Overview

Brief Summary

Chital (Axis axis) are native to India, southern Nepal, southern Bhutan, Bangladesh, and Sri Lanka. They have been introduced and established in Europe (Croatia, Ukraine, Moldova), Armenia, the Andaman Islands, New Guinea, Australia, the United States (California, Texas, and Hawaii), Brazil, Uruguay, and Argentina.

These medium-sized deer are heavily spotted year-round. Chital head and body length is around 150 to 155 cm for males (bucks) and 140 to 145 cm for females (does). Tail length is around 25 to 30 cm. Shoulder height is around 85 to 95 cm for bucks and 70 to 80 cm for does. Adult bucks are 70 to 85 kg (up to 110 kg) and adult does are 45 to 60 kg (up to 70 kg). Males have a dark chevron over the face and an elongated penis sheath. Adult males have long three-tined antlers.

Chital prefer moist and dry forest areas adjacent to scrubland or grassland, but are also found in swampy meadows close to forests, in riparian forests, and in teak plantations. They eat mainly grasses, but also forbs, leaves, flowers, and fruits.  In the Sundarbans mangrove forest (Bangladesh) they are know to feed on crabs as well.

In their native range, Chital tend to use more wooded habitats during the cool-dry season and early summer (November to May), where they find browse and fruit, and use more open grasslands when the monsoon rains bring a flush of plant growth.

Female Chital reach sexual maturity at around a year, males several months later. Mating may occur throughout the year, with a higher frequency from March to July. After a gestation period of around 231 to 235 days, a single fawn is born. Weaning occurs at 5 to 6 months. The maximum known age in captivity is 21 years. The major predators of Chital in their native range are Tigers (Panthera tigris), Leopards (Panthera pardus), and Dholes (Cuon alpinus).

Chital are mainly active around dawn and dusk, with two main resting periods, one before dawn and the other at midday.  Males have home ranges of around 200 to 350 ha, females around 150 to 250 ha. The basic social unit is the family group, consisting of a mother, her fawn, and the offspring of the previous year. Two or three families may form temporary, fluid herds of 6 to 12 animals, often accompanied by subadult males and visted by adult bucks. In some situations, where there is a concentration of food or water, aggregations of 150 to 200 individuals can occur.

Chital populations appear to be secure.

(Mattioli 2011 and references therein)

  • Mattioli, S. 2011. Family Cervidae. Pp. 350-443 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Miscellaneous Details

"Blanford 1888 says """"The flesh is dry as a rule, but if kept till tender is excellent."""""
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"The Spotted deer is variously known as chital or cheetal or chital deer, spotted deer or axis deer. It is a common inhabitant of wooded forest of India. They are usually found in large herds of ten to fifty individuals with the large dominant males occurring at the centre.Smaller stags occupy the boundaries of the herd."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native range: India, Nepal, and Sri Lanka. Introduced in Hawaii (principally on Lanai and Molokai; one remnant population on Oahu; introduced on Maui in 1959-1960) (Tomich 1986), Texas, and Florida (Grubb, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Chital occurs over 8–30ºN in India (including Sikkim), Nepal, Bhutan, Bangladesh, and Sri Lanka (Grubb 2005; Raman in press). The western distribution boundary is formed by eastern Rajasthan (e.g. Sariska, Ranthambore, and Keoladeo Ghana) and Gujarat (e.g. Sasan Gir). The northern boundary runs along the bhabar-terai belt of the foothills of the Himalaya from Uttar Pradesh and Uttaranchal through Nepal, northern West Bengal and Sikkim to western Assam and the forested valleys of Bhutan below 1,100 m asl. The eastern boundary runs through western Assam (Golapara and Kamrup district as far east as the Dhunsiri River in Darrang district) to the Sunderbans of West Bengal (India) and Bangladesh. Sri Lanka is the southern limit (Gee 1964; Schaller 1967; Raman in press). Chital occur throughout the rest of peninsular India sporadically in the forested areas (Sankar and Acharya 2004), but in Bangladesh, it now occurs only in the Sundarbans, having vanished from the central, north-east and south-east regions (Md Anwarul Islam in litt. 2008).

Chital have been introduced to the Andaman Islands (India, during 1925–1930; Banerji 1955), Argentina, Armenia, Australia, Brazil, Croatia (islands of Brijuni; Mitchell-Jones et al. 1999), Moldova, Pakistan, Papua New Guinea, Ukraine, Uruguay, and the USA (California, Florida, Hawaiian Islands, and Texas) (Grubb 2005; Raman in press). These introduced populations have not been mapped. Not all introductions have succeeded: for example, some were introduced to west-central Slovenia (from the Brijuni islands) in the late 1940s or in 1950, but this introduction failed and is now therefore frequently reported as having been of Fallow Deer Dama dama. One male, shot on 12 October 1950 and now in the Natural History Museum of Slovenia, proves the identification (Krystufek 1999). Managed herds occur in parks throughout the native and introduced range and in many other areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The axis deer occurs historically in India and Ceylon. They have been introduced to Texas and Hawaii.

Biogeographic Regions: nearctic (Introduced ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Size moderate. No mane. Molars very hypsodont. Muffle as in C. unicolor. Tail long, pointed. Interdigital glands in hind feet only (Hodgson). Upper canines generally wanting (Hodgson states that he has found them in both sexes). Horns normally with three tines, a brow-antler which joins the beam at rather less than a right angle, and two upper tines of which the outer is always much the longer. Sports or irregular points in the axil of the brow-tine very common ; few fine horns are without them, but other additional points are rare. Colour rufous fawn, spotted throughout the body with white at all seasons and all ages, A dark dorsal stripe from nape to end of tail, bordered by a single or double row of white spots on the back. Low down on the sides the white spots sometimes blend into a horizontal line. Chin and upper throat, belly, inside of limbs, and lower surface of the tail white. Head brownish unspotted, the face darker. Ears brown outside, wliite within. A melanoid variety indistinctly spotted occasionally occurs."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The Axis deer stands 0.6 to 1 m tall at the shoulder and has a body length of about 1.5 m (Walker, 1964). The body color is reddish with white on the belly, inner legs, and underneath their short tail. The males tend to be darker and to have black facial markings. They also have antlers composed of three tines which can reach lengths of almost a meter. Characteristic white spots occur in both sexes and run longitudinally in rows throughout the duration of the animal's life (Ables,1977). A dark dorsal stripe runs the length of the animal's back.

