unknown, given the loss of habitat in Upper Guinea and subsequent hunting pressure (as forests become more accessible), even that estimate may be too high and that populations most likely are continuing to decline such that a 20% decline over the course of the next 20 years is not without reason.

History
  • 2006
    Endangered
    (IUCN 2006)
  • 2006
    Endangered
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pygmy hippos are classified as Endangered by the IUCN and are on Appendix II of CITES. Threats to H. liberiensis populations include deforestation, hunting, agricultural land development, and civil conflicts. Pygmy hippos are legally protected in most of the regions where they are found. However, there are little or no resources available to enforce their protection and numbers in the wild continue to decrease. The subspecies H. l. heslopi is considered extinct in the wild, although its existence is still questioned because reports of individuals in Nigeria are questionable.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Status: ENDANGERED

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) by the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The 1993 Action Plan estimated that there were approximately 2,000–3,000 individuals remaining across all the four countries (Sierra Leone, Republic of Guinea, Côte d'Ivoire, and Liberia). The 1993 population estimate for Sierra Leone, the only country with an estimated population size, was 80-100 individuals. Subsequent reports of habitat loss and hunting suggest that the 1993 estimate may be high given current conditions.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The range of this species has changed dramatically in the past 100 years, but most acutely in the past 30 years. Forests within the Pygmy Hippo’s historical range have been steadily logged, farmed and settled. Human development activities have caused the retreat of Pygmy Hippo into diminishing parcels of forest, which are becoming increasingly fragmented and insular. Although Pygmy Hippo are unlikely to be a primary target for subsistence hunting, they are likely taken opportunistically by bushmeat hunters. In addition, the effects of national and international conflicts in eastern Sierra Leone, Guinea and Liberia are unknown, but lessen the probability of Pygmy Hippo persistence. The border area between the Guinea and Liberia has been under increasing pressure from the impacts of Liberian war refugee settlements. Although protection level for Pygmy Hippo in Guinea, Côte d'Ivoire, and Sierra Leone was described as complete, the level of enforcement is unknown. Reports from Côte d'Ivoire suggest that enforcement is limited due to lack of resources and civil unrest. Along the Côte D'ivoire-Liberian border, poaching and intense logging appear linked as logged forests are more easily accessible (Alonso et al. 2005).

In Liberia, where the majority of remaining Pygmy Hippos are believed to reside, legal protection is described as incomplete, and the level of enforcement of protection is described as poor. Pygmy Hippo protection has historically been most effective in the Sapo National Park. However, recent reports from Flora and Fauna International suggest that current legal protection has been suspended and Pygmy Hippos are being hunted for meat in the Park. Liberia’s Cestos-Senkwehn Rivershed, located in south-central area of the country, was believed to be home to substantial numbers of Pygmy Hippos based on a forest survey conducted in 1998. Since that time, Cestos-Senkwehn area has been largely logged and developed (Robinson and Suter 1999). In 1999, almost 190 million cubic meters of wood was exported from Liberia. The scope of the deforestation has alarmed Liberian government officials. In April 2000, Liberia's Minister of Agriculture, Roland Massaquoi, in criticizing the way logging companies were operating stated "it is evident that most of the country's natural rainforests has been depleted without reforestation". This alarming rate of deforestation has been confirmed by Friends of Liberia (FOL), Society for the Renewal of Nature Conservation in Liberia, and independent researchers.

The evidence suggests that habitat in protected areas in all resident countries is under siege. Pygmy Hippos, by nature of their habitat requirements, are extremely sensitive to this loss. The current population threats—deforestation for logging and human settlement, hunting, and regional conflicts—continue to threaten remaining Pygmy Hippo individuals. The conservation status of the Pygmy Hippo in Liberia is poor. At the present rate of habitat loss, only small insular populations will remain and, in the total absence of any regional conservation plans, effective protection or conservation actions, viability of this species should be considered extremely poor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats to the Pygmy Hippopotamus include deforestation, hunting, agricultural land development, and civil conflicts. Although Pygmy Hippos are legally protected in most of the regions where they are found, there are few resources to enforce their protection and numbers in the wild continue to decrease.

