Articles on this page are available in 2 other languages: Spanish (1), Dutch (1) (learn more)

Overview

Brief Summary

Fallow deer live primarily in older deciduous or mixed woods with lots of undergrowth. They also survive well in the dunes. For example, they are found in various dune areas in Zeeland and along the west coast of the Netherlands. There are even thousands of fallow deer living in the Amsterdams Drinkwater Dunes. In fact, it has become a plague for people living in the area. The deer like to munch on plants in gardens. In the wild, fallow deer eat grass, leaves and fruits from trees and bushes. Sometimes they also eat the bark. In the Netherlands, fallow deer have always come from the offspring of released animals. They are currently on the Red List of threatened animal species in this country.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Like many species of deer, the fallow deer is active throughout the 24-hour period, but in areas where human disturbance is high, they tend to be more active at night (2). They typically graze on grasses and rushes, but may also browse on young leaves, and also take cereals, berries and acorns (3). For most of the year, males and females occur in separate single-sex groups, and large herds can aggregate in open areas where there is plenty of food (3). The breeding season, or 'rut' occurs between October and November (3); Males hold 'rutting stands' to defend groups of females (6). Rutting behaviour involves displaying, including groaning contests and parallel walks, escalating to physical contests in which the males lock antlers and push each other (2). One calf is usually produced during June or July (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Prized as an ornamental species for many years (3), the fallow deer displays a variety of coat colours in the UK, ranging from red, brown and black, and even pure white coats (6). A black line runs along the back to the tail, and there are often white spots on the back during summer (6). The coat becomes darker and thicker in winter (2), and these white spots become more faint (6). Males have impressive antlers that can measure up to 70 centimetres in height (6). Calves are born with a coat similar to the summer coat of the adult (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This is a western Palaearctic species. Its original range is unclear, but current knowledge suggests that Turkey and southern Europe (southern Italy, Sicily and the southern Balkan peninsula) were the post-glacial refuges of the species (Heidemann, 1976 and 1986; Chapman and Chapman, 1980; Bökönyi, 1986; Masseti and Rustioni, 1988; Masseti, 1996, 1999 and 2002; Burgio et al., 1998), though the palaeontological and archaeozoological evidence of the species’ diffusion in all these areas is very fragmentary. Records from Iran and the Middle East refer to Dama mesopotamica. Only one undoubtedly natural wild population survives, in the Düzlerçami Game Reserve in the Termessos National Park in southern Turkey, though this is now largely fenced. Other populations in Turkey, at Ayvalik Adalar, Gokova, Adakoy and Stavros-tis-Psokas appear to have died out in recent years (M. Masseti pers. comm.). The population on the island of Rhodes (Greece) is said to have been introduced in Neolithic times (Masseti 2007; Masseti et al. 2005, 2008). Certainly, fossils of fallow deer on Rhodes go back to Neolithic times, and there are no signs of prolonged periods of domestication, and so it could be considered a native population (D. Mertzanidou pers. comm.). The population on Cyprus was introduced in the 20th century (Masseti 1999). The animals on Rhodes are genetically very distinct from all others, as are those in Termessos National Park (Masseti 2007; Masseti et al. 2005, 2008).

The species was introduced to the western Mediterranean by the Phoenicians, and to central and northern Europe by the Romans and Normans. However, most of the currently existing populations in Europe result from much more recent introductions (with the exception of some older ones in, for example, the United Kingdom, and at Castel Porziano in Italy). The distribution in Europe is much more scattered and patchy than indicated on the map (which shows its general extent of occurrence). Furthermore, most European populations are fenced and closely managed, and there are rather few truly free-ranging populations (though some are in the United Kingdom). The population on Rhodes is, however, free-ranging. In most places the fallow deer is managed as a park animal, as almost the whole of its present geographic range is attributable to humans. In Portugal, for example, most of the specimens occur within confined areas, such as parks and private hunting areas, and apart from a few scattered individuals there is no wild population (Cabral et al. 2005). Also in other areas such as Sicily and Calabria (Italy) there are only fenced and managed populations (M. Masseti pers. comm.). Most European animals (with the excepton those in Termessos National Park and on Rhodes) are essentially descended from domestic stock, and there are colour varieties that are considered to be a result of domestication.