Range mass: 27 to 45 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; ornamentation

  • Albes, E. 1977. The Axis deer in Texas. Texas Agricultural Experimental Station, Texas A&M University.: Caesar Kleberg Research Program in Wildllife Ecology and Department of Wildlife and Fisheries Sciences.
  • Walker, E. 1964. Mammals of the World. Baltimore: Johns Hopkins Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

"Height of males at shoulder 36 to 38 inches in Central and Northeru India, length 4.5 to 5 feet. A female measured 30 inches high, 53 long; tail with hair 12.5 without 10. In Southern India the height is considerably less, 30 to 34 inches according to Jerdon. Basal length of a large male skull 9-75, orbital breadth 4-7. Horns of the larger variety have been measured 38 and 38.75 inches long round the curve, with a girth of 4 at mid-beam and 5.75 at the base above the burr. Ordinary horns measure about 30 in length, but heads from Bengal and Southern India are generally smaller."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: In Hawaii, usually in or near cover during daylight hours. May be dependent on water holes during dry season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Chital thrive in a variety of habitats, but avoids extremes such as dense moist forests and open semi-desert or desert. Moist and dry deciduous forest areas, especially adjoining dry thorn scrub or grasslands appear to be optimal, and highest densities of Chital are reported from these habitats. Short grasslands of the terai, swampy meadows and glades adjoining forest areas, coastal dry evergreen forests, mixed forests or plantations with Teak Tectona grandis and Sal Shorea robusta are also used, and indeed over much of northern and southern India, its distribution closely matches that of Sal and Teak, respectively (Raman in press). Chital is particularly frequent in grassland–forest interface, edge, and other ecotones (Krishnan 1972). Eisenberg and Seidensticker (1976) opined that dry deciduous habitats with scrub is the favoured habitat, while Karanth and Sunquist (1992) found mixed forests with teak plantations, moist deciduous patches and swampy grasslands to support high abundance of Chital. Short grasslands are important because they provide little cover for predators such as Tiger Panthera tigris (Moe and Wegge 1994). The introduced population in Andaman Islands inhabits evergreen forests (Sankar and Acharya 2004) but native populations are absent from the rainforest areas of the mainland. They tend to be only visitors to dense forests, to those adjoining more open habitats. Riverine forests within the Bardia National Park in lowland Nepal are highly used by the deer for shade and cover during the dry season. The forest also provides good foraging with regard to fallen fruit and leaves that are high in nutrients needed by the deer. Four factors were identified by Schaller (1967) as delineating Chital’s distribution: (1) the need for water; (2) the need for shade; (3) an avoidance of high, rugged terrain; and (4) a preference for grass as forage. Although several observers have noted that Chital occurs mostly in flat areas and avoids hills and slopes (Schaller 1967; Khan 1996), this may not hold in areas where preferred habitats or forage is also available on slopes (Raman in press; N.S. Kumar unpublished data). It occurs in both hilly and flatter terrain, mainly the latter, in the Terai Arc Landscape of India (Johnsingh et al. 2004). In the Siwalik hills, Bhat and Rawat (1995) found that Chital preferred slopes of 11–30°, while slopes exceeding 30° were used less. Also, use of south, south-east, and east aspects was higher than of north, north-east, north-west, and west aspects, reflecting the warmer environment of the former aspects. There was no difference in average Chital density in the hills and plains (Bhat and Rawat 1995). A study of coffee estates around Bhadra Wildlife Sanctuary, India, recorded Chital widely, including in coffee areas up to 14 km of the sanctuary’s boundary (Bali et al. 2007).

Habitat use varies seasonally, reflecting food availability. Chital uses more wooded habitat during the cool-dry season and early summer (November to May), where fallen fruit, leaf litter, and browse are available. In open grassland and tropical dry thorn forest, Chital density increases with the onset of monsoon rains and flush of plant growth (Mishra 1982; Moe and Wegge 1994; Khan 1996; Raman et al. 1996). In areas of their distribution with a mosaic of forest and grassland habitats, seasonal patterns in habitat use may be complex. In the Himalayan terai, Chital use of habitats with high grass availability increased substantially in the weeks following cutting and burning of grasses in January–February, attributed to fresh flush of grass growth after the burns and with the onset pre-monsoon and monsoon rains nearly two months later (Mishra 1982; Moe and Wegge 1994, 1997). Similar behaviour has been reported from the grasslands of Bandipur Tiger Reserve (Johnsingh 1983).

Chital easily habituates to human presence, and herds often congregate in open areas near habitation or forest camps to spend the night, possibly due to greater safety from predators that shy away from these areas (Raman in press).
Chital eats a wide variety of plants: about 160–190 have been recorded from across the species' range. It is predominantly a grazer but consumes more fallen leaves, flowers and fruits in winter/dry season (Sankar 1994; Sankar and Acharya 2004; Raman in press). In addition to plant soft matter, crabs (in the Sunderbans; Stanford 1951), mushrooms (in Nepal; Moe and Wegge 1994), and rarely, bark (Raman et al. 1996) are eaten. Close to human habitation, rubbish and even human faeces are occasionally taken (Raman et al. 1996). Antler and bone chewing is also common. In Wilpattu, Sri Lanka, all age and sex classes are osteophagous, but such feeding was more common in velvet-antlered males, doubtless reflecting mineral needs during antler growth and mineralisation (Barrette 1985). Chital usually drinks water once a day, more frequently in summer. This restricts them to forest tracts with assured presence of water, even if only widely scattered.

