Overview

Brief Summary

Biology

Famed for the alkaloid-based poison excreted from its skin, which can paralyse or kill potential predators, such as snakes and large spiders, the blue colouration of this frog actually serves as a warning that it is toxic. Its toxicity is obtained from its diet, which consists mainly of ants, although it will also consume many other arthropod species (2). Sometimes known as the blue poison arrow frog due to the tribal practice of dipping a dart tip in the poison before hunting. Moving amongst its habitat during the day with small leaps, the blue poison frog is an active species, as well as being bold, aggressive, and territorial. Males initiate breeding between February and March, calling loudly to attract females. If one or more females move towards a male, fights may ensue, with the victorious female earning the right to stroke the male's snout and back with her forelegs in courtship. The male then leads the female to an area that is moistened in preparation for egg-laying. The female continues to stroke the male, signalling that she is ready to deposit her eggs, and stimulating the male to release his sperm. Between two and six eggs are laid and are kept moist by the male. They hatch after 14 – 18 days and the tadpoles are carried to water pools within plants such as bromeliads on the backs of both the male and the female. For a further two to three months, the female repeatedly returns to each tadpole and lays an unfertilised egg for the tadpole to eat. At this time, the tadpoles are at risk of predation by snakes and mosquito larvae. Over time the tadpoles undergo metamorphosis, to form an adult blue poison frog. They are sexually mature at around two years old, and can live for up to five years (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

Often said to be the most alluring of all frog species, the blue poison frog's colouration is actually thought to function as a warning to predators that it is poisonous. Its limbs are royal blue, fading into an attractive sky blue background, peppered with both large and small black spots. The underside is similarly patterned, and may also sport a darker stripe down the centre (4). This species has a hunched body posture and large, black eyes. Females are plumper than males but may be more accurately distinguished by their toes. The blue poison frog has four toes on each foot, with enlarged suction cup tips to each toe. In the female these tips are round whereas in males they are heart-shaped (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

There are two morphs, one that was formerly known as Dendrobates azureus, and the previously recognized Dendrobates tinctorius. DNA analysis has shown that these forms are conspecific. Following is a description for the morph that was formerly known as Dendrobates azureus: this morph has bright blue-black arms and legs, paler, almost sky-blue and nearly unmarked sides, and a head and back covered with both large and small round spots. The underside is pale blue with round black spots, especially on the breast, and sometimes with a darker midbelly stripe. The oval tympanum is about a third of the eye diameter. Males have noticeably larger finger discs than females.

This account was adapted from an account for the species previously known as Dendrobates azureus.

  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Wollenberg, K. C., Veith, M., Noonan, B. P., and Lotters, S. (2006). ''Polymorphism versus species richness—systematics of large Dendrobates from the Eastern Guiana Shield (Amphibia: Dendrobatidae).'' Copeia, 2006(4), 623-629.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Distribution and Habitat

Its range is restricted to the southernmost portion of Surinam, in relict "forest islands" of the Sipaliwini Savannah.

The forests are humid, always have rocky streams of running water, and are relatively cool, with temperatures dropping up to 22-27 degrees C at night. Dendrobates tinctorius is found under cover, such as rocks and moss, near streams. It usually stays on the ground, but is also found at heights up to 5 m in trees.

  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Wollenberg, K. C., Veith, M., Noonan, B. P., and Lotters, S. (2006). ''Polymorphism versus species richness—systematics of large Dendrobates from the Eastern Guiana Shield (Amphibia: Dendrobatidae).'' Copeia, 2006(4), 623-629.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is known from the lowland forests of the Guianas and adjacent Brazil. A point locality map of its distribution in French Guiana is provided in Lescure and Marty (2001). It occurs up to 600m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dendrobates tinctorius inhabits small isolated pockets in French Guinea and northeastern Brazil. (Obst, 1988)

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species is found only on the western slope of Vier Gebroeders Mountain in the Sipaliwini Savannah of Surinam in South America, at 300 – 400 metres above sea level (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This is a large poison frog, commonly 40 to 50 mm with some females reaching 60 mm. This is a bright blue frog with two broad yellow stripes on the back, these stripes are connected by cross bands to produce 2 to 3 oval blue islands down the middle of the back. The arms and legs are black or deep blue with many bright yellow or black spots. Sometimes the yellow is replaced with white or the two yellow stripes fuse across the back to produce a frog with a solid yellow back on a bright blue or black background--they are truly striking animals. It has a typical erect posture and a distinct tympanum about half the diameter of the eye. In theory males can be distinguished from females by having larger finger discs that are cut straighter across the tips. Additionally, males are somewhat territorial and may wrestle, but so do females on occasion. Of course only males call. (Walls, 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It inhabits the forest floor of tropical rainforest. Its eggs are laid out of water, and then the tadpoles are carried by the males to puddles (tree holes, etc) where they develop further.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dendrobates tinctorius are creatures of humid, usually wet habitats, and their skins are not waxy enough to prevent evaporation in dry air. Often it is found in heavy vines one to two meters above the ground where its bright yellow stripes stand out in the darkness of the forest. (Walls, 1994)

