Articles on this page are available in 3 other languages: Spanish (29), Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Short-beaked common dolphins hunt in groups of ten to ten thousand animals. They can reach speeds up to 45 kilometers per hour. They are also attracted to ships and like to play in their bow waves. Short-beaked common dolphins live in oceans; they aren't often seen swimming close to shore, usually preferring water no shallower than 200 meters. Nevertheless, they are occasionally seen in the Dutch section of the North Sea. Short-beaked common dolphins are the most common dolphin species in the region of the Mediterranean Sea. Pictures on ancient Greek vases show that it's been that way for centuries.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Short-beaked saddleback dolphins are found in tropical and temperate ocean waters and in some seas. School of fewer than ten - and of several thousand - have been reported. They eat both squid and fish. Calves, which are less than a meter long at birth, are usually born in the spring and summer after a gestation that is thought to last 10-11 months. In most members of the family Delphinidae - the dolphins - calves begin to eat solid food at about 4-6 months, but may continue to nurse as long as two years. The Delphinidae is a very large and diverse family of cetaceans, however, and much remains to be learned about the life styles of its members.

Links:
Mammal Species of the World
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

These fast-swimming dolphins are highly active (1), often leaping clear of the water (breaching), and slapping their flippers on the water surface (lobtailing) (3). They occur in large groups (3) of between 10 and 500 individuals (1), the size of group depending on both the time of day and year (3). The approach of these groups can be detected from miles away (1), and some noises made by this species can be heard from above the surface of the water (3). They feed on small fish and cephalopods such as squid (1), and are known to use co-operative methods of hunting (4). They make short dives typically of between 10 seconds and 2 minutes, but dives lasting for as long as 8 minutes have been recorded (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The short-beaked common dolphin is the commonest dolphin species (1), but exact numbers are unknown (3). It is easily identified owing to the obvious 'hourglass' pattern on the flanks, which creates a dark V-shape below the dorsal fin (1). Considerable variation in colours and patterns exists within this species (3), and in 1994 a new species, the long-beaked common dolphin was recognised, based on both anatomical and genetic differences (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 Delphinus delphis is among the most colourful of cetaceans. Its slender body is characterized by a well defined hour-glass pattern on the flanks. A yellow panel is present on the front and a grey one at the rear. A black cape forms a characteristic point on the flank, level with the dorsal fin. The belly is white and back black. Full-grown adults are 2-2.5 m long and calves 0.8 m long. The head has a black eye patch and there is a black stripe running from the corner of the mouth to the flipper. The beak is black or may be pale-tipped. Each half of both jaws contains 40-61 teeth.This highly gregarious species lives in pods of several hundreds to thousands of animals, depending on the time of day and time of year. Some observations suggest that permanent social units contain fewer than 30 dolphins (Nowak, 2003). Delphinus delphis usually travels at 10 km/hr but is capable of reaching more than 40 km/hr (Nowak, 2003). The common dolphin is highly vocal, producing clicks for echolocation, whistles for group coordination and various other sounds. This species is often seen breaching and somersaulting out of water and riding the bow waves of ships (Jefferson et al, 1993). It can dive to 280 m and remain submerged for 8 minutes. However, they usually remain below the surface for between 2 seconds and 2 minutes (Kinze, 2002). The calf is nursed by the mother for up to a year. For information on how to report dolphin sightings see 'Sealife Signpost'.

 Delphinus delphis is listed in the UK Biodiversity Action Plan list of Species of Conservation Concern (Biodiversity Steering Group, 1995; Anon, 1999 (e) ). All species of cetaceans are given protection under the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Order 1985. All cetacean species are listed on Annex A of EU Council Regulation 338/97 and therefore treated by the EU as if they are on CITES Appendix I thus prohibiting their commercial trade. The common dolphin is listed in Annex II and IV (Animal and Plant Species of Community Interest in Need of Strict Protection) of the EC Habitats Directive. Under Annex IV the keeping, sale or exchange of the species is banned, as well as deliberate capture, killing or disturbance. The Directive requires that member states monitor the incidental capture and killing of all dolphins. An 'Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas' (ASCOBANS), formulated in 1992, has now been signed by seven European countries, including the UK. The Agreement makes provision for protection of specific areas, monitoring, research, information exchange, pollution control and heightening public awareness. The Bonn Convention includes North and Baltic Sea populations of common dolphin on Appendix II.

 A report on dolphins in the south west of England (Marine Connection & Wildlife Trusts, 2007) informs of large increases in sightings of Delphinus delphis since 2000, with a peak from December to February.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circumglobal
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common dolphins can be found throughout the Atlantic and Pacific Oceans. They are abundant in the Mediterranean Sea, as well as in the Black Sea, the Gulf of Mexico, and the Red Sea. At times, these dolphins follow the Gulf Stream up to Norwegian waters. In addition, scattered populations have been found in the Indian Ocean and waters near Japan. They seldom venture into the Arctic.