Public Domain

Harvard Museum of Natural History

Source: Harvard Museum of Natural History Africa Hall

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Deforestation is the main threat facing the pygmy hippopotamus (2). Hunting is also known to occur, but the extent of this has not been determined (2). The subspecies C. l. heslopi in Nigeria may already be extinct (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included on Appendix II of CITES (as Hexaprotodon liberiensis). It is fully protected legally in all countries. It is protected in Liberia under the Wildlife and National Park Act of 1988, but enforcement of the regulations is loose except in Sapo National Park, where protection is good.

A vital area for the Pygmy Hippo's protection is the Sapo forest in eastern Liberia. A 509-square-mile block of this forest was chartered as Sapo National Park in 1983, establishing its only national park. Another key area in which the species occurs is in the Tai National Park in western Côte d'Ivoire. Tai is now subject to poaching, agricultural encroachment and gold mining in the park's river beds.

Captive Breeding
As of the end of 2004, the latest edition of the International Studbook for the Pygmy Hippopotamus recorded some 303 animals (290 captive-born) from a founder population of 70, in 135 zoos in captivity (Hlavacek et al. 2005). The species breeds freely in captivity and most, if not all, of the specimens listed have been born in zoos to captive-bred parents. The world population of captive born animals has more than doubled since 1970.

Whilst the future of the species in captivity seems assured, the conditions under which it is kept need reconsideration given that most collections consist of a pair that are kept permanently together in a pool of water. Evidence from the wild suggests that Pygmy Hippopotamus come together infrequently and do not spend much time immersed in the water. The causes of death mentioned in the Studbook include many references to attacks by mates, maternal neglect and injuries inflicted by the mother. It is possible that many of these deaths are due to stress from the artificial conditions of captivity and greater attention to the way of life in the wild might help to reduce this mortality.

There are no current research projects investigating Pygmy Hippo ecology or conservation in the wild. In addition, there is little action being taken to protect Pygmy Hippo habitat or populations.

Objectives:

1. To ensure, as a first priority, that the species can continue to survive in the Liberian forests without further reduction or fragmentation of its range.

2. To establish more precisely the distribution and numbers of the species throughout its range but more particularly in Liberia, where the bulk of the population occurs.

3. To identify secure regions where conservation action can be concentrated.

4. To establish whether or not the isolated population reported from Nigeria still exists and if it does, to develop plans for its enhanced future protection.

(The alleged population in Guinea-Bissau is so improbable that the time and money that would be involved in an attempt to establish its existence are unlikely to be justified.)

Priority Projects
1. Establish a reliable method for assessing the sizes of the various populations.

It is unlikely that such an elusive creature can be counted accurately and attention should be paid to developing indirect techniques that will provide an index of density, as has been done with forest elephants. These may include, for example, counts of dunging areas, trails or nest sites.

2. Identify and give special protection to areas containing adequate populations of the species and which appear free from the threat of deforestation.

This does not necessarily mean according them national park status, which might be difficult to achieve. In any case, even if new parks were created they might not be large enough to contain viable populations. As the only national park in Liberia, however, special attention should be given to Sapo National Park particularly as the species was recently recorded there.

3. Monitor the species in protected areas on a permanent basis using techniques developed for census purposes.

4. Identify potential threats to the species in each area and take steps to remove them.

Apart from the obvious problem of deforestation, attention should be paid to possible threats from meat hunting and the trophy trade. Education should play a prominent role in such projects in making local people aware of the rarity and uniqueness of the pygmy hippopotamus.

5. Mount expeditions to those regions of Nigeria where the species was last reported in order to look for evidence of its continued existence.

If it is shown to survive there, special efforts should be made to assist the development of management strategies for its enhanced future protection and to determine the taxonomic as well as the conservation status of this population.

6. Coordinate the international captive breeding effort to take advantage of recent computer programmes for analysing stud book data and to ensure that maximum use is made of the genetic potential of the existing captive population.

7. Study the behaviour of the species under a variety of captive conditions in order to generate information of benefit to their enhanced future husbandry, with particular reference to the habits of the animals in the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Direct conservation action is required to prevent precipitous declines and potential extinction (7). At present there is a good captive population, which has bred successfully in captivity and has doubled in size over the last 25 years (2). If the wild population becomes extinct, it should be possible to maintain the species in captivity, providing a last-ditch safeguard against total extinction (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Hexaprotodon liberiensis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Pygmy hippos are hunted as a source of bushmeat.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pygmy hippopotamus

The pygmy hippopotamus (Choeropsis liberiensis or Hexaprotodon liberiensis) is a small hippopotamid native to the forests and swamps of West Africa, primarily in Liberia and small populations in Sierra Leone, Guinea and Ivory Coast. The pygmy hippo is reclusive and nocturnal. It is one of only two extant species in the Hippopotamidae family, the other being its much larger cousin the common hippopotamus.

