Overview

Comprehensive Description

Description

M 32-34 mm, F 38-41 mm. A relatively large Brygoomantis from north-western Madagascar. Tibiotarsal articulation reaches the eye. Hand without webbing, foot webbing 1(0.5-0), 2i(1), 2e(0-0.5), 3i(1-2), 3e(0-1), 4i(1.5-2), 4e(1-1.5), 5(0). Terminal discs of fingers and toes slightly enlarged. Dorsal skin coarsely granular, with weakly developed dorsolateral folds. Colour dorsally brown, typically rather uniform, sometimes with a few dark markings or a light vertebral band or stripe. Venter dirty whitish with brown pigment, especially on the chest. Males with distinct femoral glands, yellowish in breeding specimens, and a weakly distensible single subgular vocal sac.

Taken with permission from Glaw and Vences (2007).

  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Nussbaum, R. and Vences, M. (2008). Mantidactylus ulcerosus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 29 April 2009.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution and Habitat

Ambilobe, Ankarafantsika (Ampijoroa, Antsiloky, Lac Tsimaloto), Berara forest, Lokobe, Manongarivo, Nosy Be. It occurs from sea level to 1,600m asl in slow-flowing streams of rainforest, heavily degraded areas, and open swampy areas. It also inhabits agricultural land (Nussbaum and Vences 2008).

  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Nussbaum, R. and Vences, M. (2008). Mantidactylus ulcerosus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 29 April 2009.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species complex is widely distributed in Madagascar except the high plateau and in the arid southwest. The map is not very meaningful, since it is an unresolved complex. It has been recorded from sea level up to 1,600m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is associated with (usually slow-flowing) streams in rainforest and in heavily degraded areas, and in open swampy areas. It does survive in agricultural land. It breeds in many types of water, especially slow-flowing streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mantidactylus ulcerosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGCCTCCTAATTCGAGCTGAATTAGGTCAACCCGGAACCCTACTCGGCGAT---GACCAAATTTATAATGTAGTTGTGACTGCCCATGCCTTCGTAATAATCTTTTTTATAGTCATACCCATTTTAATCGGAGGATTCGGAAACTGACTTGTTCCCTTAATAATTGGAGCCCCCGATATAGCCTTTCCCCGAATAAACAACATAAGCTTTTGACTTCTCCCCCCCTCTTTTTTTCTTCTCCTTGCCTCCTCTATAGTAGAAGTCGGCGCCGGAACTGGCTGAACAGTCTATCCACCCTTAGCCGGTAACCTAGCTCATGCAGGCCCATCAGTAGACCTCACCATTTTTTCGCTCCACCTCGCGGGTGTCTCTTCAATTCTTGGGGCCATCAACTTTATCACCACTATTCTGAACATAAAACCCCCATCAATAATTCAATACCAAACACCCTTATTTGTATGATCTGTTCTAATTACTGCTGTTCTTCTCCTTCTCTCTCTCCCTGTTTTAGCCGCTGGCATCACAATACTCTTAACAGACCGAAATCTAAATACAACCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mantidactylus ulcerosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Ronald Nussbaum, Miguel Vences

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habits: Found along streams and in swamps. Males call from hidden positions during the day and often from more open sites on the stream border or in the stream at night. Eggs are deposited in the leaf litter or on rocks next to the water, tadpoles are flushed into the stream after hatching and develop there.

Calls: A series of 4-5 pulsed notes of low intensity.

Breeding takes place in slow-flowing streams (Nussbaum and Vences 2008).

  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Nussbaum, R. and Vences, M. (2008). Mantidactylus ulcerosus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 29 April 2009.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a very abundant species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Life History, Abundance, Activity, and Special Behaviors

It occurs in many protected areas (Nussbaum and Vences 2008).

  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
  • Nussbaum, R. and Vences, M. (2008). Mantidactylus ulcerosus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 29 April 2009.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
It is generally not seriously threatened, since it is very adaptable. However, some of the cryptic species within the complex might prove to be threatened, especially by pollution of streams, and extreme opening up of the habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mantidactylus ulcerosus

Mantidactylus ulcerosus is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, rivers, swamps, freshwater marshes, intermittent freshwater marshes, and heavily degraded former forest. It is threatened by habitat loss.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!