(Baker, 1987;   http://whales.ot.com/).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The short-beaked common dolphin is an oceanic species that is widely distributed in tropical to cool temperate waters of the Atlantic and Pacific Oceans (Perrin 2002), from nearshore waters to thousands of kilometers offshore. They regularly occur in some enclosed seas, such as the Okhotsk Sea and Sea of Japan, and separate subpopulations exist in the Mediterranean and Black seas. Short-beaked common dolphins may occur in parts of the Indian Ocean around southeastern Africa and southern Australia, but previous records of this species in other parts of the Indian Ocean and in waters of Taiwan are now thought to have been of long-beaked common dolphins (D. capensis; Jefferson and Van Waerebeek 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Worldwide in subtropical and warm temperate oceans, including the Mediterranean Sea and Black Sea. In the Pacific Ocean, ranges from British Columbia south to Chile and out to 135 degrees west longitude; there are few records from the Gulf of California; documented from New Caledonia, New Zealand, and Japanese waters in the western Pacific, and there are records from north of Hawaii; range may extend entirely across the tropical and temperate North Pacific; records from the western Atlantic range from at least Florida to Newfoundland and in the eastern Atlantic from northern Europe to the west coast of Africa (Heyning and Perrin 1994). Abundant in waters of eastern North America, ranging north in large numbers to near Nova Scotia and Newfoundland in summer; otherwise, generally ranges from Gulf of Maine to Chesapeake Bay area (Gaskin 1992). Penetrates tropical zone where relatively cool waters keep surface temperature between about 15 to 26 C (Mead and Brownell, in Wilson and Reeder 1993, Gaskin 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Mediterranean Sea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in all tropical, subtropical and warm temperate seas (5). Common, with a wide distribution in the eastern north Atlantic Ocean. Around the UK it is abundant in the western approaches to the English Channel, west of Ireland, in the southern Irish Sea and in the vicinity of the Inner Hebrides, reaching as far north as Skye (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The common dolphin is one of the smallest dolphins. Overall length can vary from 5 feet to a maximum of 8 feet. Females are slightly smaller than males. The common dolphin has a dorsal fin that is almost triangular, in addition to small flippers and flukes. The beak is sharply divided from the lower forehead by a deep groove. The beak is elongated and pointed more than any other species of the same genus. The jaws on each side of the beak are lined with 20 or more small, sharp, recurved teeth, perfect for catching slippery fish. Common dolphins are a colorful dolphin species. The back is either black or dark brown, and they have a white or cream-colored underside. A dark streak stretches from the the lower jaw to the flipper. The flippers and flukes are the same color as the back, black or dark brown, and the eyes are encirled with black markings that extend to the beak. The most distinctive feature is a crisscross pattern which runs across the dolphin's side. It resembles an hourglass and divides the top and bottom colors. This band is a buffy tan in front and gray towards the tail. This characteristic has given this species the nickname "crisscross dolphin".

(Allen, 1979; Baker, 1987; Flower, 1866).

Range mass: 100 to 136 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 2600 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are 5% larger than females.

Length:
Range: 1.7-2.2 m males; 1.6-2.2 m females

Weight:
Range: up to 110 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Delphinus delphis (Linnaeus, 1758)
Catalog Number: USNM A4107
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Mature
Preparation: Skull
Locality: Locality Unknown, Chile, South America, South Pacific Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Delphinus delphis (Linnaeus, 1758)
Catalog Number: USNM A15781
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull
Collector(s): J. Wallace
Year Collected: 1876
Locality: New York, New York Bay, New York, United States, North America, North Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

mainly offshore
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

oceanic, tropical to temperate
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common dolphins are fond of coastal waters, but are also found well out to sea. Generally, they prefer surface temperatures greater than 10 degrees Celsius. These dolphins normally travel at 5 to 7 miles per hour (although they are known to reach speeds of 29 miles per hour when pursuing food), and can move up to 150 to 200 miles in a 48 hour period. When swimming, schools follow and dive over prominent features of the ocean bottom. Also, herd movements correlate with the seasonal shifts in population of certain fish.

(Alpers, 1961; Baker, 1987; Schevill, 1974;   http://whales.ot.com/).

Aquatic Biomes: benthic ; reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Short-beaked common dolphins appear to have a preference for upwelling-modified waters, areas with steep sea floor relief, and extensive shelf areas, but they are widespread in warm temperate and tropical waters (Evans 1994). In the eastern tropical Pacific, they prefer equatorial and subtropical waters with a shallow thermocline, relatively large seasonal changes in surface temperature, and seasonal upwelling (Reilly 1990; Fiedler and Reilly 1994).

Mediterranean common dolphins frequent coastal and upper slope waters (Bearzi et al. 2003). In the Black Sea, common dolphins are distributed mainly offshore and visit shallow coastal waters following seasonal aggregations and regular mass migrations of small pelagic fishes such as anchovy and sprat (Birkun 2006). Black Sea common dolphins avoid waters with low salinity, and this may explain why they do not occur in the Sea of Azov and in the Kerch Strait.