The pygmy hippopotamus displays many terrestrial adaptations, but like its larger cousin, it is semi-aquatic and relies on proximity to water to keep its skin moisturized and its body temperature cool. Behaviors such as mating and giving birth may occur in water or on land. The pygmy hippo is herbivorous, feeding on ferns, broad-leaved plants, grasses and fruits it finds in the forests.

A rare nocturnal forest creature, the pygmy hippopotamus is a difficult animal to study in the wild. Pygmy hippos were unknown outside of West Africa until the 19th century. Introduced to zoos in the early 20th century, they breed well in captivity and the vast majority of research is derived from zoo specimens. The survival of the species in captivity is more assured than in the wild; the World Conservation Union estimates that there are fewer than 3,000 pygmy hippos remaining in the wild.[1] Pygmy hippos are primarily threatened by loss of habitat, as forests are logged and converted to farm land, and are also vulnerable to poaching, hunting, natural predators and war.

Taxonomy and origins[edit]

Nomenclature of the pygmy hippopotamus reflects that of the hippopotamus. The plural form is pygmy hippopotami (hippopotamuses is also accepted as a plural form by the OED, or pygmy hippos for short). A male pygmy hippopotamus is known as a bull, a female as a cow, and a baby as a calf.

Skull of a pygmy hippopotamus

The pygmy hippopotamus is a member of the family Hippopotamidae where it is classified as a member of either the genus Choeropsis ("resembling a hog") or, the genus Hexaprotodon ("six front teeth"). Members of Hippopotamidae are sometimes known as hippopotamids. Sometimes the sub-family Hippopotaminae is used. Further, some taxonomists group hippopotami and anthracotheres in the superfamily Anthracotheroidea or Hippopotamoidea.

A sister species of the pygmy hippopotamus may have been the little-studied Malagasy pygmy hippopotamus (Hexaprotodon madagascariensis or Hippopotamus madagascariensis), one of three recently extinct species from Madagascar. C. madagascariensis was the same size as C. liberiensis and shared its terrestrial behavior, inhabiting the forested highlands of Madagascar, rather than open rivers. It is believed to have gone extinct within the last 500 years.[3][4][5]

The taxonomy of the genus of the pygmy hippopotamus has changed as understanding of the animal has developed.[1][6][7][8] Samuel G. Morton initially classified the animal as Hippopotamus minor, but later determined it was distinct enough to warrant its own genus, and labeled it Choeropsis. In 1977, Coryndon proposed that the pygmy hippopotamus was closely related to Hexaprotodon, a genus that consisted of prehistoric hippos mostly native to Asia.[9] This assertion was widely accepted,[1][6][7][8] until Boisserie asserted in 2005 that the pygmy hippopotamus was not a member of Hexaprotodon, after a thorough examination of the phylogeny of Hippopotamidae; he suggested instead that the pygmy hippopotamus was a distinct genus, and returned the animal to Choeropsis.[6][10][11] All agree that the modern pygmy hippopotamus, be it H. liberiensis or C. liberiensis, is the only extant member of its genus.[6][9]

Nigerian subspecies[edit]

A distinct subspecies of pygmy hippopotamus lived in Nigeria until at least the 20th century, though the validity of this has been questioned.[1] The existence of the subspecies, makes Choeropsis liberiensis liberiensis (or Hexaprotodon liberiensis liberiensis under the old classification) the full trinomial nomenclature for the Liberian pygmy hippopotamus. The Nigerian pygmy hippopotamus was never studied in the wild and never captured. All research and all zoo specimens are the Liberian subspecies. The Nigerian subspecies is classified as C. liberiensis heslopi.[7]

The Nigerian pygmy hippopotamus ranged in the Niger River Delta, especially near Port Harcourt, but no reliable reports exist after the collection of the museum specimens secured by I. R. P. Heslop, a British colonial officer, in the early 1940s. It is probably extinct.[1] The subspecies is separated by over 1,800 kilometres (1,100 mi) and the Dahomey Gap, a region of savanna that divides the forest regions of West Africa. The subspecies is named after I. R. P. Heslop, who claimed in 1945 to have shot a pygmy hippo in the Niger Delta region and collected several skulls. He estimated that perhaps no more than 30 pygmy hippos remained in the region.[12]