More recently, the species has been introduced to many countries worldwide (not included in the distribution map), including South Africa, Australia, New Zealand (considered a pest there), the United States, Argentina, Chile, Peru, and Uruguay, as well as islands in Fijian group, the Lesser Antilles, and off the Pacific coast of Canada (Apollonio 1999). (Apollonio 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Since the last glaciation, fallow deer have had a natural range in southern European regions, Asia Minor, along the Mediterranean Sea, and possibly in northern Africa and Ethiopia. They have been widely introduced to 38 countries in North and South America, the Leeward Islands, Europe, South Africa, Australia, New Zealand, and Fiji. (Feldhamer et al. 1998; Nowak 1999).

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native ); oriental (Introduced ); ethiopian (Introduced , Native ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to southern Turkey and (subspecies mesopotamica) Iran and formerly Iraq, Israel, Jordan, Lebanon, eastern Turkey, and possibly Syria; introduced to Europe, South Africa, Australia, New Zealand, USA, Argentina, Chile, Peru, Uruguay, Fijian islands, Lesser Antilles, and western Canadian islands (Grubb, in Wilson and Reeder 2005). Exists in a semi-wild state in many areas of the United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In the 11th century, the Normans introduced fallow deer to Britain; they are now patchily distributed throughout much of England and Wales, they also occur in some areas of Scotland and Northern Ireland (3). They are common throughout most of Europe, as they have escaped from deer parks throughout the continent (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Two subspecies of fallow deer are distinguished: Dama dama dama (European fallow deer) and Dama dama mesopotamica (Persian fallow deer).

The body mass of free-ranging adult males is from 46 to 80 kg with an average of 67 kg, and the mass of adult females is from 30 to 50 kg with an average of 44 kg. The head and body length is 1.3 to 1.75 meters, tail length is 150 to 230 mm, and the shoulder height of males is generally 0.9 to 1.0 meters with the females slightly smaller. The forelegs of Dama dama are usually shorter than the hind legs; as a result, the line of the back is elevated posteriorly. The "Adam's apple" (larynx) is prominent in males.

Palmate, multi-point antlers, usually found only in males, also distinguish Dama dama from all other deer. They range in length from 50 to 70 cm. The antlers are usually shed annually in April and the new ones are regrown and free of velvet by August, until the fifth or sixth year. Females are generally without antlers.

Dama dama have the most variable pelage coloration (white, menil, common, and black) of any species of deer. Typically, the pelage is darker on the dorsal surface of the body and lighter on the ventral surface, chest, and lower legs. Their summer coat is pale brown, smooth, and thin while their winter coat is dark brown and rougher with a heavy undercoat. As a rule, there are visible white spots on the back and flank, less on the neck, and none on the head or legs. In general, the darker the coat, the less striking the spots. A black stripe runs dorsally along the nape of the neck to the tip of the tail. (Feldhamer et al. 1998; Grizmek 1990; Nowak 1999).

Range mass: 30 to 80 kg.

Range length: 1.3 to 1.75 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 180 cm

Weight: 80000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a a highly adaptable species that can survive in a wide range of habitats, including forest, shrubland, grassland, pastureland and plantations.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fallow deer live in a variety of climates ranging from cool-humid to warm-dry areas. The habitat they prefer usually is a combination of vegetation types. They prefer old, deciduous, broad-leaf forests of varying densities interspersed with grassy areas, but they are also found in mixed forests, broad-leaf forests, subalpine vegetation, grasslands, woodlands, low mountains, scrublands, and savanna. (Feldhamer et al. 1998; Grizmek 1990).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Often found in brushy, hilly areas near grassy meadows; prefers older forest interspersed with areas of grass; tolerates diverse habitats: mixed forest, broadleaf forest, subalpine vegetation, grassland, scrub, savanna (Feldhamer et al. 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species inhabits mature deciduous and mixed woodland with dense undergrowth (3). It also occurs in marshes, meadows, and mature conifer plantations (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Fallow deer forage on a variety of vegetation, usually grasses, mast, and browse. Other items in their diet may include herbs, dwarf shrubs, leaves, buds, shoots, and bark. Their diets are adaptable and depend on season and availability. Their peak feeding periods are usually at dusk and dawn but they may also forage at intervals throughout the day. (Feldhamer et al. 1998; Grizmek 1990).