Associations with other marine mammal species are common. Schools in the Eastern Tropical Pacific (ETP) are sometimes associated with yellowfin tuna, and have thus been involved in tuna purse-seine fishing operations (Gerrodette 2002). Mixed-species groups of common, striped and Risso’s dolphins (Grampus griseus) have been observed frequently in the pelagic waters of the Gulf of Corinth, Greece (Frantzis and Herzing 2002). The prey of common dolphins consists largely of small schooling fishes and squids (Perrin 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Primarily pelagic, in waters of about 10-28 C; usually along or seaward of the 100 fathom contour. Young are born in the water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6965 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4409 samples.

Environmental ranges
  Depth range (m): 0 - 2150
  Temperature range (°C): 2.217 - 29.261
  Nitrate (umol/L): 0.000 - 17.224
  Salinity (PPS): 30.701 - 39.945
  Oxygen (ml/l): 4.117 - 7.897
  Phosphate (umol/l): 0.033 - 1.095
  Silicate (umol/l): 0.494 - 12.030

Graphical representation

Depth range (m): 0 - 2150

Temperature range (°C): 2.217 - 29.261

Nitrate (umol/L): 0.000 - 17.224

Salinity (PPS): 30.701 - 39.945

Oxygen (ml/l): 4.117 - 7.897

Phosphate (umol/l): 0.033 - 1.095

Silicate (umol/l): 0.494 - 12.030
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Pelagic, generally occurring well out to sea and continental shelf waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Prefers waters that have a surface temperature higher than 10°C (4). It is less commonly seen in water shallower than 180m (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Delphinus delphis feed on small fish as well as squid and octopus. Small fish include young herring, pilchard, anchovies, nocturnal hake, sardines, small bonito, as well as sauries. Individual dolphins eat up to 18 to 20 pounds of fish per day. Groups of common dolphins all feed at the same time during the night or day. They are sometimes joined by bands of bottlenose or white-sided dolphins. These feeding forays can last up to an hour. During these, each dolphin rushes to the center of the school the group has been pursuing and tries to seize as many fish as possible, which it swallows whole. Common dolphins have also been known to dive below schools and drive them to the surface. They push their prey completely out of the water and catch them in midair.

(Allen, 1979; Alpers, 1961; Baker, 1987;   http://whales.ot.com/).

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds opportunistically on pelagic schooling fishes (e.g., smelt, herring, mackerel, mullet, lantern fish) and squid.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: In the eastern tropical Pacific, northern stock population was estimated at around 500,000 in the 1980s; central stock evidently declined from around 500,000 in the late 1970s to about 250,000 in the 1980s; though data are weak, southern stock may have declined from 750,000 in 1976 to under 250,000 in 1982 (reanalysis yielded estimates that were a couple 100,000s lower) (see IUCN 1991). See IUCN (1991) for population estimates and trend information for other parts of the range (most data are difficult to interpret).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Travels in groups of a few to several thousand; commonly in groups of several hundred in the Pacific.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

small fish and cephalopods
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is know about the longevity of common dolphins. It is likely that they live over 20 years (Ronald Nowak 1999). One wild born animal was still living in captivity at about 33-34 years of age (Richard Weigl 2005). Anecdotal reports suggest they may live over 40 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Common dolphins are viviparous, as are all mammals except monotremes. Females normally give birth to one baby at a time, but have been found to carry twins or triplets. Gestation usually lasts 10 to 12 months. When the calf is born (tail first) it is 3 feet long and usually weighs 25 to 35 pounds.

Common dolphins reach sexual maturity after 12 to 15 years. Courtship occurs in the spring and fall. Males and females court by stroking each other with their flippers, by vigorously rubbing their bodies together, and by swimming along side each other. The male often rushes towards the female as if he is about to bump into her before moving away. The female often swims away from the male's pursuits. After this playful courtship, these dolphins mate in the belly-to-belly position. The male enters the female with his hidden penis and gives a short series of pelvic thrusts. Females have also been observed thrusting. Other sexual activity includes beak-genital propulsion.

Common dolphins have an estimated life span of 35 to 40 years.

(Alpers, 1961; Baker, 1979; Cousteau, 1988; McIntyre, 1974;   http://whales.ot.com/).

Range number of offspring: 1 to 3.

Range gestation period: 10 to 12 months.

Range age at sexual or reproductive maturity (female): 12 to 15 years.

Range age at sexual or reproductive maturity (male): 12 to 15 years.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 7000 g.

Average number of offspring: 1.