Heslop reportedly sent four pygmy hippopotamus skulls he collected to the British Museum of Natural History in London. These specimens were not subjected to taxonomic evaluation, however, until 1969 when G. B. Corbet classified the skulls as belonging to a separate subspecies based on consistent variations in the proportions of the skulls.[13] The Nigerian pygmy hippos were seen or shot in Rivers State, Imo State and Bayelsa State, Nigeria. While some local populations are aware that the species once existed, its history in the region is poorly documented.[7]

Evolution[edit]

Anthracotheres like Anthracotherium resembled pygmy hippos and are among their likely ancestors

The evolution of the pygmy hippopotamus is most often studied in the context of its larger cousin. Both species were long believed to be most closely related to the family Suidae (pigs and hogs) or Tayassuidae (peccaries), but research within the last 10 years has determined that pygmy hippos and hippos are most closely related to cetaceans (whales and dolphins). Hippos and whales shared a common semi-aquatic ancestor that branched off from other artiodactyls around 60 mya.[14][15] This hypothesized ancestor likely split into two branches about six million years later.[16] One branch would evolve into cetaceans, the other branch became the anthracotheres, a large family of four-legged beasts, whose earliest member, from the Late Eocene, would have resembled narrow hippopotami with comparatively small and thin heads.[10]

Hippopotamids are deeply nested within the family Anthracotheriidae. The oldest known hippopotamid is the genus Kenyapotamus, which lived in Africa from 16 to 8 mya. Kenyapotamus is known only through fragmentary fossils, but was similar in size to C. liberiensis.[11] The Hippopotamidae are believed to have evolved in Africa, and while at one point the species spread across Asia and Europe, no hippopotami have ever been discovered in the Americas. Starting 7.5 to 1.8 mya the Archaeopotamus, likely ancestors to the genus Hippopotamus and Hexaprotodon, lived in Africa and the Middle East.[6]

While the fossil record of hippos is still poorly understood, the lineages of the two modern genera, Hippopotamus and Choeropsis, may have diverged as far back as 8 mya. The ancestral form of the pygmy hippopotamus may be the genus Saotherium. Saotherium and Choeropsis are significantly more basal than Hippopotamus and Hexaprotodon, and thus more closely resemble the ancestral species of hippos.[6][11]

Extinct pygmy and dwarf hippos[edit]

Several species of small hippopotamids have also become extinct in the Mediterranean in the late Pleistocene or early Holocene. Though these species are sometimes known as "pygmy hippopotami" they are not believed to be closely related to C. liberiensis. These include the Cretan dwarf hippopotamus (Hippopotamus creutzburgi), the Sicilian hippopotamus (Hippopotamus pentlandi), the Maltese hippopotamus (Hippopotamus melitensis) and the Cyprus dwarf hippopotamus (Hippopotamus minor).[17]

These species, though comparable in size to the pygmy hippopotamus, are considered dwarf hippopotamuses, rather than pygmies. They are likely descended from a full-sized species of European hippopotamus, and reached their small size through the evolutionary process of insular dwarfism which is common on islands; the ancestors of pygmy hippopotami were also small and thus there was never a dwarfing process.[17] There were also several species of pygmy hippo on the island of Madagascar (see Malagasy hippopotamus).

Description[edit]

Pygmy hippos share the same general form as a hippopotamus. They have a graviportal skeleton, with four stubby legs and four toes on each foot, supporting a portly frame. The pygmy hippo, however, is only half as tall as the hippopotamus and weighs less than 1/4 as much as its larger cousin. Adult pygmy hippos stand about 75–83 cm (2.46–2.72 ft) high at the shoulder, are 150–177 cm (4.92–5.81 ft) in length and weigh 180–275 kg (397–606 lb).[7] Their lifespan in captivity ranges from 30 to 55 years, though it is unlikely that they live this long in the wild.[7][18]

A pygmy hippopotamus resting at Louisville Zoo; the skull of a pygmy hippo has less pronounced orbits and nostrils than a common hippopotamus

The skin is greenish-black or brown, shading to a creamy gray on the lower body. Their skin is very similar to the common hippo's, with a thin epidermis over a dermis that is several centimeters thick. Pygmy hippos have the same unusual secretion as common hippos, that gives a pinkish tinge to their bodies, and is sometimes described as "blood sweat" though the secretion is neither sweat nor blood. The highly alkaline substance is believed to have antiseptic and sunscreening properties. The skin of hippos dries out quickly and cracks, which is why both species spend so much time in water.[7]

The skeleton of C. liberiensis is more gracile than that of the common hippopotamus, meaning their bones are proportionally thinner. The common hippo's spine is parallel with the ground; the pygmy hippo's back slopes forward, a likely adaptation to pass more easily through dense forest vegetation. Proportionally, the pygmy hippo's legs and neck are longer and its head smaller.