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet reflects seaoson and availability, includes grasses, forbs, acorns, fruits, fungi, browse (bark, twigs, evergreen leaves and needles).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Dama dama

Animal / parasite / ectoparasite
adult of Lipoptena cervi ectoparasitises Dama dama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Fallow deer impact the plant communities in which they live through browsing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Fallow deer are preyed on by humans and large predators in the areas in which they occur, such as wolves, cougars, and bears. Their vigilance behaviors and herding helps to protect them from predation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Highly gregarious. Does and fawns form small herds separate from groups of bucks. May compete with mule deer in certain areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Fallow deer have a good sense of smell and hearing and very good vision. They communicate through body language, smells, and vocalizations. Fallow deer have six types of vocalizations: barking, which is an explosive alarm call used by females; bleating, which is produced by females during parturition or with their young; mewing, given by any deer during submission postures; peeping, produced by fawns in distress or contacting their mothers; wailing, an intense distress sound by a fawn older than 2 days; and groaning, produced by rutting males. The most common visual communication among Dama dama when disturbed is alerting, where they gain an upright stance with their head held vertically and their body rigid. They may also use different forms of touching, stiff-walking, tail positions, and head positions to communicate. When responding to a source of disturbance the deer may walk, trot, strut, gallop, or pronk.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Often most active at dusk and dawn, but may forage at various intervals throughout day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Fallow deer have an average life span of 20 to 25 years.

Typical lifespan

Status: captivity:
20 to 25 years.

Average lifespan

Status: wild:
25.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.1 years (captivity) Observations: Males attain full size at 5-9 years of age and females at 4-6 years of age (Ronald Nowak 1999). In the wild, it is estimated that these animals live up to 25 years (Bernhard Grzimek 1990), which is doubtful. Record longevity in captivity is 21.1 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During the breeding period, or rut, males spend most of their time establishing their territory (rut stand) by pawing the ground to create scrapes where they may urinate, thrashing understory vegetation with their antlers, and by producing low-pitched groans and grunts. At the onset of the rut, since deer are polygynous, the females also appear at the rut stand. Males may stop feeding at this time. Many subordinate males unable to establish territories remain around the edges of the herd, but they are chased away by the rutting male if they enter the territory.

Mating occurs during the rut. Males fight often and violently during the mating season but injuries are rare; their fights involve a ritual shoving with the antlers that follow fixed rules. When mating, the male approaches the female many times, sniffing and licking her genital areas in order to determine if she is in estrous. The female responds with a high-pitched whine and moves away. Eventually the female allows the male to mount.

Mating System: polygynous

Fallow deer have a breeding season of approximately 135 days, generally between the months of September and January in the Northern Hemisphere. The highest percent of fertilization occurs in late October. Males are capable of breeding at the age of 17 months but do not generally breed until the age of four years unless they live in heavily hunted populations. Females generally conceive for the first time around 16 months of age. The length of the estrous cycle for females is approximately 24 to 26 days. Females are polyestrous and may cycle up to seven times in one breeding season, but they usually conceive during their first cycle. Dama dama usually give birth to one fawn after a gestation period of 33 to 35 weeks. The majority of fawns in the Northern Hemisphere are born in early June. Their weight at birth is generally 2 to 4 kg. Full size is attained between 4 to 6 years in females and 5 to 9 years in males.

Breeding interval: Fallow deer breed once yearly.

Breeding season: Mating occurs between September and January.

Average number of offspring: 1.

Range gestation period: 231 to 245 days.

Average time to independence: 12 months.

Average age at sexual or reproductive maturity (female): 16 months.

Range age at sexual or reproductive maturity (male): 17 (low) months.

Average age at sexual or reproductive maturity (male): 48 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 4500 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
487 days.

Females often become secretive and try to find hiding places prior to giving birth. The female usually gives birth during the daily period of least activity. The mother-fawn bond is established immediately after birth when she licks it clean. The mother does not rejoin the herd immediately after birth. The mother hides the fawn in dense bushes and only returns to nurse it (every 4 hours for the first 4 months) during the day. Rumination in the fawn does not begin until 2 to 3 weeks of age. The mother begins weaning the fawn when it is around 20 days old but weaning continues until the fawn is around 7 months old. After 3 to 4 weeks the mother and fawn rejoin a herd of females and their young. After approximately one year, the young are independent.