In lowland Nepal, an individual’s total range incorporates a core area of about 32 hectares surrounded by foraging and cover areas of about 140 ha for females and 195 ha for males (Moe and Wegge 1994). Variation in range size occurs with site, season, sex and age of the animal. The basic social unit is a matriarchal family group, normally consisting of an adult female, her offspring from the previous year, and a fawn (Ables 1974). The usual herd is composed of two or more such family units and is often accompanied by individual deer of mixed sex and age-classes. Chital exhibits a fission-fusion system, or fluid group formation and dissolution (Schaller 1967; Mishra 1982; Barette 1991). Group composition changes frequently during feeding periods, during the rut when males frequently join groups of females (Schaller 1967), and while fleeing from predators (Dinerstein 1980). These social groupings of Chital do not remain permanent (Schaller 1967; Eisenberg and Lockhart 1972). Groups may number up to 150 or more individuals (De and Spillit 1966; Schaller 1967; Eisenberg and Lockhart 1972; Krishnan 1972; Fuchs 1977; Karanth and Sunquist 1992), sometimes even more: N.S. Kumar (pers. comm. 2008) counted 211 in one group during rainy season in Nagarahole and 203 in one group at Pench-Maharashtra near a water reservoir in summer. Measured sex ratios have all been biased towards females (Sankar and Acharya 2004 and references therein). Pariwakam (2006) observed nearly 10,500 Chital in Bandipur and estimated the proportion of Chital in different age and sex classes as stags 27%, does 57% and fawns 16%. In neighbouring Nagarahole, age-sex categories of Chital were adult stags 26%, adult does 36%, yearling males 8%, yearling females 9% and young 21% (Karanth and Sunquist 1992). Breeding can occur at any time of year but there is some peaking at any given locality (Sankar and Acharya 2004 and references therein). Heavy mortality of fawns in early weeks has been observed by several workers and fawn survival appears to be a key determinant of Chital population growth (Schaller 1967). Schaller (1967) estimated an annual fawn mortality of 48% in Kanha, Sharathchandra and Gadgil (1975) estimated a constant monthly mortality of 26% over first nine months in Bandipur, Raman (1996) estimated a mean monthly mortality of 9.7% in Guindy. Pariwakam (2006) for the first time used a rigorous photographic capture-recapture approach to estimate the fawn mortality rate, and found it to be 66% over a 6-week study period in Bandipur. Further information on sociality and breeding is synthesised by Sankar and Acharya (2004) and by Raman (in press).

Chital is a prolific breeder, as documented by several empirical studies of the speed of increase by newly introduced populations or in those where a factor restraining populations was removed (Raman in press and references therein). In Bhadra, following the departure from the park of human settlements and consequent removal of anthropogenic pressures on Chital and habitats, Chital populations bounced back by nearly seven times in fewer than four years (K.U. Karanth and N.S. Kumar unpublished data). Karanth et al. (1999) earlier documented their empirical observations of the recovery of Chital populations in Nagarahole. This and its diverse diet and habitats allow high density where threats are controlled. It is even considered to be a pest in the Andamans (Banerji 1955).
The main causes of death are predation, diseases, and accidents. Occasionally, stags kill each other when fighting (Sankar and Acharya 2004 and references therein). Predation is by far the major cause of Chital mortality. Older Chital stags are more susceptible to it than are younger stags (Johnsingh 1983; Patel 1992; Karanth and Sunquist 1995). This may be due to their being less vigilant during rut, to their separation from the group after the rut, or to weakening from injuries from conflicts. In Kanha, Chital remains were found in about 52% of Tiger faeces and 59% of Leopard Panthera pardus faeces analysed (Schaller 1967). In Bandipur, Chital is the most important prey in terms of the biomass taken by Dhole (78%), Leopard (55%) and Tiger (19%) (Andheria et al. 2007). Even in terms of the relative number of individuals taken, Chital is the predominant prey among the three large sympatric predators (Tigers about 33%, Leopards about 39% and Dholes about 73% in Bandipur; Andheria et al. 2007). In adjoining Nagarahole remains were found in about 31% of Tiger faeces, 44% of Leopard faeces, and 50% of Dhole faeces (Karanth and Sunquist 1995). In Sariska, around 54% of the faeces of Tiger and 21% of Leopard faeces contained Chital remains (Sankar 1994). Chital remains were found in about 53% of Tiger faeces in Pench (Biswas and Sankar 2002) and 61% of Tiger faeces in Ranthambore (Bagchi et al. 2003).

Each Chital spends a major portion of its life in foraging, resting, and wandering within its range, with the relative extent of these activities determined by season (Schaller 1967). In a day, peak feeding times are around dawn and dusk. There are usually two major resting periods, before dawn and mid-day (Sankar and Acharya 2004).
Considerable further detail on ecology, drawn from the relative wealth of studies on the species, with each item precisely referenced to source, is provided by Raman (in press).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In their native lands, the deer occupy grasslands and very rarely move into areas of dense jungle that may occur adjacent to them. Short grasslands are an important area for them due to a lack of cover for predators such as the tiger (Moe and Wegge, 1994). Riverine forests within the Bardia National Park in lowland Nepal are highly utilized by the deer for shade and cover during the dry season. The forest also provides good foraging with regard to fallen fruit and leaves that are high in nutrients needed by the deer. Therefore, the deer require open areas as well as forested areas within their home ranges for optimum habitat. Their total range incorporates a core area of about 32 hectares(ha) surrounded by foraging and cover areas of about 140 ha for females and 195 ha for males (Moe and Wegge, 1994). Some variation in range size occurs depending on the season as well as the sex.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats grass, leaves of broadleaf plants, seed pods; browses on woody plants.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The main foods utilized by these deer are grasses as well as flowers and fruits which fall from the forest trees. They will occasionally browse when it is necessary. During the monsoon season, grass and sedge species in a sal forest are an important food source. Another source of nutrition may come from mushrooms which are high in proteins and nutrients and are also found in sal forests (Moe and Wegge, 1994).

Plant Foods: leaves; wood, bark, or stems; fruit

Primary Diet: herbivore (Folivore )

  • Moe, S., P. Wegge. 1994. Spacing behavior and habitat use of Axis deer (Axis axis) in lowland Nepal. Canadian Journal of Zoology, 72(10): 1735-1743.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Fairly gregarious.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The especial habitat of this deer, perhaps the most beautiful in form and coloration of the whole family, is amongst bushes and trees near water, and in bamboo-jungle. The spotted deer is found both in hilly ground and on alluvial plains. It never goes far from its drinking-places. So long as it has a wild tract of bush or ravines for shelter, it appears to care little for the neighbourhood of man. Many of its favourite haunts are in some of the most beautiful wild scenery of the Indian plains and lower hills, on the margins of rippling streams with their banks over-grown by lofty trees, or in the grassy glades that open out amidst the exquisite foliage of bamboo clumps. Spotted deer are thoroughly gregarious and associate at all times of the year in herds, sometimes of several hundreds. They are less nocturnal than sambar, and may be found feeding for three or four hours after sunrise, and again in the afternoon for an hour or two before sunset. They generally drink between 8 and 10 o'clock in the morning, the time varying with the season of year, and repose during the day in deep shade. They swim well, and take readily to water. They both graze and browse. There is great irregularity as to the period of dropping the horns, and bucks with perfect antlers may be found at all seasons. The call of the spotted deer is a peculiar, loud, hoarse barking sound, easily recognized but difficult to describe. This deer also utters a shrill alarm cry."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Axis deer have several vocalizations besides the bellowing that occurs during the mating season. They have a bark that is used during times of alarm or when an unusual object has been observed. This usually occurs among females and juveniles and is repeated back and forth. Another kind is squealing which is used by fawns when they get separated from their mothers. Moaning is associated with males during aggressive displays or when resting (Ables, 1977).