A nuzzling couple at the Duisburg Zoo in Germany

The orbits and nostrils of a pygmy hippo are much less pronounced, an adaptation from spending less time in deep water (where pronounced orbits and nostrils help the common hippo breathe and see). The feet of pygmy hippos are narrower, but the toes are more spread out and have less webbing, to assist in walking on the forest floor.[18] Despite adaptations to a more terrestrial life than the common hippopotamus, pygmy hippos are still more aquatic than all other even-toed ungulates. The ears and nostrils of pygmy hippos have strong muscular valves to aid submerging underwater, and the skin physiology is dependent on the availability of water.[7][8]

Behavior[edit]

The behavior of the pygmy hippo differs from the common hippo in many ways. Much of its behavior is more similar to that of a tapir, though this is an effect of convergent evolution.[8] While the common hippopotamus is gregarious, pygmy hippos live either alone or in small groups, typically a mated pair or a mother and calf. Pygmy hippos tend to ignore each other rather than fight when they meet. Field studies have estimated that male pygmy hippos range over 1.85 square kilometres (460 acres), while the range of a female is between 0.4 to 0.6 square kilometres (99 to 148 acres).[7]

(video) A pygmy hippopotamus rests in some water to help prevent its skin from cracking at Ueno Zoo in Japan

Pygmy hippos spend most of the day hidden in rivers. They will rest in the same spot for several days in a row, before moving to a new spot. At least some pygmy hippos make use of dens or burrows that form in river banks. It is unknown if the pygmy hippos help create these dens, or how common it is to use them. Though a pygmy hippo has never been observed burrowing, other artiodactyls, such as warthogs, are burrowers.[7]

Diet[edit]

Like the common hippopotamus, the pygmy hippo emerges from the water at dusk to feed. It relies on game trails to travel through dense forest vegetation. It marks trails by vigorously waving its tail while defecating to further spread its feces. The pygmy hippo spends about six hours a day foraging for food.[7]

Pygmy hippos are herbivorous. They do not eat aquatic vegetation to a significant extent and rarely eat grass because it is uncommon in the thick forests they inhabit. The bulk of a pygmy hippo's diet consists of ferns, broad-leaved plants and fruits that have fallen to the forest floor. The wide variety of plants pygmy hippos have been observed eating suggests that they will eat any plants available. This diet is of higher quality than that of the common hippopotamus.[7]

Reproduction[edit]

Baby pygmy hippopotamus stands near its parent at a zoo in Jihlava, Czech Republic

A study of breeding behavior in the wild has never been conducted; the artificial conditions of captivity may cause the observed behavior of pygmy hippos in zoos to differ from natural conditions. Sexual maturity for the pygmy hippopotamus occurs between three and five years of age.[8] The youngest reported age for giving birth is a pygmy hippo in the Zoo Basel, Switzerland which bore a calf at three years and three months.[7] The oestrus cycle of a female pygmy hippo lasts an average of 35.5 days, with the oestrus itself lasting between 24–48 hours.[1][19]

Pygmy hippos consort for mating, but the duration of the relationship is unknown. In zoos they breed as monogamous pairs. Copulation can take place on land or in the water, and a pair will mate one to four times during an oestrus period. In captivity, pygmy hippos have been conceived and born in all months of the year.[8] The gestation period ranges from 190–210 days, and usually a single young is born, though twins are known to occur.[7]

The common hippopotamus gives birth and mates only in the water, but pygmy hippos mate and give birth on both land and water. Young pygmy hippos can swim almost immediately. At birth, pygmy hippos weigh 4.5–6.2 kg (9.9–13.7 lb) with males weighing about 0.25 kg (0.55 lb) more than females. Pygmy hippos are fully weaned between six and eight months of age; before weaning they do not accompany their mother when she leaves the water to forage, but instead hide in the water by themselves. The mother returns to the hiding spot about three times a day and calls out for the calf to suckle. Suckling occurs with the mother lying on her side.[7]