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in primary forest (1), the blue poison frog prefers to stay under the cover of rocks and moss around streams, but is sometimes seen up to five metres high in trees (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

All Dendrobatids are insectivores. The diet consists mainly of ants, termites, and other small insects and small spiders. Adults tend to actively search and hunt down prey. (Obst, 1988 and Walls, 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: These animals have been recorded to live up to 7.6 years in captivity (http://www.pondturtle.com/). Most likely, however, their maximum lifespan is considerably greater. Anecodtal claims of animals living 12-15 years in captivity are plausible. Further studies are needed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Amplexus occurs always on land, never in water. Eight to ten eggs are laid and the male ejaculates the sperm directly over the eggs. The male will carry the nearly hatched tadpoles on his back to water. There tends to be considerable sibling aggression among the larvae. (Obst, 1988) Dozens of tadpoles may be placed in one large water hole by several males. Tadpoles reach transformation size in about ten weeks and feed on almost anything. (Walls, 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

Recent work has indicated that the long recognized species Dendrobates azureus is actually just a variant of the highly polymorphic D. tinctorius, making the name D. azureus a no longer valid junior synonym (Wollenberg et al. 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrobates azureus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATATTTGGTATTCGGAGCGTGAGCCGGAATAGTCGGCACAGCCCTTAGCCTCTTAATTCGAGCAGAATTGAGCCAACCTGGAGCCCTTCTAGGGGAC---GACCAAATCTACAATGTTATTGTCACCGCCCATGCCTTCGTGATAATCTTTTTTATAGTAATGCCAATTCTAATCGGGGGATTCGGGAACTGACTCGTCCCTCTGATAATTGGAGCCCCAGATATGGCCTTTCCCCGTATAAACAACATAAGCTTCTGACTACTTCCCCCCTCCTTTCTCCTACTCCTAGCTTCAGCCGGAGTCGAAGCCGGTGCCGGCACCGGCTGAACAGTCTACCCTCCCCTTGCAGGAAATTTAGCTCACGCTGGCCCATCTGTTGACTTAACCATCTTTTCTCTTCACCTAGCCGGGATCTCATCTATTCTAGGAGCAATTAATTTTATCACTACAACTCTTAATATAAAACCTCCCACTCTAACACAATATCAAACTCCTCTATTTGTTTGGTCTGTTTTAATTACAGCTGTACTACTCCTCCTCTCTTTACCAGTTCTAGCTGCAGGCATCACTATACTCCTCACTGATCGAAACTTAAACACTACTTTCTTCGACCCCGCTGGGGGTGGTGACCCAGTTCTCTACCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendrobates azureus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Dendrobates tinctorius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATATTTAGTATTCGGAGCGTGAGCCGGAATAGTCGGCACAGCCCTAAGCCTCTTAATTCGAGCAGAATTGAGCCAACCTGGAGCCCTTCTGGGGGAC---GACCAGATCTACAATGTTATTGTCACCGCCCATGCCTTCGTGATAATCTTTTTTATAGTAATGCCAATTTTAATCGGGGGATTCGGGAACTGACTCGTCCCTCTGATAATCGGAGCCCCAGACATGGCCTTTCCCCGTATAAACAACATAAGCTTCTGACTACTTCCCCCCTCCTTTCTCCTACTCCTAGCTTCAGCTGGAGTCGAAGCCGGTGCCGGCACCGGCTGAACAGTCTACCCTCCCCTTGCAGGAAATTTAGCTCACGCTGGCCCATCTGTTGACTTAACCATCTTTTCTCTTCACCTAGCCGGGATCTCATCTATTCTAGGAGCAATCAATTTTATCACTACAACTCTTAATATAAAACCTCCCACTCTAACACAATATCAAACTCCTCTATTTGTTTGGTCTGTCTTAATTACAGCTGTACTACTTCTCCTCTCTTTGCCAGTTCTAGCTGCAGGCATCACTATACTTCTCACTGATCGAAACTTAAACACTACTTTCTTCGACCCCGCTGGGGGCGGTGACCCAGTTCTCTATCAACACCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendrobates tinctorius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Philippe Gaucher, Ross MacCulloch

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Because of the unusual nature of forests in Guianas, with relatively dry savannahs and high mountain plateaus, no two populations of D. tinctorius are exactly alike(Walls,1994. One or two cases of overcollecting could wipe out a whole population. A violent storm or clear cutting could also have negative effects.