Babies immediately become a part of the family group. The calf stays close to its mother and never wanders more than a few feet away. The calf feeds on milk from the teats of its mother. Unlike human babies, however, dolphins do not have the lips needed to suck the teats. Also they could not breathe under water if they were able to suck. To solve these problems, the mother squirts milk into her offspring's mouth by contracting muscles. The young dolphin then goes up to the surface to breathe and then comes down for more. Dolphin milk has 6 times more protein and is much more fattening than human milk. It allows the baby dolphin to increase its weight 2 to 3 times faster than a human baby does during the first six months. Suckling goes on for about a year and a half. After six months, the baby occasionally takes solid food.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproductive parameters vary significantly among different populations. Gestation lasts 10-11 months. Lactation lasts up to 19 months, though in at least some areas young may be weaned in 6 months or less. Sexually mature in 5-7 years or more (but apparently 2-4 years in Black Sea). Calving interval averages probably somewhat over 2 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Delphinus delphis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCACAAAGACATTGGTACCCTATATTTACTATTTGGCGCTTGGGCAGGAATAGTAGGTACCGGTCTA---AGTTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTGACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCTATCATAATTGGAGGTTTTGGGAACTGATTAGTCCCCTTAATA---ATCGGAGCTCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTAATAGCATCTTCAATAATTGAGGCCGGCGCAGGTACAGGCTGAACTGTTTACCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACTATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATCATTAATATAAAACCACCCGCTATAACTCAATACCAAACACCCCTCTTCGTCTGATCTGTCTTAGTCACAGCAGTCTTACTTTTACTATCATTACCTGTTCTAGCAGCC---GGAATTACTATACTATTAACCGATCGAAATCTAAACACAACCTTTTTCGACCCGGCAGGAGGAGGTGACCCAATCTTATATCAACACTTATTCTGATTTTTTGGCCATCCTGAAGTATATATTTTAATTCTACCCGGCTTTGGAATAATTTCACACATCGTTACTTATTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Delphinus delphis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Common dolphins face many obstacles at the hands of human beings. They face exploitation by man, entanglements in fishing nets, hunting, as well as other human disturbances. These, however, can be avoided if the dolphin is lucky. Unfortunately, common dolphins, as well as other aquatic life, cannot avoid the pollution that is overtaking their habitats. Many laws have been enacted to protect the dolphins and other marine life.

(Alpers, 1961;   http://whales.ot.com/).

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Contributor/s

Justification
Despite ongoing threats to local populations, the species is widespread and very abundant (with a total population in excess of four million), and none of these threats is believed to be resulting in a major global population decline.

History
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Abundant and widespread, with limited threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed on Annex IV of the EC Habitats Directive; North and Baltic Sea, western Mediterranean, Black Sea and eastern tropical Pacific populations are listed under Appendix II of the Bonn Convention, and Appendix II of the Bern Convention (7). All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited. In the UK all cetaceans are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is a very abundant species, with many available estimates for the various areas where it occurs. In the Pacific, 2,963,000 (CV=24%) was estimated for the eastern tropical Pacific (Gerrodette and Forcada 2002), and an average of 352.000 (CV = 18%) was estimated for the US west coast based on surveys between 1991 and 2005 (Barlow and Forney in press). Off California, common dolphins show seasonal and inter-annual changes in abundance due to shifts in distribution (Forney and Barlow 1998).

In the Atlantic, abundance in European continental shelf waters was estimated at 63,400 (95%CI=27,000-149,000) in 2005 (SCANS-II project; P. Hammond pers. comm.). Offshore, abundance in a block bounded by 53-57ºN and 18-29ºW was estimated at 273,000 (95%CI=153,000-435,000) in 1995 (Cañadas et al. in press). West of the Bay of Biscay, 62,000 common dolphins were estimated in the fishing grounds of the albacore tuna driftnet fishery in 1993 (Goujon 1996). In the western North Atlantic, 121,000 (CV=0.23) were estimated to occur (Waring et al. 2006).

In the western Mediterranean, abundance has been estimated at 19,400 (95%CI=15,300-22,800) in the northern Alborán Sea between 2000 and 2004 (Cañadas 2006). Once one of the most common species in the Mediterranean Sea, the short-beaked common dolphin has experienced a generalized and major decline during the last 30-40 years (Bearzi et al. 2003). Dramatic negative trends were recorded in portions of the central Mediterranean, particularly in the northern Adriatic Sea and in the eastern Ionian Sea (Bearzi et al. 2004; 2006). Recent genetic studies indicate that population structure within the Mediterranean reflects differences in distribution pattern and habitat use by short-beaked common dolphins in the eastern (where the species is predominantly coastal) and western (where it is predominantly pelagic) portions of the basin (Natoli 2004). Genetic exchange between short-beaked common dolphins from the Mediterranean Sea and the Atlantic Ocean, to the extent that it occurs, appears to involve predominantly animals from the Alborán Sea (Natoli 2004).

The population size in the Black Sea is unknown. Line transect surveys have been conducted recently to estimate common dolphin abundance in a few parts of the range. The survey areas are small relative to the total range of the subspecies. Results suggest that current population size is at least several 10,000s, and possibly 100,000 or more (Birkun 2006). By the mid 1960s, the Black Sea subpopulation collapsed due to long-running overexploitation, and a reduction of 70% was inferred. However, directed takes continued until 1983 when cetacean hunting finally ceased. The population has not recovered (Birkun 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: See GABUNDCOM.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The common dolphin is one of the most prominent by-catches of pelagic purse-seine, driftnet and trawl fisheries. In the ETP, common dolphins are sometimes found in association with yellowfin tuna, Thunnus albacares, and annual incidental mortality in the tuna purse-seine fishery of this species has been as high as 24,307 (in 1986) (IATTC, 2006). Since the Inter-American Tropical Tuna Commission (IATTC) imposed per-vessel stock limits on the international fleet, the mortality declined to 325 in 2005 (IATTC 2006). Takes have been recorded in other purse-seine fisheries in the Indian Ocean and off the west coast of Africa (Simmons 1968). Short-beaked common dolphins are the most commonly killed cetacean in the U.S. drift gillnet fishery for sharks and swordfish, with about 2,100 estimated killed between 1990 and 2002 (Julian and Beeson 1998; Carretta et al. 2005); measures have been in place to reduce cetacean takes since 1996, and bycatch levels are not a population level concern (Carretta et al. 2006).