Conservation[edit]

A pair of pygmy hippos at the Mount Kenya Wildlife Conservancy

The greatest threat to the remaining pygmy hippopotamus population in the wild is loss of habitat. The forests in which pygmy hippos live have been subject to logging, settling and conversion to agriculture, with little efforts made to make logging sustainable. As forests shrink, the populations become more fragmented, leading to less genetic diversity in the potential mating pool.[1]

Because of their reclusive lifestyle they are not a target of subsistence hunting, though they are hunted opportunistically by bush hunters. Their meat is said to be of excellent quality, like that of a wild boar; unlike those of the common hippo, the pygmy hippo's teeth have no value.[8] The effects of West Africa's civil strife on the pygmy hippopotamus are unknown, but unlikely to be positive.[1] The pygmy hippopotamus is capable of being killed by leopards, pythons and crocodiles. How often this occurs, however, is unknown.[7]

C. liberiensis was identified as one of the top-10 "focal species" in 2007 by the Evolutionarily Distinct and Globally Endangered (EDGE) project.[20] Some populations inhabit protected areas, such as the Gola Forest Reserve in Sierra Leone.[21]

The Zoo Basel in Switzerland holds the international studbook and coordinates the entire captive pygmy hippo population that freely breeds in zoos around the world. Between 1970 and 1991 the population of pygmy hippos born in captivity more than doubled. The survival of the species in zoos is more certain than the survival of the species in the wild.[18][22] In captivity, the pygmy hippo lives from 42 to 55 years, longer than in the wild.[7] Since 1919, only 41 percent of pygmy hippos born in zoos have been male.[19]

History and folklore[edit]

Pair of pygmy hippos at the Mount Kenya Wildlife Conservancy

While the common hippopotamus was known to Europeans since classical antiquity, the pygmy hippopotamus was unknown outside of its range in West Africa until the 19th century. Due to their nocturnal, forested existence, they were poorly known within their range as well. In Liberia the animal was traditionally known as a water cow.[8]

Early field reports of the animal misidentified it as a wild hog. Several skulls of the species were sent to the American natural scientist Samuel G. Morton, during his residency in Monrovia, Liberia. Morton first described the species in 1843. The first complete specimens were collected as part of a comprehensive investigation of Liberian fauna in the 1870s and 1880s by Dr. Johann Büttikofer. The specimens were taken to the Natural History Museum in Leiden, The Netherlands.[8]

The first pygmy hippo was brought to Europe in 1873 after being captured in Sierra Leone by a member of the British Colonial Service but died shortly after arrival. Pygmy hippos were successfully introduced to Europe in 1911. They were first shipped to Germany and then to the Bronx Zoo in New York City where they also thrived.[7][8]

In 1927, Harvey Firestone of Firestone Tires presented Billy the pygmy hippo to U.S. President Calvin Coolidge. Coolidge donated Billy to the National Zoo in Washington, D.C. According to the zoo, Billy is a common ancestor to most pygmy hippos in U.S. zoos today.[18][23]

Several folktales have been collected about the pygmy hippopotamus. One tale says that pygmy hippos carry a shining diamond in their mouths to help travel through thick forests at night; by day the pygmy hippo has a secret hiding place for the diamond, but if a hunter catches a pygmy hippo at night the diamond can be taken. Villagers sometimes believed that baby pygmy hippos do not nurse but rather lick secretions off the skin of the mother.[8]

References[edit]