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The blue poison frog is classified as Vulnerable (VU D2) on the IUCN Red List 2004 (1) and is listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Mating behavior starts with the male calling from his position in tree leaves or on the ground. The female is attracted by his calls and strokes the male's snout and back in a typical poison frog courtship sequence. The male then leads the female to his chosen spot, where a clutch of 2-6 eggs are laid, and attended to, in most cases, by the male, but also sometimes by the female. The eggs hatch within 14 to 18 days, and the tadpoles are carried to water pools within bromeliad or other plant leaf axils or crevices by both the female and the male.

  • Walls, J. G. (1994). Jewels of the Rainforest: Poison Frogs of the Family Dendrobatidae. J.F.H. Publications, Neptune City, New Jersey.
  • Wollenberg, K. C., Veith, M., Noonan, B. P., and Lotters, S. (2006). ''Polymorphism versus species richness—systematics of large Dendrobates from the Eastern Guiana Shield (Amphibia: Dendrobatidae).'' Copeia, 2006(4), 623-629.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is locally common in French Guiana (Lescure and Marty, 2001). Elsewhere it is common but patchily distributed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
It is illegally collected for the pet trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population numbers of the blue poison frog are now relatively stable, but due to the tiny range of this species, its existence is precarious. It previously suffered due to over-collection for the pet trade, but since it breeds easily in captivity, removal from the wild is now rare (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Its range includes a few protected areas. This species breeds easily in captivity, and is found in zoos around the world.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The range of the blue poison frog is entirely contained within the boundaries of the Sipaliwini Protected Area (1). Local people are educated to avoid collecting this species, although it is less valuable now as it can be bred so prolifically in captivity (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Though this species is not the one native people use for darts, they are highly prized in the pet trade. They are also insectivores eating ants and other small pests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dendrobates azureus

Dendrobates azureus is a species of poison dart frog found in the forests surrounded by the Sipaliwini savannah, which is located in southern Suriname and northern to central Brazil. Dendrobates azureus is widely known as the blue poison dart frog or by its Tirio Indian name, okopipi. Its species name comes from the fact that it is colored azure.

Contents

Physical description [edit]

D. azureus frogs coexist peacefully in captivity.

D. azureus is a medium-sized frog that weighs approximately 8 grams. It grows between 3 and 4.5 cm in length and has a typical lifespan of 4–6 years in the wild. Its bright blue skin serves as a warning to predators. Its color is also usually darker around its limbs and stomach. The glands of poisonous alkaloids located in the skin serve as a defense mechanism to potential predators. These poisons paralyze and sometimes kill the predator. The black spots are unique to each frog, serving as an identification tool. Each foot contains four toes which each have a flattened tip with a suction cup pad used for gripping. This species of frog is also identifiable by a hunch-backed posture.

Physical appearance also differs with the sex of the animal. Females are larger and about half a centimeter longer than males, but males have larger toes. The tips of the toes in females are round, while males have heart-shaped tips.

Tadpoles differ greatly in appearance from adults. They have a long tail, about 6 mm, with a total length of about 10 mm. They lack legs and have gills instead of lungs.

Behavior [edit]

(video) A Blue Poison Dart Frog suddenly snacks on something.

Dendrobates tinctorius is a mainland animal, but stays close to water sources. These frogs spend most of their awake time, during the day, hopping around in short leaps. They are very territorial and aggressive both towards their own species and others. To ward off intruders, they use a series of calls, chases, and wrestling, which usually occurs within the same sex.

Although poison dart frogs are known for their skin toxins, used on the tips of arrows or darts of natives, in reality only the species of the Phyllobates genus are used in this manner, although all poison dart frogs have some level of toxicity. In captivity, the frogs lose toxicity as a result of altered diets.

Reproduction [edit]

The blue poison dart frog breeds seasonally, usually during the months of February or March when it is rainy. To find mates, the males sit on a rock and produce quiet calls, which the females follows to track down the males. The females then physically fight over a male. The male takes the female to a quiet place by water, which becomes the site of the egg-laying. Once the eggs are laid the male will then cover them in his sperm to fertilise them, therefore fertilisation occurs externally.