Incidental capture of common dolphins in European Atlantic fisheries has been well studied in recent years, and as a result of recent EU legislation, on-board observer programs are being carried out in most of the fisheries considered to have a potentially significant bycatch of common dolphins. Northridge (2006) showed that bycatches of common dolphins in European pelagic trawl fisheries probably total around 800 animals per year in UK and French pelagic trawl fisheries for sea bass. Annual catch rates in the UK sector of this fishery have been falling in recent years and the annual average total mortality recently (2000-2006) has been 170 animals in this sector. Other bycatches in the same area are known to occur in gill nets, tangle nets and possibly other fisheries (ICES 2005; Northridge 2006).

In the western North Atlantic, 105 common dolphins are taken on average each year by sink gill nets and bottom trawls (Waring et al. 2006). By-catches have also been reported from other areas (Crespo et al. 2000; Bearzi et al. 2003).

The main factors thought to have contributed, singly or in synergy, to the decline of Mediterranean short-beaked common dolphins include: 1) incidental mortality in fishing gear, especially driftnets, 2) reduced availability of prey caused by overfishing and habitat degradation, 3) contamination by xenobiotic chemicals resulting in immunosuppression and reproductive impairment, and 4) environmental changes such as increased water temperatures affecting ecosystem dynamics (Bearzi et al. 2003, 2006). A recent survey focusing on the Moroccan driftnet fishing fleet estimated that about 12,000-15,000 dolphins are killed annually around the Strait of Gibraltar (Tudela et al. 2004).

At least 840,000 dolphins were taken from the Black Sea from 1946 until a ban of small cetacean hunting was declared in Turkey in 1983. The take was certainly much greater because that value did not incorporate catch statistics from Romania (whole period), Turkey (before 1976 and after 1981) and Bulgaria (before 1958) (Birkun 2006).

Reduced prey availability is considered to be a major threat to Black Sea common dolphins (Bushuyev 2000). Of two mass mortality events that killed an unknown but certainly large number of common dolphins in 1990 and 1994 (Krivokhizhin and Birkun 1999), the latter was recognised as the result of a morbillivirus epizootic. However, both die-offs coincided with a drastic (8 to 12 fold) decline in the abundance of the two main common dolphin prey species, anchovy and sprat. Such a reduction was caused by a combination of overfishing, eutrophication and the explosive increase of the introduced ctenophore Mnemiopsis leidyi. Correlation between large die-offs of Black Sea common dolphins and prey scarcity suggests that reduced prey availability increases susceptibility to viral infection (Birkun 2006). Prey depletion caused by overfishing was considered as a main cause for the decline of common dolphins in the eastern Ionian Sea (Bearzi et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Relatively heavily exploited in the yellowfin tuna industry of the eastern tropical Pacific (1987 kill was estimated at about 20,000; not subject to any particular threat in waters off North America (Gaskin 1992). Some are killed incidental to various fisheries in other parts of the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known threats include entanglement in fishing nets, human disturbance, noise and chemical pollution, lack of food and hunting (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES. The Mediterranean population is listed in Appendices I and II of CMS.

Common dolphins, as with other species impacted by the ETP tuna purse-seine fishery, are managed both nationally by the coastal countries and internationally by the IATTC. The IATTC has imposed annual stock mortality limits on each purse seiner and has promulgated regulations regarding the safe release of dolphins (Bayliff 2001). In the eastern North Pacific, the U.S. drift gillnet fishery has been required to use acoustic warning devices since 1996 to reduce cetacean bycatch; however, some bycatch of Delphinus delphis has continued (Carretta et al. 2005).

The current ban on driftnet fishing in the Mediterranean should be implemented and enforced as a matter of priority.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

A UK Biodiversity Action Plan priority species, the common dolphin is protected in UK waters by the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Orders, 1985; it is illegal to intentionally kill, injure, or harass any cetacean (whale or dolphin) species in UK waters (2). The Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas (ASCOBANS) has been signed by 7 European Countries, this includes the UK. Provision is made under this agreement to set up protected areas, promote research and monitoring, pollution control and increase public awareness (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Common dolphins feed on fish. This can be a problem for those trying to catch the fish on which these dolphins are preying. In fact, the United Nations reported that dolphins along the California coast eat an average of 300,000 tons of anchovies each year, whereas commercial fisherman take in only 110,000 tons. Because of this, many angry fisherman who catch these enemies in their nets often kill them.