  1. ^ a b c d e f g h i j Lewison, R. & Oliver, W. (IUCN SSC Hippo Specialist Subgroup) (2008). Hexaprotodon liberiensis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 17 December 2006. Database entry includes a brief justification of why this species is of endangered.
  2. ^ "ITIS on Hexaprotodon liberiensis". Integrated Taxonomic Information System. Retrieved 2004-08-11. 
  3. ^ Harris, J.M. (1991). "Family Hippopotamidae". Koobi Fora Research Project. Vol. 3. the Fossil Ungulates: Geology, Fossil Artiodactyls and Paleoenvironments (Clarendon Press, Oxford): 31–85. 
  4. ^ Oliver, W.L.R. (1995). "Taxonomy and Conservation Status of the Suiformes — an Overview" (PDF). IBEX Journal of Mountain Ecology. 
  5. ^ "Hippopotamus madagascariensis". IUCN Red List of Threatened Species. 2002. Retrieved 2008-08-23. 
  6. ^ a b c d e f Boisserie, Jean-Renaud (2005). "The phylogeny and taxonomy of Hippopotamidae (Mammalia: Artiodactyla): a review based on morphology and cladistic analysis". Zoological Journal of the Linnean Society 143: 1–26. doi:10.1111/j.1096-3642.2004.00138.x. Retrieved 2007-06-01. 
  7. ^ a b c d e f g h i j k l m n o p q r Eltringham, S. Keith (1999). The Hippos. London: Academic Press. ISBN 0-85661-131-X. 
  8. ^ a b c d e f g h i j k Robinson, Phillip T. River Horses and Water Cows. Hippo Specialist Group of the World Conservation Union. Retrieved on 2007-07-30.
  9. ^ a b "The taxonomy and nomenclature of the Hippopotamidae (Mammalia, Artiodactyla) and a description of two new fossil species". Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen 80 (2): 61–88. 1977. 
  10. ^ a b Boisserie, Jean-Renaud; Fabrice Lihoreau and Michel Brunet (February 2005). "The position of Hippopotamidae within Cetartiodactyla". Proceedings of the National Academy of Sciences 102 (5): 1537–1541. doi:10.1073/pnas.0409518102. PMC 547867. PMID 15677331. Retrieved 2007-06-09. 
  11. ^ a b c Boisserie, Jean-Renaud; Fabrice Lihoreau and Michel Brunet (March 2005). "Origins of Hippopotamidae (Mammalia, Cetartiodactyla): towards resolution". Zoologica Scripta 34 (2): 119–143. doi:10.1111/j.1463-6409.2005.00183.x. Retrieved 2007-06-01. 
  12. ^ "Pigs, Peccaries and Hippos Status Survey and Action Plan". World Conservation Union status survey. 1993. Archived from the original on January 5, 2008. Retrieved 2008-08-23. 
  13. ^ Corbet, G. B. (1969). "The taxonomic status of the pygmy hippopotamus, Choeropsis liberiensis, from the Niger Delta". Journal of Zoology 158: 387–394. doi:10.1111/j.1469-7998.1969.tb02156.x. 
  14. ^ "Scientists find missing link between the dolphin, whale and its closest relative, the hippo". Science News Daily. 2005-01-25. Retrieved 2008-08-23. 
  15. ^ Gatesy, J (1 May 1997). "More DNA support for a Cetacea/Hippopotamidae clade: the blood-clotting protein gene gamma-fibrinogen". Molecular Biology and Evolution 14 (5): 537–543. doi:10.1093/oxfordjournals.molbev.a025790. PMID 9159931. 
  16. ^ Ursing, B.M.; U. Arnason (1998). "Analyses of mitochondrial genomes strongly support a hippopotamus-whale clade". Proceedings of the Royal Society 265 (1412): 2251–5. doi:10.1098/rspb.1998.0567. PMC 1689531. PMID 9881471. 
  17. ^ a b Petronio, C. (1995). "Note on the taxonomy of Pleistocene hippopotamuses" (PDF). Ibex 3: 53–55. Retrieved 2008-08-23. 
  18. ^ a b c d "Pygmy Hippo fact sheet". National Zoological Park. Retrieved 2008-08-23. 
  19. ^ a b Zschokke, Samuel (2002). "Distorted Sex Ratio at Birth in the Captive Pygmy Hippopotamus, Hexaprotodon Liberiensis". Journal of Mammalogy 83 (3): 674–681. doi:10.1644/1545-1542(2002)083<0674:DSRABI>2.0.CO;2. 
  20. ^ "Protection for 'weirdest' species". BBC. 2007-01-16. Retrieved 2008-08-23. 
  21. ^ Visitsierraleone.org
  22. ^ Eltringham, S. Keith (1993). "Pigs, Peccaries and Hippos Status Survey and Action Plan". IUCN. Archived from the original on January 5, 2008. 
  23. ^ Jablonski, Nina G. (2004). "The hippo’s tale: how the anatomy and physiology of Late Neogene Hexaprotodon shed light on Late Neogene environmental change". Quaternary International 117: 119–123. doi:10.1016/S1040-6182(03)00121-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!