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
15.0 years.

Average lifespan

Status: captivity:
20.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.8 years (captivity) Observations: These animals can live up to 20.8 years in zoos (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproductively active nearly year-round in Texas (Howery et al. 1989) and Hawaii (Kramer 1971). Breeding peaks in spring-summer in Hawaii. Gestation lasts about 229 days. In Hawaii, litter size usually is 1 and most females are sexually mature in their first year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"The period of gestation is 8 months, or 6 according to Hodgson. Young fawns are born almost throughout the year."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males tend to bellow during the mating season which may be a good indicator of when breeding begins.

Axis deer breed in April or May and have a gestation of about 7.5 months. They usually have two fawns but one or three is not uncommon(Walker, 1964). The number of fawns produced as well as the mating season may vary for deer in captivity; only one fawn is usually produced and mating may take place from May to August (Ables, 1977). First pregnancies usually occur between the ages of 14 to 17 months. The female usually maintains nursing until the fawn can safely roam with the herd (Walker, 1964).

Breeding interval: Axis deer breed once yearly.

Breeding season: Breeding occurs in April and May.

Range number of offspring: 1 to 3.

Average gestation period: 7.5 months.

Range age at sexual or reproductive maturity (female): 14 to 17 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 3144 g.

Average gestation period: 226 days.

Average number of offspring: 1.03.

Average age at sexual or reproductive maturity (male)

Sex: male:
913 days.

  • Walker, E. 1964. Mammals of the World. Baltimore: Johns Hopkins Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Axis axis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCGTTAACCGCTGATTGTTTTCAACTAATCATAAAGATATCGGTACTCTATACCTACTATTTGGTGCTTGAGCAGGCATAGTAGGTACAGCCTTAAGCCTATTAATTCGCGCTGAACTAGGCCAACCTGGCACCCTGCTTGGAGATGACCAAATTTATAATGTAATCGTAACCGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGTAATTGACTGGTTCCCTTAATAATTGGTGCTCCAGATATGGCATTCCCTCGAATAAACAATATAAGCTTTTGACTCCTTCCTCCCTCTTTTTTACTGCTTCTAGCATCATCTATAATTGAAGCTGGCGCAGGAACAGGCTGAACTGTATATCCTCCTCTAGCTGGTAATTTAGCTCACGCAGGGGCTTCAGTAGACCTGACTATTTTTTCTTTACACCTAGCAGGCGTCTCTTCAATTTTAGGGGCCATTAACTTTATTACAACAATTATCAATATAAAACCCCCTGCTATGTCACAATACCAAACTCCTCTATTCGTGTGATCCGTACTAGTTACTGCTGTATTACTGCTTCTTTCCCTCCCTGTACTAGCGGCCGGAATTACAATATTATTAACAGATCGAAATTTAAATACAACCTTCTTTGATCCAGCGGGAGGCGGAGACCCTATTTTATACCAACACTTGTTCTGATTTTTTGGTCACCCTGAAGTATATATCCTTATTTTACCCGGTTTCGGTATAATTTCCCACATCGTAACATATTACTCAGGAAAAAAAGAACCATTCGGGTACATAGGAATGGTCTGAGCTATAATATCAATTGGATTTCTAGGATTCATCGTATGAGCCCACCATATATTCACAGTTGGAATAGATGTTGACACACGAGCCTATTTCACATCAGCTACCATGATTATTGCTATCCCAACTGGAGTAAAAGTCTTTAGTTGATTAGCAACACTTCACGGAGGCAATATTAAATGATCACCTGCCATAATATGAGCTTTAGGCTTTATTTTCCTTTTTACAGTTGGAGGCTTAACCGGAATTGTTCTTGCCAACTCTTCTCTAGACATTGTCCTTCATGACACATATTATGTAGTTGCACATTTCCATTATGTACTGTCAATAGGAGCCGTATTTGCTATTATAGGAGGGTTTGTTCATTGATTTCCATTATTCTCAGGATATACACTCAATGACACATGAGCCAAAATTCACTTTGTAATTATATTTGTAGGCGTAAATATAACTTTCTTTCCACAACATTTCCTAGGATTGTCCGGTATGCCACGACGCTATTCTGATTATCCAGACGCATACACAATGTGAAATACTATCTCATCCATAGGCTCATTCATTTCTTTAACAGCAGTTATATTAATAATCTTTATTATCTGAGAAGCGTTCGCATCCAAACGAGAAGTCTCAATCGTAGAATTAACAACAACAAATTTAGAGTGATTAAACGGATGCCCTCCGCCATATCATACATTTGAAGAACCTACGTATATTAACTTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Axis axis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Duckworth, J.W., Kumar, N.S., Anwarul Islam, Md., Hem Sagar Baral & Timmins, R.J.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
Chital is listed as Least Concern because it occurs over a very wide range within which there are many large populations. Although it is still declining in some sites (particularly outside protected areas), at the species level any such declines are at nowhere near the rate required to qualify for listing even as Near Threatened. Historical declines may have been higher, but these occurred outside of the three generation window (<30 years) used for purposes of applying Red List Criteria. Listing as Least Concern recognizes that there are two significant conservation issues with this species. Firstly, current densities are mostly well below what the habitat could support (and have been for decades), and secondly, the long-term persistence of nearly all populations is dependent upon well secured protected areas: anything which caused the breakdown of current effective protection would allow a rapid rise in hunting levels and perhaps of domestic stock-grazing. These are the factors with which current Chital numbers are in an uneasy and fragile relationship. If such changes were to occur across a significant part of the range, reassessment of red list status would be required: without effective protection, Chital’s population trend would emulate that of Eld's deer Rucervus eldii, another herding deer of rather open forests, but with a geographic range covering areas without long-standing effective protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red List Category & Criteria: Least Concern ver 3.1 Year Published: 2008
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The axis deer has been introduced into Texas and Hawaii with good results. They do very well in captivity and can be seen at Zoos in the United States. Most are on private lands in the U.S., however, some are free-ranging.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Chital declined drastically throughout its range up until the first two-thirds of the 20th century (see under Major Threats). It is now locally abundant in appropriate habitat throughout its range. In India it occurs in 123 Protected Areas and forest tracts (National Wildlife Database, Wildlife Institute of India in Sankar and Acharya 2004). There are some large populations in Nepal (e.g. Moe and Wegge 1994) where the population is probably currently stable and is anticipated to remain so in the immediate future (Hem Sagar Baral in litt. 2008). Thousands survive in the Sundarbans mangrove forest, Bangladesh, and there are a few introduced populations on coastal islands in the south (Md Anwarul Islam in litt. 2008).