(Allen, 1979;   http://whales.ot.com/).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common dolphins are a very helpful and friendly species. They have been known to rescue humans. They also provide entertainment for sailors as they play along the sides of their ships. Furthermore, fisherman use common dolphins in trying to locate fish. In some cultures, such as on the Polynesian Gilbert Islands, dolphins are also eaten as food.

(Alpers, 1961).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Small numbers are taken directly, mainly for human consumption or animal feed, in many parts of the range (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

subpopulation Mediterranean common dolphin : Endangered (EN)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Category

Least Concern (LC)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Short-beaked common dolphin

The short-beaked common dolphin (Delphinus delphis) is a species of common dolphin. It has a larger range than the long-beaked common dolphin (D. capensis), occurring throughout warm-temperate and tropical oceans, including the Indian Ocean although in smaller quantities than other places they are found.[4] There are more short-beaked common dolphins than any other dolphin species in the warm-temperate portions of the Atlantic and Pacific Oceans.[5] It is also found in the Caribbean and Mediterranean Seas. The short-beaked common dolphin is also abundant in the Black Sea, Gulf of Mexico, and Red Sea. They follow the gulf stream up to Norwegian waters. Seldom do any short-beaked dolphin venture near the Arctic.[4]

Physical characteristics[edit]

Homodont (similar) teeth of the Delphinus delphis

The short-beaked common dolphin is a medium sized dolphin, smaller than the more widely known bottlenose dolphin. Adults vary in length from five to eight feet and range in mass from 100 to 136 kilograms or 220.26 to 299 pounds.[4][6] Males are generally longer and heavier,[6] with a sexual size dimorphism of 1.06. Mature males also have prominent postanal humps. The color pattern on the body is unusual. The back is dark and the belly is white, while on each side is an hourglass pattern colored light grey, yellow or gold in front and dirty grey in back.[7] It has a long, thin rostrum with 50–60 small, sharp, interlocking teeth on each side of each jaw.[8] Juvenile dolphins have a more muted appearance and become more distinguishable when they mature.[9]

Taxonomy[edit]

Early illustration from Transactions of the Zoological Society of London (1944)

The short-beaked common dolphin is a member of common dolphin genus, Delphinus, within the dolphin family, Delphinidae. Until the mid-1990s, the different forms within Delphinus were not recognized as separate species, but were all considered members of the species D. delphis.[5][6] Currently, there are two recognized species of Delphinus: the short-beaked common dolphin and the long-beaked common dolphin (D. capensis).[1] The short-beaked common dolphin is generally smaller than the long-beaked common dolphin and has a shorter rostrum. Differentiation among the short-beaked variety can be attributed to ocean temperature, chlorophyll concentration, and ocean turbidity, rather than zoogeographical distribution.

Behavior[edit]

Short-beaked common dolphin porpoising

Short-beaked common dolphins can live in aggregations of hundreds or even thousands of dolphins.[5] They sometimes associate with other dolphin species, such as pilot whales.[5] They have also been observed bow riding on baleen whales, and they also bow ride on boats.[5] It is a fast swimmer (over 60 km/h), and breaching behavior and aerial acrobatics are common with this species.[6] They are very social animals and engage in most necessary activities such as traveling, eating, and breathing together.[4] They usually associate in groups that can consist of 1000s to 100,000s of individuals.[10] When some individuals are sick, others in the group assist them by using their fins to help keep them afloat so they survive.[4]

Diet[edit]

The short-beaked common dolphin has a varied diet consisting of many species of fish and squid that live less than 200 metres (660 ft) deep.[5] The short-beaked common dolphin has been known to eat small fish, such as herring, pilchard, anchovies, hake, sardines, bonito, and sauries, as well as squid and octopus. The diet of short-beaked common dolphins near the English Channel consists mostly of lanternfish, Atlantic mackerel, sprats, and squids. In the Black Sea, their diet contains sprats, anchovies, and pipefish. In the Mid-Atlantic region near the Northeastern United States, their diet contains Atlantic Mackerel.[11] They typically eat anywhere from 18 to 20 pounds a day.[4]

In order to study the long-term diet of short-beak common dolphins, their intake of Cadmium (Cd) was observed in 2004. In oceanic regions short-beaked dolphins diet consist largely of Cephalopods (such as Cranchids and Histioteuthids). In coastal areas, their diet contained up to 10 times less cephalopods.[12]

Reproduction[edit]

Females tend to reach sexual maturity when they have grown to 85% of their final size. It is at this point that the distribution of resources in their bodies becomes more focused on their sexual organs, rather than their physical size. This is usually when they are approximately 12 to 15 years of age. Like many other animals, female short-beaked common dolphins are considered sexually mature when they have ovulated at least once.[13]

