Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Comprehensive Description

General Description

Forewing white heavily stippled with brown, broad brown AM, PM and terminal bands; hindwing ochre-brown with dark brown mottling and PM band. Discal spots relatively large and conspicuous. Female slightly smaller and paler overall. Very similar to E. discospilata, but males are larger and darker. Genitalic dissection is required to confirm identification (see McGuffin 1977). Treated as a subspecies of E. notataria in some older works.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Northeastern BC east to Newfoundland (McGuffin 1977).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Occurs in lodgepole and jack pine forest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Larvae feed on various species of pine, including Lodgepole Pine (Pinus contortus) and Jack Pine (Pinus banksiana) (Prentice 1963, as E. notataria).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults fly in spring, peaking in early to mid June.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Adults are diurnal but are also attracted to lights at night. The larva is green and slender with a pale lateral line, mimicking pine needles. The pupa overwinters (Wagner et al. 2001). McGuffin (1977) gives a detailed description of the immature stages.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eufidonia convergaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAACATTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGTGGATTTGGGAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTGTTACCCCCTTCTATTACACTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGAACTGGTTGAACAGTATACCCACCTTTATCTTCTAATATTGCTCATGGAGGAAGTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGACTAAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTTTATTACTACTATCTTTACCGGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTGAATACATCATTTTTTGATCCAGCTGGAGGAGGAGATCCGATCCTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eufidonia convergaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 74
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Not of concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eufidonia convergaria

The Pine Powder Moth or Converged Powder Moth (Eufidonia convergaria) is a species of moth of the Geometridae family. It is found from Newfoundland to British Columbia and the north-western parts of the United States.


The wingspan is 22–30 mm. The moth flies from May to July depending on the location.

The larvae feed on pinus species, including White Pine, Lodgepole Pine, Jack Pine.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!