The reported ecological densities of Chital mostly fall within 3–50 animals per km² in India: Bhadra Tiger Reserve, 4.51 +/- 1.05 (SE) per km² (Jathanna et al. 2003); Madhya Pradesh Pench National Park dry deciduous forest, 51.3 animals per km² (Karanth and Nichols 2000); Kanha moist deciduous forest, 49.7 animals per km² (Karanth and Nichols 2000); Nagarahole moist deciduous forest, 50.6 animals per km² (Karanth and Sunquist 1992); Bandipur dry deciduous forest, 20.1 animals per km² (Karanth and Nichols 2000); Tadoba-Andhari dry deciduous forest, 3.2 animals per km² (Karanth and Kumar 2005); Maharashtra Pench dry deciduous forest, 5.8 animals per km² (Karanth and Kumar 2005); Ranthambore semi-arid dry deciduous forest, 38.4 animals per km² (Kumar 2000); and Gir semi-arid dry deciduous forest, 50.8 animals per km² (Khan et al. 1996). Some parts of the well-protected areas in Nagarahole and Bandipur are known to harbour densities as high as 80–100 Chital per km² (N.S. Kumar pers. comm. 2008). The highest population densities, of around 200 Chitals per km², are reported for the Bardia National Park, Nepal (Naess and Andersen 1993; Moe and Wegge 1994) and for the reintroduced population in Guindy National Park, southern India (Menon 1982; Raman et al. 1996). These high densities reflect habitat and food availability in the former area (Moe and Wegge 1994), and supplementary feeding and low predation in the latter (Raman et al. 1996). Population densities in marginal habitats tend to be lower (Raman in press; K.U. Karanth and N.S. Kumar unpublished data). Chital is the most abundant ungulate in Nagarahole, and reaches higher densities in moist than in dry deciduous forests (Karanth and Sunquist 1992). The recorded Bhadra density is low, reflecting poaching and livestock grazing (Jathanna et al. 2003), and the population density is steadily increasing following removal of these pressures in 2003 (K.U. Karanth and N.S. Kumar unpublished data). A study at Nagarahole National Park compared an area which was only moderately hunted with a heavily hunted site. This found respective densities of 65 and 10 Chitals per km² (Madhusudan and Karanth 2002).

The only population in Europe is on the islands of Brijuni (off Istria, Croatia), but B. Krystufek (pers. comm. 2008) has traced no information on its current status. Information has not been sought for this account on introduced populations elsewhere, because they do not contribute to assessing the species’ Red List status.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are presently no major global-level threats to Chital, although densities are widely below ecological carrying capacity, through hunting and competition with domestic livestock. There were substantial declines and local extinctions, driven by hunting for meat, extermination as an agricultural pest, and habitat conversion, particularly during British rule of India and adjacent countries, and immediately after independence (Raman in press). Fewer than 20 years after independence, Schaller (1967) wrote that "...the species has declined drastically throughout its range in India, and is now only locally abundant in some sanctuaries and forest tracts. The remaining populations are highly vulnerable to poaching, habitat destruction, and other forms of decimation". The habitat loss of the past few centuries means that populations are now rather fragmented. Now, in India, most populations appear secure within the modern protected area network (Raman in press), but those outside (now highly localised) are under rapid decline due to habitat conversion and extensive hunting (N.S. Kumar pers. comm. 2008). A relaxation of protection can lead to rapid decreases. For example, Chital used to be numerically the most abundant large herbivore in the Wilpattu National Park (Sri Lanka), but numbers declined significantly due to poaching which increased during management breakdown during the civil war, when its meat was even being sold next to the park. Poaching has also risen, for the same reason, in several other national parks in Sri Lanka (Santiapillai and Wijeyamohan 2003). Where not prevented by effective conservation measures (active protection through patrolling and law enforcement, backed up by adequate awareness), people avidly hunt and poach Chital throughout their Indian range (Madhusudan and Karanth 2000, 2002; Sankar and Acharya 2004; Bali et al. 2007) and there are occasional cases in even the best secured protected areas such as Corbett Tiger Reserve (Johnsingh et al. 2004). Many protected areas are well enough secured that the species has thrived well and, is now locally abundant (Sankar and Acharya 2004) and in such areas poaching of Chital is a more serious conservation problem for the large predators (every deer poached reduces predators’ food base; Karanth et al. 2004) than it is for Chital itself. In many other protected areas (especially those with a lower public profile) and for areas outside the conservation system, populations are severely restrained by hunting. For example, densities in Bhadra Tiger Reserve are very low by comparison with what the habitat should support because of poaching with snares, dogs, and shotguns, and also grazing competition with domestic stock (Jathanna et al. 2003), and the density was 87 percent lower in a heavily hunted area of Nagarahole National Park than in a well secured area (Madhusudan and Karanth 2000, 2002). Even though all hunting is illegal in this protected area, protection efficacy is uneven across the area. The Chital is one of the two most commonly hunted mammal species in the national park, partly because various facets of its behaviour and ecology such as herding behaviour and attachment to open habitat allow its ready detection and killing, and quick entry and exit by poachers. It is therefore exposed to far higher hunting pressure than are the ungulates which are solitary and spend much time in dense cover (Madhusudan and Karanth 2002). Poaching is probably operative to a greater or lesser extent in most populations, but at low enough levels that recent decades have not seen, with Chital, the frequent local extirpations from areas of prime habitat of earlier decades.