Similar to humans, the short-beaked common dolphin is viviparous. Though they have the ability to carry twins, triplets, etc., they usually only carry one baby at a time.[4] The Short-beaked common dolphin has a gestation period of 10 to 11 months.[5] The newborn calf has a length of between 70 and 100 centimetres (2.3 and 3.3 ft) and weighs about 10 kilograms (22 lb).[6] For the Black Sea population, weaning occurs at between 5 and 6 months, but occurs later (up to about 19 months) in other areas.[5][6] Typical interbirth interval ranges from 1 year for the Black Sea population to 3 years for eastern Pacific Ocean populations.[5] Age of sexual maturity also varies by location, but can range between 2 and 7 years for females and 3 and 12 years for males.[5][6] Common short-beaked dolphins have been observed to engage in oral sex, intimating that they – like chimpanzees and humans – engage in sexual activities for pleasure.[4]

After a baby is born, it immediately becomes part of the family and takes part in daily life. Staying close to its mother, the calf never strays more than a few feet, especially when it is very young. Until the calf is six months old, it obtains its nourishment solely from its mother's milk. Unlike humans, short-beaked common dolphins have no lips and cannot suck on the teats of its mother. If they did have this ability they would drown. Thus, the female dolphin's mammary glands have a muscle that when contracted, squirts milk so that it can feed its calf.[4]

Maximum lifespan is 35 years, but has been estimated at 22 years for the Black Sea population.[5][6]

Habitat[edit]

Short-beaked common dolphins are commonly found in warm tropical waters, they are known to live in areas of the Atlantic, Pacific, and Southeast Indian Ocean. They are believed to have originated in the eastern Indo-Pacific Ocean during the Pleistocene and expanded into the Atlantic Ocean through the Indian Ocean due to climate oscillations.[14] Short-beaked common dolphins have been shown to reside in the Gulf of Corinth of the Ionian Sea. They were found in groups of Striped dolphin; their numbers were very small and believed to be unsuitable for survival. Traces of hybridization were found on Striped dolphins, leading further credence to their inability to survive in such groups.[15] The number of short-beaked common dolphins has declined elsewhere in Western Greece, specifically the island of Kalamos. Overfishing has been studied to have reduced the number of available prey for dolphins near the island between 1996 and 2007.[16]

Conservation[edit]

The Mediterranean population of the short-beaked common dolphin Delphinus delphis is listed on Appendix I,[17] while the North Sea, Baltic Sea, Mediterranean, Black Sea and eastern tropical Pacific populations are listed on Appendix II[17] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). The regional listing on Appendix I [17] means that this population has been categorized as being in danger of extinction and CMS Parties strive towards strictly protecting these animals, conserving or restoring the places where they live, mitigating obstacles to migration and controlling other factors that might endanger them. It was listed on Appendix II[17] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

In addition, the species is also covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS)[18] and the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS).[19] The species is further included in the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia[20][21] and the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MoU).[22]

Mass stranding events[edit]

On 8 June 2009, a mass-stranding event (MSE) occurred in Falmouth Bay, Cornwall, United Kingdom. The reason for the MSE was led to believe that it was due to naval involvement due to that fact that all other factors that cause MSEs in cetaceans that was tested for showed improbable. This event had twenty six common dolphins wash ashore and about the same amount floated back out to sea. There were three other MSEs in the UK before this event, all of unknown reasons, from the years 1915 to 1938, but with arguably lower counts of stranded dolphins.[23]

Bycatch[edit]

See Cetacean bycatch

There have been few studies specific to bycatch in relation to the short-beaked common dolphin, however certain models indicate that its effect on the reproduction of the species is greater than expected, and as compared with other species of dolphin.[24] About 1000 short-beaked common dolphins are bycaught in the North Atlantic each year by either tuna drift, trawling and gillnetting. The regulation is that only cetacean bycatch can not be longer than 15 meters [25] and this can lead to be a problem because short-beaked common dolphins are only about 2.7 meters.

See also[edit]

References[edit]