Parental Investment: precocial ; female parental care

  • 1990. Grizmek's Encyclopedia of Mammals Vol. 5. New York: McGraw-Hill Publishing Co..
  • Feldhamer, G., K. Farris-Renner, C. Barker. Dec. 27, 1988. Mammalian Species No. 317, pp. 1-8. The American Society of Mammalogists.
  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition, Volume II. Baltimore & London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rut occurs in October; males join female herds in fall, leave herd in winter. Bucks are polygamous. Gestation lasts 8 months. Litter size usually is 1. Weaning is complete at about 7 months Females first breed at 6-7 months or 16 months; males usually at 4 years. See Howery et al. (1989) for information on seasonal reproductive activity in Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dama dama

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGCTGATTGTTCTCAACCAACCATAAAGATATCGGTACCCTGTATCTACTATTTGGTGCCTGAGCAGGCATAGTAGGAACAGCTTTAAGCCTATTGATTCGTGCTGAACTGGGCCAACCTGGTACCCTACTTGGAGATGACCAAATTTATAATGTTATTGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTTATACCAATTATAATCGGAGGATTTGGTAACTGACTAGTTCCCTTAATAATTGGTGCCCCAGATATAGCATTCCCTCGAATAAACAATATGAGCTTTTGACTCCTTCCTCCCTCTTTCTTACTACTTCTAGCATCATCTATAGTTGAAGCTGGCGCAGGAACAGGCTGAACTGTGTACCCCCCTCTAGCTGGTAACTTAGCTCACGCAGGAGCCTCAGTGGACCTAACTATCTTTTCTCTACACCTGGCAGGTGTCTCTTCAATTCTAGGGGCCATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCTATGTCACAATACCAAACTCCCCTATTTGTGTGATCCGTACTAGTCACTGCTGTATTACTACTTCTCTCACTCCCAGTACTAGCAGCTGGAATTACAATATTATTAACAGACCGAAATTTAAATACAACCTTTTTTGATCCAGCAGGAGGCGGAGATCCCATTCTATATCAACACTTATTCTGATTCTTTGGTCACCCTGAAGTATATATTCTTATTTTACCCGGCTTTGGCATAATTTCCCATATCGTAACATATTATTCAGGAAAAAAAGAACCATTTGGGTACATAGGAATGGTCTGGGCTATAATATCAATTGGATTTTTAGGATTTATCGTATGAGCCCACCACATGTTTACAGTTGGAATAGATGTCGATACACGAGCCTACTTTACATCAGCTACCATAATTATTGCTATTCCGACTGGGGTAAAAGTCTTCAGTTGATTAGCAACACTCCACGGAGGTAATATTAAATGATCACCTGCTATAATATGAGCTTTAGGTTTTATTTTCCTTTTTACAGTTGGAGGCTTAACCGGAATTGTTCTTGCCAACTCTTCTCTCGATATCGTCCTTCATGACACATATTATGTAGTTGCACATTTCCACTATGTACTGTCAATAGGAGCTGTATTCGCTATTATGGGAGGATTTGTTCACTGATTCCCATTATTTTCAGGATATACCCTCAATGACACATGAGCCAAAATCCACTTTGTAATTATATTTGTAGGTGTAAATATAACTTTCTTTCCACAACACTTCCTAGGGTTATCTGGTATACCACGACGCTATTCTGATTACCCAGATGCGTATACAACATGAAACACCATCTCATCTATAGGCTCATTTATTTCTTTAACAGCAGTTATACTAATAGTCTTTATTATCTGAGAAGCATTCGCATCTAAACGAGAAGTCTCAACCGTAGAACTAACAACAACCAACTTAGAGTGACTAAACGGATGCCCCCCACCATACCACACATTTGAAGAACCTACATACGTTAACTTGAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dama dama

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Masseti, M. & Mertzanidou, D.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
As a result of introductions by the Phoenicians, Romans, and Normans, it is a widespread and abundant species in Europe, hence is listed as Least Concern. However, in its Turkish native range this species is under serious threat.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dama dama mesopotamica (Persian fallow deer) is considered the rarest and least known mammal of its size. In 1955 the residual population was endangered by degradation of their habitat, and by animal and human enemies. In 1957, efforts to preserve and aid breeding of this species were undertaken in the Opel Animal Preserve in Kronberg, Germany, and Dama dama mesopotamica was placed under complete protection in Iran. In the late 1970's this wild population was found to be well protected and increasing in number. By 1988, however, the last wild population seemed to have disappeared. The species in its natural environment remains endangered. They are being reintroduced in northern Israel. Currently there are more than 80 in the wild (Grizmek 1990; Saltz 1998, Nowak 1999).