The most serious threat, in areas where poaching and habitat conversion are well controlled, is the reduction in carrying capacity through competition with livestock, especially during the pinch season as observed in Sariska (Sankar 1994); Chital and livestock are known to have dietary overlap (Raman in press). The problem has been documented almost throughout Chital’s range but awareness that it is a problem at all remains so low that it is not even recognised as a key conservation issue in many protected areas (e.g. Mathai 1999). In Gir Lion Sanctuary and National Park, Chital population density increased 14-fold from 3.57 animals per km² in 1970–1971 (Berwick 1974) to 50.8 animals per km² in 1989 (Khan 1996; Khan et al. 1996). This was attributed to the rapid and complete removal of pastoral settlements, their livestock, and a total ban on several thousand migratory livestock. Dung densities of Chital and livestock were also negatively correlated in Gir, indicating avoidance and possible competitive interaction between the species. With removal of human impact and increase in forage availability, Chital population increased, as testified by higher Chital densities in the vicinity of abandoned settlements (nesses; Sharma and Johnsingh 1995). Similarly, in Bardia National Park (Nepal), protection from livestock grazing (and logging) in 1975 increased measured Chital populations from 30–34 per km² in 1977 (Dinerstein 1980) to over 200 per km² in the early 1990s (Naess and Andersen 1993; Moe and Wegge 1994). In Bandipur Tiger Reserve, mean densities of Chital were 11 times higher in livestock-free areas than in adjacent livestock-grazed areas. In shared grazing areas, these Chital densities declined sharply with increasing livestock densities. In the studied grazed area, halving the livestock density allowed an increase in Chital density by a factor of five (Madhusudan 2004). Threats to southern India’s forest ungulates by competition with domestic stock grazing within protected areas are exacerbated where dung is collected for export to adjacent coffee areas. Fuel wood removal may also be at levels sufficient to disrupt nutrient cycles of the habitat (Madhusudan 2005). All these pressures interact to have, overall, a major depression of Chital densities. In Bhadra, following the departure from the park of human settlements and consequent removal of anthropogenic pressures on Chital and habitats, Chital populations bounced back by nearly seven times in fewer than four years (Karanth and Kumar unpublished data). Karanth et al. (1999) earlier documented their empirical observations of the recovery of Chital populations in Nagarahole.

Chital are susceptible to livestock-borne diseases such as rinderpest (Schaller 1967) and foot-and-mouth disease (Sankar 1994) but the current population is too widespread for these to rank as potential global-level threats. Accidents, especially from speeding vehicles, are a cause of Chital mortality but occur rarely within protected areas and cannot be significant at the global level. Many Indian forest areas are severely encroached by exotics such as Lantana camara, Parthenium spp. and Chromolaena odorata (= Eupatorium odoratum), and these are suspected to effect major changes to forest structure (Hiremath and Sundaram 2005): but their effects on Chital populations warrant further study. Wild-ranging domestic dogs are also likely to be a problem (Raman in press), but no study quantifying their effects has been traced. There are no predictable threats to the Sundarbans population of Bangladesh, but as a low-lying area extreme weather events might cause episodic major population removal, as happened with hurricane Sidr in November 2007 (Md Anwarul Islam in litt. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

No major global threats
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Tomich (1986) for review of legal battle over proposed introduction onto island of Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
The Chital is protected under Schedule III of the Indian Wildlife Protection Act (1972) (Sankar and Acharya 2004) and under the Wildlife (Preservation) (Amendment) Act, 1974 of Bangladesh (Md Anwarul Islam in litt. 2008). It occurs in many protected areas. Legal protection as a species and a network of functioning protected areas are the two cornerstones of its current healthy conservation status. Populations exceeding 20,000 Chitals probably occur in and around a handful of conservation areas within India: the belt of about 3,000 km² between Koh river and Haldwani including the Corbett Tiger Reserve; the Gir Protected Area (about 1,400 km²); Kanha Tiger Reserve (about 2,000 km²); and the Nilgiris–Western Ghats sector including Nagarahole, Bandipur, and Mudumalai (about 5,000 km²) (Raman in press). Protected areas support more Chitals than do non-protected areas in the Terai Arc Landscape of India, although there is not currently such a great difference in densities as with the grassland species (Barasingha Rucervus duvaucelii and Hog Deer Axis porcinus) (Johnsingh et al. 2004). Ongoing habitat conversion trends outside protected areas will continue to increase the relative proportion of the total Chital population that they hold, and the maintenance of an extensive network of functional protected areas will remain the foundation of this species’s healthy conservation status. Part of this responsibility is vigilance by staff and partners of illegal poaching, which takes place at varying levels in most of the species range. Some recent cases have involved high-profile public role models such as actors poaching Chital and these warrant heavy court penalties. There is a strong case for prevention of livestock grazing in protected areas which hold Chital, partly to reduce risks of disease transmission, but mostly to prevent artificially low densities of Chital being forced through competition (see Major Threats).

Chital populations have been studied in: Corbett (De and Spillit 1966), Kanha (Schaller 1967), Bandipur (Johnsingh 1983), Nagarahole (Karanth and Sunquist 1992), Sariska (Sankar 1994), Gir (Khan et al. 1995, 1996), Guindy (Raman 1996, Raman et al. 1996), Pench (Biswas and Sankar 2002), Ranthambore (Bagchi et al. 2003) in India, Chitwan (Seidensticker 1976; Mishra 1982) and Karnali-Bardia (Dinerstein 1980; Moe and Wegge 1994, 1997) in Nepal, and Wilpattu (Eisenberg and Lockhart 1972) in Sri Lanka.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Hunted in Hawaii (mainly Lanai) (Tomich 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Axis deer have become an important resource for hunting in the United States.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chital

The chital or cheetal (Axis axis),[2] also known as chital deer, spotted deer or axis deer, is a deer which commonly inhabits wooded regions of India, Sri Lanka, Nepal, Bangladesh, Bhutan, and in small numbers in Pakistan. The chital goes by various names in India, among which include: chital horin in Bengali, thith muwa in Sinhalese, jinke in Kannada, pulli maan in Tamil and Malayalam, jinka in Telugu, phutuki horin in Assamese, haran/harin in Marathi, and hiran in Hindi/Urdu (the latter two derived from harini, the Sanskrit cognate for 'deer'). It is the most common deer species in Indian forests. The name chital comes from the Bengali word chitral (চিত্রল)/chitra (চিত্রা), which means "spotted". The chital is monotypic within the genus Axis, but this genus has also included three species that now are placed in Hyelaphus based on genetic evidence.[3][4]

(video) A Chital eats at a zoo in Japan.

Description[edit]

Drawing of skull

The chital's coat is pinkish fawn, marked with white spots, and its underparts are also white. Its antlers, which it sheds annually, are usually three-pronged and curve in a lyre shape and may extend to 75 cm (2.5 ft). Compared to the hog deer, its close relative, the chital has a more cursorial build. It also has a more advanced morphology with antler pedicles being proportionally short and its auditory bullae being smaller. It also has large nares. The male chital averages about 90 cm (35 in) tall at the shoulder, with a total length of 170 cm (67 in), including a 20 cm (7.9 in). Males, at a typical weight of 30 to 75 kg (66 to 165 lb), are somewhat larger than females, at 25 to 45 kg (55 to 99 lb).[5] Exceptionally large males can weigh up to 98 to 110 kg (216 to 243 lb).[6] Their lifespans are around 8–14 years.