Between five and ten offspring are produced, and eggs are laid in the male’s territory, which he defends. The male takes care of the eggs most of the time, but sometimes the female does, as well. The eggs hatch between 14 and 18 days, and after 10 to 12 weeks, the tadpoles are fully mature. Both sexes reach sexual maturity at two years of age. The expected lifespan of an average D. azureus is between four and six years in the wild, and about ten years in captivity.

Eating habits [edit]

Feeding on primarily insects, such as ants, flies, and caterpillars, the Dendrobates tinctorius is primarily an insectivore, but occasionally feeds on other arthropods, such as spiders. The mother provides unfertilized eggs for the tadpoles’ nutrition.

Captive care [edit]

The blue dart frog is very popular in captivity.[citation needed] Besides being visually appealing, D. azureus is both hardy and easy to breed.[citation needed] They are highly recommended for beginner hobbyists. However, they are somewhat aggressive frogs, and are best kept in pairs.

Like most captive dart frogs, they eat a staple diet of fruit flies, pinhead crickets, rice flour beetle larvae, and springtails.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Dendrobates tinctorius

Dendrobates tinctorius, also known by the common name dyeing dart frog, is a species of poison dart frog. It is the among the largest species, reaching lengths of 50 millimetres (2.0 in). This species is distributed throughout the eastern portion of the Guiana Shield, including parts of Guyana, Suriname, Brazil, and nearly all of French Guiana.

Contents

Poison

Like most species of the genus Dendrobates, D. tinctorius is a mildly toxic species of poison dart frog. It produces pumiliotoxins which the frog uses for self-defense. While pumiliotoxins are weaker than their derivative allopumiliotoxins and the batrachotoxins secreted by Phyllobates species, they are sufficiently toxic to discourage most animals from feeding on dendrobatids. In the case of D. tinctorius, the toxins cause pain, cramping and stiffness when the frogs are handled roughly. Due to the toxins of the frogs, animals that feed on D. tinctorius will typically learn to associate the bright colours of such frogs with the vile taste and pain that occurs after a frog is ingested. As it is such a variable species, different color morphs of tinctorius have varying degrees of toxicity.

Local tribes use D. tinctorius for decoration. Feathers are plucked from the back of young parrots and the frogs are rubbed on the parrots' exposed skin. When the feathers regrow, the toxin causes them to appear yellow or red rather than green. These altered feathers are highly prized by the indigenous tribes.

Description

Male Dendrobates tinctorius alanis climbing at the Zurich Zoo.

The dyeing poison dart frog is large for a poison dart frog, but may be smaller than Phyllobates terribilis and Ameerega trivittata. Many small forms of D. tinctorius reach 3.5 cm long; most morphs are in the area of 5 cm in length or slightly bigger; some of the larger morphs may exceed 7 cm, although large tinctorius are usually closer to 5.5 cm long. For some time it was thought that captive individuals were incapable of reaching the sizes of wild specimens; however later evidence suggested that the fact that captive individuals do not reach their maximum potential size may be due to vitamin and mineral deficiencies. More recently, breeders have had success raising tinctorius to very large sizes.

Dendrobates tinctorius is one of the most variable of all poison dart frogs. Typically the body is primarily black, with an irregular patter of yellow or white stripes running along the back, flanks, chest, head, and belly. In some morphs, however, the body may be primarily blue, primarily yellow, or primarily white. The legs range from pale blue, sky blue or blue-gray to royal blue, cobalt blue, navy blue, or royal purple and are typically peppered with small black dots. The yellow-backed morph is almost entirely yellow and black, with only a few specks of white on the toes. Another unique morph, the Citronella morph, is primarily golden yellow with tiny splotches of black on its belly and royal blue legs that have no black dots.

Males are typically smaller and more slender than females, but they have larger toe discs. The toe discs of female dyeing poison dart frogs are circular while those of the males are heart-shaped.

Distribution

It exists in discrete patches throughout this region, being restricted to "highland" (up to 350 metres (1,150 ft)) areas. While this species can be found at sea level, these individuals have been collected at the base of nearby hills or mountains. The isolation of populations has presumably occurred as a result of the erosion of these highland areas and the seasonal inundation of the inter-patch areas.

Morphs

The species encompasses a great diversity of color and patterning variants (subspecies and morphs). Some batrachologists suspect that some of these are actually different species.

Etymology

The specific name tinctorius comes, however, not from the variety of colors, but from the way some indigenous tribes use the frogs. They rub them on the skin of young parrots, and the toxifying of the bird's skin causes them to grow feathers of different colors.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!