CITES: appendix i

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

This widespread and locally common introduced species is increasing in numbers (3). It is protected in the UK by the Deer Act 1991 (4), and certain methods of killing or capture are prohibited under Appendix IV of the Bern Convention (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Most introduced populations in Europe are stable (Apollonio 1999). However, in its native range in Turkey, this species has suffered severe declines and has disappeared most of its former distribution (M. Masseti pers. comm.). There is only one surviving population of D. dama that is considered to be an original native population. This population is restricted to Telmessos National Park in Turkey and numbers fewer than 30 individuals (Masseti 2007), with apparently fewer than ten animals remaining outside the fended area. It has declined by over 50% in the last ten years and is genetically distinct from D. dama occurring elsewhere (Masseti 2002, 2007). The population of D. dama on Rhodes has not been subject to any systematic research on population size (D. Mertzanidou pers. comm.). The distribution range of fallow deer on Rhodes is about 550 km², and a subjective estimate of the population size ranges between 400 – 800 individuals (D. Mertzanidou pers. comm.). Masseti (2002, 2007) estimated that there were 400-500 animals on Rhodes. There are recent signs of population recovery on Rhodes (D. Mertzanidou pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species in Europe. In the species' native range, hunting and habitat conversion for agriculture caused massive declines in the past (Wemmer 1998). The tiny remaining population in the native range in Turkey is at risk from inbreeding and hunting. The Rhodian population is also at risk form poaching and from the incidence of large fires (D. Mertzanidou pers. comm.). In the future there might be the threat of outbreeding depression, as there is a tendency people on Rhodes to keep fallow deer of European origin in fenced areas, which, if they escape, could breed with the wild animals (D. Mertzanidou pers. comm.). Furthermore, damage to summer crops on Rhodes, attributable to fallow deer, has been recorded, and as there is no compensation system for damage caused by deer damages, persecution of animals could take place (D. Mertzanidou pers. comm.). Also, there is a reduction in water resources on the island due to climatic change, and this could affect the animals (D. Mertzanidou pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Road deaths are common, and predation of fawns is a major cause of mortality (3). Populations are managed, as this species is a pest of woodland and agriculture (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix III of the Bern Convention. It occurs in a large number of protected areas. The main conservation priority for this species is to protect the surviving native population in the Düzlerçami Game Reserve in the Termessos National Park in southern Turkey. This will require strong anti-poaching measures, recovery management, captive breeding and re-introductions.

The population on Rhodes is also very important genetically and should also be the focus of conservation programmes. The free-ranging animals on Rhodes are protected by Greek law. Although poaching is still taking place, this is to a much lesser extent than was the case in the past. Thanks to more effective control of poaching, as well as the reduced number of large fires on the island, the fallow deer population seems to have recovered and regained much of its former range (up until 1960 it occurred in almost all of the rural and natural areas on the island). A fallow deer conservation plan for Greece is now needed, which should include: a) the establishment of a population and habitat monitoring program; b) the creation of a compensation system as well as a monitoring programme for agricultural damage caused by deer; c) the introduction of fallow deer of Rhodian origin to other places in Greece; and d) the implementation of public awareness and participatory programmes for the conservation of the species (D. Mertzanidou pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There is no conservation action targeted at this introduced species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Collision with fallow deer occasionally cause motor-vehicle accidents. (Grizmek 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In Europe fallow deer are the best known and most widespread "park game". Fallow deer are also maintained in captivity for their antler velvet or for commercial production of meat. Since they are easy to breed, they are present in almost all of the larger zoos. In addition, fallow deer are raised on large, fenced, unfertile meadows as domestic animals. (Grizmek 1990; Nowak 1999).

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fallow deer

The fallow deer (Dama dama) is a ruminant mammal belonging to the family Cervidae. This common species is native to western Eurasia, but has been introduced widely elsewhere. It often includes the rarer Persian fallow deer as a subspecies (D. d. mesopotamica),[2] while others treat it as an entirely different species (D. mesopotamica).[1]

Contents

Description

The male fallow deer is known as a buck, the female is a doe, and the young a fawn. Adult bucks are 140–160 cm (55–63 in) long with a 85–95 cm (33–37 in) shoulder height, and typically 60–100 kg (130–220 lb) in weight; does are 130–150 cm (51–59 in) long with a 75–85 cm (30–33 in) shoulder height, and 30–50 kg (66–110 lb) in weight. The largest bucks may measure 190 cm (75 in) long and weigh 150 kg (330 lb).[3] Fawns are born in spring at about 30 cm (12 in) and weigh around 4.5 kg (9.9 lb). The life span is around 12–16 years.