Chital have well-developed preorbital glands which have hairs that are like stiff little branches.[7] They also have well-developed metatarsal glands and pedal glands on their hind legs. Males have larger preorbital glands than females and are opened very often in response to certain stimuli.[8][9]

Range[edit]

The chital ranges over 8–30ºN in India and through Nepal, Bhutan, Bangladesh, and Sri Lanka.[10] The western limit of its range is eastern Rajasthan and Gujarat. The northern limit is along the Bhabar-terai belt of the foothills of the Himalaya and from Uttar Pradesh and Uttaranchal through to Nepal, northern West Bengal and Sikkim and then to western Assam and the forested valleys of Bhutan which are below 1,100 m asl.[1] The eastern limit of its range is through western Assam[11][12] to the Sunderbans of West Bengal (India) and Bangladesh.[1] Sri Lanka is the southern limit.[13] Chital occur sporadically in the forested areas throughout the rest of the Indian peninsula.[14] However, it currently occurs only in the Sundarbans in Bangladesh, as it became extinct in the central, north-east and south-east regions.[1]

Australia[edit]

The chital was the first species of deer introduced into Australia in the early 1800s by Dr. John Harris, surgeon to the New South Wales Corps, and he had about 400 of these animals on his property by 1813. These did not survive and the primary range of the chital is now confined to a few cattle stations in North Queensland near Charters Towers and several feral herds on the NSW north coast. While some of the stock originated from Sri Lanka (Ceylon), the Indian race likely is also represented.

The United States[edit]

In the 1860s, axis deer were introduced to the island of Molokai, Hawaii, as a gift from Hong Kong to King Kamehameha V. Today, the deer are plentiful on Lanai, another of the Hawaiian Islands. The paniolos (cowboys) were instructed to lasso the deer from Molokai and to bring them for shipping to Lanai. Hawaii wildlife officials believe people have flown the deer by helicopter and transported them by boat onto the island. In August 2012, a helicopter pilot pleaded guilty to transporting four axis deer from Maui to the Big Island. [15]

The deer were introduced to Maui island in the 1950s as part of a post-World War II veteran hunting opportunity. Because the deer have no natural predators on the Hawaiian islands, their population is growing 20 to 30% each year.[16] Hawaii law now prohibits "the intentional possession or interisland transportation or release of wild or feral deer."[17]

In 1932, axis deer were introduced to Texas. In 1988, self-sustaining herds were found in 27 counties, located in central and southern Texas.[18] The deer are most populated on the Edwards Plateau, where the land is similar to that of India.[19]

Ecology[edit]

The spotted deer is found in large numbers in dense deciduous or semievergreen forests and open grasslands.[13] The highest numbers of chital are found in the forests of India, where they feed upon tall grass and shrubs.[7] Chital have been also spotted in Phibsoo Wildlife Sanctuary in Bhutan, which is the only remaining natural sal (Shorea robusta) forests in the country. They do not occur at higher-elevation forests, where they are usually replaced by other species such as the Sambar deer. They also prefer heavy forest cover for shade and are intolerant of direct sunlight.[7][13]

Browsing chital
Chital at an evergreen area
Chitals drinking at a waterhole

Chital are primarily grazers and feed on short, sprouting grasses.[7][13] However, they will also browse, as well as eat forbs, fruit, and branches of trees, especially when they are thrown down by monkeys.[7][13] Stags, more than hinds, will stand on their hind legs on feed on tree foliage.[7][13] Chital also eat their shed antlers as a source of nutrients, and will use mineral licks.[7][13] Chital prefer to be near water and will drink in mornings and evenings in hot weather. Predators of the chital include wolves, tigers, Asiatic lions (in Gir Forest only), leopards, Indian rock pythons, dholes, and mugger crocodiles. Red foxes and golden jackals also sometimes prey on chital fawns. Hinds and fawns are more likely to be victims of predation than adult stags,[7] and dholes are more successful in catching stags than tigers and leopards.[7] The chital can run up to 40 mph (65 km/h) to escape its predators.[20][21]

An interesting relationship has been observed between herds of axis deer and troops of the Northern Plains gray langurs (Presbytis entellus), a widespread leaf-eating monkey taxon of South Asia. Axis deer apparently benefit from the langurs' good eyesight and ability to post a lookout in a treetop, helping to raise the alarm when a predator approaches.[13] For the langurs' part, the axis deer's superior sense of smell would seem to assist in early predator warning, and it is common to see langurs foraging on the ground in the presence of axis deer.[13] The axis deer also benefit from fruits dropped by the langurs from trees such as Terminalia bellerica and Phyllanthus emblica.[22] Alarm calls of either species can be indicative of the presence of a predator such as a tiger.[citation needed]

Social behavior and reproduction[edit]

Two chital stags (one hard, one velvet)

Axis deer most commonly occur in herds of 10 to 50 individuals of both sexes. Large dominant stags without velvet stay in the center of the herd and are surrounded by the females and their young.[7] Smaller stags with velvet occupy the boundaries of the herd. Chital stags pay close attention when a stag of equal size to them enters their group.[7] They will follow, graze with, and display to the newcomer. Sparring is more common between young stags, while older, larger stags prefer horning, pawing, and marking.[7] Large stags with hard antlers are more likely to be well spaced out. Stags are known to stand on their hind legs and mark tree branches above.[7][13]

The chital has a protracted breeding season due in part to the tropical climate, and births can occur throughout the year. For this reason, males do not have their antler cycles in synchrony and some females are fertile at all times of the year. Males sporting hard antlers are dominant over those in velvet or those without antlers, irrespective of their size and other factors. Stags commonly bellow during the rut.[13] Chital hinds have three-week long estrous cycles. Chital courtship is based on tending bonds.[7][13] A stag will follow and guard a hind in estrus.[7] During this time, the stag will not eat. The pair will do several bouts of chasing and mutual licking before copulation.[7][13] Hinds birth one fawn, rarely two, at a time.[7] Young fawns suckle longer than older fawns which suckle for 55 seconds. Hinds and fawns have loose bonds and it is common for them to get separated.[7] However, because chital tend to stay close to each other, it is not difficult for a hind to find a fawn.[7] Fawns sometimes gather in nurseries.

