Overview

Comprehensive Description

Color

Unevenly orange over carapace and abdominal somites 1–4, abdominal somites 5, 6 and telson uncoloured; colour highlighted at the bases of abdominal spines and spines on pereopodal meri; narrow transverse orange bands at the ends of meri, carpi and propodi of pereopods 1–4. Based on WA specimen, NMV J55021.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© POORE, GARY

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Philippines, off Sibago Island (off Zamboanga), 06º47´N, 122º28´E, 458 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Data

Holotype, female, BMNH 1888:33.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymy

Munida incerta Henderson, 1888: 130, pl. 13, figs 4, 4a.
Agononida incerta. - Baba et al. 2009: 76–78, fig. 63. - Poore et al. 2008: 18 (part).
Munida sp. cf. solae. — Poupin, 1996b: 24, pl. 11, fig. f (Maria, Tubuai Islands, 680 m).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© POORE, GARY

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Taiwan, Philippines to southern Western Australia; 22°N-24°S; 280–460 m (in Western Australia the species was not taken at stations targeting the 200 m, 800 m or deeper contours).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© POORE, GARY

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Males, cl 7–38 mm; females cl 7.5–21 mm; ovigerous females cl 20–24 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© POORE, GARY

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 217 specimens in 1 taxon.
Water temperature and chemistry ranges based on 141 samples.

Environmental ranges
  Depth range (m): 69 - 990
  Temperature range (°C): 4.657 - 26.923
  Nitrate (umol/L): 1.091 - 37.878
  Salinity (PPS): 34.374 - 35.744
  Oxygen (ml/l): 0.695 - 4.797
  Phosphate (umol/l): 0.369 - 2.522
  Silicate (umol/l): 1.610 - 66.977

Graphical representation

Depth range (m): 69 - 990

Temperature range (°C): 4.657 - 26.923

Nitrate (umol/L): 1.091 - 37.878

Salinity (PPS): 34.374 - 35.744

Oxygen (ml/l): 0.695 - 4.797

Phosphate (umol/l): 0.369 - 2.522

Silicate (umol/l): 1.610 - 66.977
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Agononida incerta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTTTACTTTATTTTTGGGGCCTGAGCTGGAATAGTAGGAACCTCATTAAGTTTAATTATTCGAGCCGAACTAGGCCAACCAGGAAGTCTTATTGGAGAT---GACCAAATCTACAATGTTATTGTTACTGCTCACGCTTTTGTAATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGTTTTGGAAATTGACTAGTTCCCCTAATACTAGGCTCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGGTTACTACCGCCTTCTTTAACCCTTCTCTTAATAAGAGGGATAGTAGAAAGAGGTGTTGGAACAGGTTGAACTGTTTACCCCCCCTTAGCCGCAGGGATTGCCCATGCAGGAGCTTCAGTAGATATAGGAATTTTTTCTCTCCATTTAGCGGGAGTTTCCTCTATTTTAGGTGCAGTAAATTTTATAACTACAGTGATTAATATACGACCCGCAGGAATAACTATAGATCGTATACCCCTTTTTGTCTGATCTGTATTTATTACAGCTGTTCTTTTACTCCTTTCTCTCCCAGTTTTAGCTGGAGCCATCACCATATTATTAACAGACCGAAATTTAAATACATCTTTTTTTGACCCCGCAGGTGGGGGGGATCCTATTCTCTACCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Agononida incerta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!