The species has great variations in the colour of their coats, with four main variants, "common", "menil", melanistic and leucistic – a genuine colour variety, not albinistic.[4] The white is the lightest colored, almost white; common and menil are darker, and melanistic is very dark, sometimes even black (easily confused with the sika deer).

  • Common: Chestnut coat with white mottles that are most pronounced in summer with a much darker, unspotted coat in the winter. Light-colored area around the tail, edged with black. Tail is light with a black stripe.
  • Menil: Spots more distinct than common in summer and no black around the rump patch or on the tail. In winter, spots still clear on a darker brown coat.
  • Melanistic (black): All year black shading to greyish-brown. No light-colored tail patch or spots.
  • Leucistic (white, but not albino): Fawns cream-colored, adults become pure white, especially in winter. Dark eyes and nose, no spots.[5]

Most herds consist of the common coat variation, yet it is not rare to see animals of the menil coat variation. The Melanistic variation is rarer and white very much rarer still.

Only bucks have antlers, which are broad and shovel-shaped (palmate) from three years. In the first two years the antler is a single spike. They are grazing animals; their preferred habitat is mixed woodland and open grassland. During the rut bucks will spread out and females move between them, at this time of year fallow deer are relatively ungrouped compared to the rest of the year when they try to stay together in groups of up to 150.

Agile and fast in case of danger, fallow deer can run up to a maximum speed of 30 mph (48 km/h)[6] over short distances (being naturally less muscular than other cervids such as roe deer, they are not as fast). Fallow deer can also make jumps up to 1.75 metres high and up to 5 metres in length.

Distribution and history

White variant of Fallow Deer, in Beijing Zoo
Fallow deer at Avon Valley Country Park, Bristol, England

The fallow deer is a Eurasian deer[7] that was a native to most of Europe during the last Interglacial. In the Holocene, the distribution was restricted to the Middle East and possibly also parts of the Mediterranean region, while further southeast in western Asia was the home of the Persian fallow deer, that is bigger and has larger antlers. In the Levant, fallow deer were an important source of meat in the Palaeolithic Kebaran-culture (17000–10000 BC), as is shown by animal bones from sites in northern Israel, but the numbers decreased in the following epi-Palaeolithic Natufian culture (10000–8500 BC), perhaps because of increased aridity and the decrease of wooded areas.

Britain and Ireland

The fallow deer was spread across central Europe by the Romans. Until recently it was thought that the Normans introduced them to Great Britain and to Ireland for hunting in the royal forests. However recent finds at Fishbourne Roman Palace show that fallow deer were introduced into southern England in the 1st century AD. It is not known whether these escaped to form a feral colony, or whether they died out and were reintroduced by the Normans.

Fallow deer are now widespread on the UK mainland and are present in most of England and Wales below a line drawn from the Wash to the Mersey. There have been long standing populations in the New Forest and the Forest of Dean and many of the other populations originated from park escapees. They are not quite so widespread in the northern parts of England but are present in most lowland areas and also in parts of Scotland, principally in the Tay valley and around Loch Lomond. According to the British Deer Society distribution survey 2007 they have enjoyed an increase in range since the previous survey in 2000 although the increase in range is not as spectacular as for some of the other deer species.

A fallow deer buck
A buck (with growing antlers) and four does

A significant number of the fallow in the Forest of Dean and in Epping Forest are of the black variety. One particularly interesting population is that based in the Mortimer Forest on the England/Wales border where a significant part of the population have long hair with distinct ear tufts and longer body hair.

Rhodes island

The Rhodian population of fallow deer has been found to average smaller than those of central and northern Europe, though they are similarly coloured. In 2005 the Rhodian fallow deer was found to be genetically distinct from all other populations and to be of urgent conservation concern.[8] At the entrance to the harbour of Rhodes city, statues of a fallow deer buck and doe now grace the location where the Colossus of Rhodes once stood.

Three of the color variants found at Fossil Rim Wildlife Center in Texas

United States

The species Odocoileus virginianus was once classified as Dama virginianus; they were given a separate genus in the 19th century.

In more recent times, fallow deer have been introduced in parts of the United States. In some areas of central Georgia, wild fallow deer, not having any natural enemies, have increased to numbers that cause serious damage to young trees. Fallow deer have also been introduced in Texas, along with many other exotic deer species, where they are often hunted on large game ranches. They also live in Rhode Island.