Albino chital at Ranthambore National Park, India

Chital are generally silent when grazing together.[7] They do, though, make high-pitched chuckles when walking. When grazing, chital do a "courtesy posture" when they pass each other.[7] The bellow of a chital stag exists in a primitive state of development compared to other deer like the red deer or elk. Its calls are one or several coarse bellows and loud growls, which may be weaker versions of the bellow.[7] Bellowing coincides with rutting.[13][23] Stags guarding estrous females will make high-pitched growls at lesser stags that hang about.[7] Stags will also moan during aggressive displays or when resting.[24] When alarmed, chital will bark. These barks usually occur among females and juveniles, and is repeated back and forth. Fawns separated from their mothers will squeal. When in danger, they run in groups. They will make bursts of high-speed running and then soon tire and dive into heavy cover to hide.[7]

Status[edit]

The chital is listed by the IUCN as Least Concern "because it occurs over a very wide range within which there are many large populations".[1] Currently, no range-wide threats to chitals are present, and they live in many protected areas. However, population densities are below ecological carrying capacity in many places due to hunting and competition with domestic livestock. Hunting for the deer's meat has caused substantial declines and local extinctions.[1] The axis deer is protected under Schedule III of the Indian Wildlife Protection Act (1972)[14] and under the Wildlife (Preservation) (Amendment) Act, 1974 of Bangladesh.[1] Two primary reasons for its good conservation status are its legal protection as a species and a network of functioning protected areas.[1]

The chital has been introduced to Australia, Mexico, Chile, Argentina, Uruguay, Brazil, Point Reyes National Seashore near San Francisco, California, Florida, Texas, Alabama, Mississippi, Louisiana, and Hawaii in the United States, Andaman Islands, Nicobar Islands, Armenia, Moldova, Italy, Bosnia and Herzegovina, Albania, Greece, Bulgaria, and to the Veliki Brijun Island in the Brijuni Archipelago of the Istrian Peninsula in Croatia.

Gallery[edit]

See also[edit]

References[edit]

  1. ^ a b c d e f g h Duckworth, J.W., Kumar, N.S., Anwarul Islam, Md., Hem Sagar Baral & Timmins, R.J. (2008). Axis axis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 8 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Grubb, P. (16 November 2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Pitra, C; Fickel, J; Meijaard, E; Groves, PC (2004). "Evolution and phylogeny of old world deer". Molecular Phylogenetics and Evolution 33 (3): 880–95. doi:10.1016/j.ympev.2004.07.013. PMID 15522810. 
  4. ^ Groves, Colin (2006). "The genus Cervus in eastern Eurasia". European Journal of Wildlife Research 52: 14–22. doi:10.1007/s10344-005-0011-5. 
  5. ^ Axis Deer (Cervus axis). Nsrl.ttu.edu. Retrieved on 2012-08-23.
  6. ^ Preliminary study of the behavior and ecology of axis deer on Maui, Hawaii. Hear.org. Retrieved on 2012-08-23.
  7. ^ a b c d e f g h i j k l m n o p q r s t u v w x Valerius Geist. Deer of the world: their evolution, behaviour, and ecology. Stackpole Books. 1998. pp. 58–73 ISBN 0811704963.
  8. ^ Groves, C. P. and P. Grubb (1987). "Relationships of living deer". pp. 21–59 in Biology and management of the Cervidae: a conference held at the Conservation and Research Center, National Zoological Park, Smithsonian Institution, Front Royal, Virginia, 1–5 August 1982. Smithsonian Institution Press ISBN 0874749808.
  9. ^ Müller-Schwarze, D (1987). "Evolution of cervid olfactory communication". pp. 223–234, in Biology and management of the Cervidae: a conference held at the Conservation and Research Center, National Zoological Park, Smithsonian Institution, Front Royal, Virginia, 1–5 August 1982. Smithsonian Institution Press ISBN 0874749808.
  10. ^ Grubb, P. 2005. Artiodactyla. In: D. E. Wilson and D. M. Reeder (eds), Mammal Species of the World. A Taxonomic and Geographic Reference (3rd ed), pp. 637–722. Johns Hopkins University Press, Baltimore, USA.
  11. ^ Gee, E.P. (1964). The wild life of India, Collins, London
  12. ^ Choudhury, A.U. (1994). Checklist of the mammals of Assam. Gibbon Books, Guwahati, India. ISBN 81-900866-0-X.
  13. ^ a b c d e f g h i j k l m n The Deer and the Tiger: A Study of Wildlife in India. George Schaller. University Of Chicago Press. 1967. Pg. 37–92. (Midway Reprint)
  14. ^ a b Sankar, K. and Acharya, B. 2004. Chital (Axis axis (Erxleben, 1777)). ENVIS Bulletin (Wildlife Institute of India, Dehra Dun) 7: 171–180.
  15. ^ Audrey McAvoy (22 August 2012). "Alleged animal smugglers used helicopters to fly sheep to Maui, deer to Big Island". Associated Press. Retrieved 22 August 2012. 
  16. ^ McAvoy, Audrey (24 May 2012). "Mystery deer growth pitting hunters against Hawaii". Associated Press. Retrieved 24 May 2012. 
  17. ^ "New law prohibits having or releasing feral deer in Hawaii", Honolulu Star-Advertiser, 21 June 2012, retrieved 21 June 2012 
  18. ^ Davis, William B., and David J. Schmidly. "Axis Deer". The Mammals of Texas – Online Edition. Texas Tech University. Retrieved 24 May 2012. 
  19. ^ Ables, Ernest D. "Axis Deer". Handbook of Texas Online. Texas State Historical Association. Retrieved 24 May 2012. 
  20. ^ Chital. The Animal Files. Retrieved on 2012-08-23.
  21. ^ Parc Zoologique de Fréjus : Cerf axis : Présentation détaillée de l'animal. Zoo-frejus.com. Retrieved on 2012-08-23.
  22. ^ Prasad, S.; R. Chellam; J. Krishaswamy & S. P. Goyal (2004) Frugivory of Phyllanthus emblica at Rajaji National Park, northwest India. Current Science 87(9):1188–1190
  23. ^ Mishra, H. and Wemmer, C. 1987. "The comparative breeding ecology of four cervids in Royal Chitwan National Park, Nepal". Washington, D.C.: Smithsonian Institution Press.
  24. ^ Albes, E. 1977. The Axis deer in Texas. Texas Agricultural Experimental Station, Texas A&M University: Caesar Kleberg Research Program in Wildllife Ecology and Department of Wildlife and Fisheries Sciences.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Cervus. Placed in the genus Axis by Grubb (in Wilson and Reeder 1993, 2005) and Jones et al. (1997).

See Cronin (1991) for a phylogeny of the Cervidae based on mitochondrial-DNA data. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!