  1. ^ a b Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Delphinus delphis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 October 2008.
  3. ^ Perrin, W. (2009). Delphinus delphis Linnaeus, 1758. In: Perrin, W.F. World Cetacea Database.
  4. ^ a b c d e f g h i Alspaugh, M. "Delphinus delphis". Animal Diversity Web. Retrieved 20 October 2013. 
  5. ^ a b c d e f g h i j k Perrin, W. (2002). "Common Dolphins". In Perrin, W.; Wursig, B. and Thewissen, J. Encyclopedia of Marine Mammals. Academic Press. pp. 245–248. ISBN 0-12-551340-2. 
  6. ^ a b c d e f g h Shirihai, H. & Jarrett, B. (2006). Whales, Dolphins and Other Marine Mammals of the World. pp. 171–174. ISBN 0-691-12757-3. 
  7. ^ Reeves, Stewart, Clapham, Powell. Guide to Marine Mammals of the World. p. 388. ISBN 0-375-41141-0. 
  8. ^ "The Common Dolphin". Retrieved 2008-07-03. 
  9. ^ "Short Beaked Dolphin". Retrieved 2013-10-23. 
  10. ^ "Short-Beaked Common Dolphin." Oregon Coast Aquarium. Oregon Coast Aquarium. Web. 22 Oct 2013.
  11. ^ Ohizumi, H.; Yoshioka, M.; Mori, K.; Miyazaki, N. (1998). "Stomach Contents of Common Dolphins (Delphinus Delphis) in the Pelagic Western North Pacific". Marine Mammal Science 14 (4): 835. doi:10.1111/j.1748-7692.1998.tb00767.x.  edit
  12. ^ Lahaye, V.; Bustamante, P.; Spitz, J.; Dabin, W.; Das, K.; Pierce, G. J.; Caurant, F. (2005). "Long-term dietary segregation of common dolphins Delphinus delphis in the Bay of Biscay, determined using cadmium as an ecological tracer". Marine Ecology Progress Series 305: 275. doi:10.3354/meps305275.  edit
  13. ^ Danil, Kerri; Chivers, S.J. (2006). "Growth and reproduction of female short-beaked common dolphins, Delphinus delphis, in the eastern tropical Pacifi". Canadian Journal of Zoology 85: 108–121. doi:10.1139/z06-188. 
  14. ^ Amaral, A. R.; Beheregaray, L. B.; Bilgmann, K.; Freitas, L. S.; Robertson, K. M.; Sequeira, M.; Stockin, K. A.; Coelho, M. M.; Möller, L. M. (2012). "Influences of past climatic changes on historical population structure and demography of a cosmopolitan marine predator, the common dolphin (genus Delphinus)". Molecular Ecology 21 (19): 4854–4871. doi:10.1111/j.1365-294X.2012.05728.x. PMID 22891814.  edit
  15. ^ Bearzi, G.; Bonizzoni, S.; Agazzi, S.; Gonzalvo, J.; Currey, R. J. C. (2011). "Striped dolphins and short-beaked common dolphins in the Gulf of Corinth, Greece: Abundance estimates from dorsal fin photographs". Marine Mammal Science 27 (3): E165. doi:10.1111/j.1748-7692.2010.00448.x.  edit
  16. ^ Bearzi, G.; Agazzi, S.; Gonzalvo, J.; Costa, M.; Bonizzoni, S.; Politi, E.; Piroddi, C.; Reeves, R. R. (2008). "Overfishing and the disappearance of short-beaked common dolphins from western Greece". Endangered Species Research 5: 1. doi:10.3354/esr00103.  edit
  17. ^ a b c d "Appendix I and Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5 March 2009.
  18. ^ Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas. Ascobans.org. Retrieved on 2013-12-14.
  19. ^ Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area. Accobams.org. Retrieved on 2013-12-14.
  20. ^ Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia. cms.int
  21. ^ Convention on Migratory Species page on the Short-beaked common dolphin. cms.int
  22. ^ Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region. Pacificcetaceans.org. Retrieved on 2013-12-14.
  23. ^ Jepson, P. D.; Deaville, R.; Acevedo-Whitehouse, K.; Barnett, J.; Brownlow, A.; Brownell Jr, R. L.; Clare, F. C.; Davison, N.; Law, R. J.; Loveridge, J.; MacGregor, S. K.; Morris, S.; Murphy, S. A.; Penrose, R.; Perkins, M. W.; Pinn, E.; Seibel, H.; Siebert, U.; Sierra, E.; Simpson, V.; Tasker, M. L.; Tregenza, N.; Cunningham, A. A.; Fernández, A. (2013). Fahlman, Andreas, ed. "What Caused the UK's Largest Common Dolphin (Delphinus delphis) Mass Stranding Event?". PLoS ONE 8 (4): e60953. doi:10.1371/journal.pone.0060953. PMC 3640001. PMID 23646103.  edit
  24. ^ Mannocci, L.; Dabin, W.; Augeraud-Véron, E.; Dupuy, J. F. O.; Barbraud, C.; Ridoux, V. (2012). Reina, Richard, ed. "Assessing the Impact of Bycatch on Dolphin Populations: The Case of the Common Dolphin in the Eastern North Atlantic". PLoS ONE 7 (2): e32615. doi:10.1371/journal.pone.0032615. PMC 3290591. PMID 22393423.  edit
  25. ^ Mannocci, L; Dabin, W; Augeraud-Véron, E; Dupuy, JF; Barbraud, C; Ridoux, V (2012). Reina, Richard, ed. "Assesing the Impact of Bycatch on Dolphin Populations: The Case of the Common Dolphin in the Eastern North Atlantic". PLoS ONE 7 (2): e32615. doi:10.1371/journal.pone.0032615. PMC 3290591. PMID 22393423. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Mead and Brownell (in Wilson and Reeder 1993) included D. bairdii, D. capensis, and D. tropicalis in D. delphis. Heyning and Perrin (1994) examined variation in Delphinus in the eastern North Pacific and found two distinct forms, a short-beaked form that they recognized as D. capensis (D. bairdii is a junior synonym), and a long-beaked form regarded as D. delphis. They noted that the status of D. tropicalis needs to be examined to determine if it is an extremely long-beaked form along a cline of D. capensis or a third species of Delphinus. Mead and Brownell (in Wilson and Reeder 2005) recognized D. capensis and D. delphis (but not D. tropicalis) as distinct species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!