In Pennsylvania, fallow deer are considered livestock since there are no feral animals breeding in the wild. Occasional reports of wild fallow deer in Pennsylvania are generally attributed to escapes from preserves or farms.

There is a herd of white fallow deer located near Argonne National Laboratories in central Illinois.[9]

White fallow deer near Argonne National Labs in Westmont, Illinois, USA

A small herd of fifteen mostly white fallow deer resides at the Belle Isle Nature Zoo on Belle Isle in Detroit, Michigan. Until the turn of he 21st century, this herd was free range having the run of the island; the herd was thereafter confined, with extirpation being the goal.

South Africa

Fallow deer have been introduced to Cape Province, South Africa.

New Zealand

From 1860 Fallow deer were introduced into New Zealand. Significant herds exist in a number of low altitude forests.[10]

Historical herds

One noted historical herd of fallow deer is located in the Ottenby Preserve in Öland, Sweden where Karl X Gustav erected a drystone wall some four kilometres long to enclose a royal fallow deer herd in the mid 17th century; the herd still exists as of 2006.[11] Another is Phoenix Park in Ireland where a herd of 400–450 fallow deer descend from the original herd introduced in the 1660s.[12]

The fallow deer is easily tamed and is often kept semi-domesticated in parks today.[citation needed]

Fallow deer fawn in Uruguay.
Fallow Deer

Name

The Latin word dāma or damma, used for roe deer, gazelles, and antelopes, lies at the root of the modern scientific name, and the German Damhirsch, French daim, Dutch damhert, and Italian daino. In Croatian and Serbian, the name for the fallow deer is jelen lopatar ("shovel deer"), due to the form of its antlers. The Hebrew name of the fallow deer, yachmur (יחמור), comes from the Aramaic language, where chamra (חמרא) means "red" or "brown".

Metaphorical meaning

Damhirsch at Rapperswil (SG) castle in Switzerland

In the well-known 16th century English folk ballad "The Three Ravens", the term "fallow doe" is used metaphorically, as meaning "a young woman".

Down there comes a fallow Doe,
As great with young as she might goe,

See also

References

Notes

  1. ^ a b Masseti, M. & Mertzanidou, D. (2008). Dama dama. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 8 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  4. ^ The British Deer Society
  5. ^ Prior, John. Dear Watch. David & Charles Inc, 1987. p. 80.
  6. ^ The Deers of the Ranch of America
  7. ^ Urdang, p. 476
  8. ^ Marco, M; Cavallaro, A; Pecchioli, E & Vernesi, C (2006-11-11), "Artificial Occurrence of the Fallow Deer, Dama dama dama (L., 1758), on the Island of Rhodes (Greece): Insight from mtDNA Analysis", Human Evolution 21, No. 2: 167–175, doi:10.1007/s11598-006-9014-9, http://www.springerlink.com/content/u406m764gm435u82/
  9. ^ And another in Willits CA. on the famous Sea Biscuit Ranch. They number about fifty and have resided there for the last 50 Years Herd of white deer roams Argonne campus.
  10. ^ http://www.doc.govt.nz/parks-and-recreation/hunting/what-to-hunt/deer/fallow-deer/where-to-hunt-fallow-deer/
  11. ^ Environmental Baseline Study, Lumina Technologies, Öland, Sweden, July, 2004
  12. ^ http://www.phoenixpark.ie/about/naturebiodiversity/fauna/

Further reading

  • FAO ANIMAL PRODUCTION AND HEALTH PAPER 27. (1982). Deer farming guidelines on practical aspects. ISBN 92-5-101137-0. Retrieved on 4 January 2008.
  • Clutton-Brock, J. (1978). A Natural History of Domesticated Animals. London, British Museum.
  • Lyneborg, L. (1971). Mammals [of Europe]. ISBN 0-7137-0548-5.
  • Level 1 DSC Training Manual. http://www.eskdalewildlife.com/training.html
  • Urdang, Laurence. The Random House Dictionary of the English Language. 1969; Laurence Urdang, Editor in Chief, Random House.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Cervus. Placed in the genus Dama by Feldhamer et al. (1988); Grubb, in Wilson and Reeder (1993, 2005); and Jones et al. (1997). Grubb (following Geist 1998) included D. mesopotamica as a subspecies of D. dama.

See Cronin (1991) for a phylogeny of the Cervidae based on mitochondrial DNA data. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!