Overview

Brief Summary

Pseudosquilla ciliata is known by many names such as the common mantis, false mantis, rainbow mantis, ciliated mantis, and the checkered eye mantis.  It is a mantis shrimp (Stomatopoda), one of about 15 species in family Pseudosquillidae (Ahyong 2013).  The common mantis is a marine species (as are all stomatopods) found in tropical and sub-tropical low intertidal areas and shallow waters (up to about 50 m, or 150 feet deep) world-wide, except in the far eastern Pacific along the American coast.  A generalist in terms of habitat, it lives in u-shaped burrows it digs in sandy substrates near reefs or in eel-grass beds and also inhabits cavities in dead coral heads (Caldwell 2005; Kinsie 1968; 1984).

The common mantis stays in its burrow at night, but ventures out by day and is an opportunistic feeder and active hunter, catching small crustaceans, worms and fish.  It is has lightening-fast, spearer-style raptorial appendages, which it uses to strike at it’s prey in a manner similar to a preying mantis (Caldwell 2005). 

Pseudosquilla ciliata grows to 9.5 cm (3.7 inches) long, with a variable coloration pattern often coordinating with its habitat: green, brown, yellow, or black, sometimes mottled or with a dorsal stripe, and checkered eyes (Caldwell 2005).

The common mantis is regularly found in the aquarium industry.  It is a hardy species that does well in captivity (Caldwell 2005).

Pseudosquilla ciliata is one of the few large, and until 1953 was recored as the most common, shallow water stomatopods in Hawaii.  More recently it appears to be excluded from inhabiting dead coral heads by two other large stomatopods found in Hawaii, Gonodactylus falcatus and G. hendersoni, which are more aggressive species than P. ciliata and appear to dominate in competition for nooks in coral heads (Kinzie 1968, 1984 and references therein).  Kinzie (1968, 1984) proposes that these two Gonodactylus species may have been accidentally introduced to Hawaii from the west Pacific, possibly from US barges used in World War II, subsequently reducing the distribution (and abundance) of P. ciliata to sandy flats.  Another hypothesis posits that the species known as G. falcatus in Hawaii is in fact a cryptic endemic Hawaiian species (G. aloha) rather than a foreign introduction, and not recognized as a separate species until recently.  This senario posits that G. aloha has always lived in (and excluded P. ciliata from) dead coral heads and that an increase in dead coral heads habitat in the last 50+ years has allowed for an increase in abundance of G. aloha (Kinzie 1968; 1984; Manning and Reaka 1981).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 73 specimens in 1 taxon.
Water temperature and chemistry ranges based on 39 samples.

Environmental ranges
  Depth range (m): 0.15 - 223
  Temperature range (°C): 17.631 - 28.954
  Nitrate (umol/L): 0.062 - 12.387
  Salinity (PPS): 34.131 - 36.560
  Oxygen (ml/l): 3.373 - 4.821
  Phosphate (umol/l): 0.055 - 0.857
  Silicate (umol/l): 0.567 - 3.921

Graphical representation

Depth range (m): 0.15 - 223

Temperature range (°C): 17.631 - 28.954

Nitrate (umol/L): 0.062 - 12.387

Salinity (PPS): 34.131 - 36.560

Oxygen (ml/l): 3.373 - 4.821

Phosphate (umol/l): 0.055 - 0.857

Silicate (umol/l): 0.567 - 3.921
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudosquilla ciliata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGACGATGATTATTTTCTACAAATCATAAAGATATTGGGACTTTATATTTTATTTTAGGGGCATGATCAGGTATGGTAGGCACTGCTCTTAGTTTGATTATTCGAGCAGAGTTAGGACAACCAGGTAGTTTAATTGGAGAT---GATCAAATTTATAATGTTGTTGTTACAGCTCACGCTTTCATTATAATTTTTTTCATGGTAATGCCAATTATAATTGGAGGGTTCGGTAACTGACTTGTACCTTTAATATTAGGAGCTCCTGATATGGCATTCCCTCGAATAAACAACATAAGATTTTGATTATTACCACCGGCTTTAACATTACTTCTTTCTAGAGGAATAGTTGAAAGAGGAGTAGGAACGGGATGAACAGTGTATCCTCCATTATCGGCAGGAATCGCTCACGCAGGGGCCTCTGTTGATTTAGGAATTTTCTCTTTACACATAGCTGGGGCTTCTTCTATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCTAATGGAATGACTATAGACCGTATACCTTTATTTGTATGAGCAGTCTTTATTACTGCAATTCTTTTACTCCTTTCATTACCTGTCTTAGCTGGTGCAATTACTATATTATTAACTGACCGTAATTTAAATACTTCATTCTTTGACCCAGCCGGAGGGGGAGATCCTGTTTTATATCAACACCTTTTCTGATTTTTCGGACACCCAGAAGTATATATTTTAATTTTACCAGGATTTGGTTTAATTTCACATATTGTTAGACAAGAATCAGGTAAAAAAGAAACATTTGGGACTTTAGGTATAATTTATGCTATATTAGCTATTGGAGTTCTTGGATTTGTAGTGTGGGCTCACCACATGTTTACAGTAGGTATAGACGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudosquilla ciliata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pseudosquilla ciliata

Pseudosquilla ciliata, the common mantis shrimp, is a species of mantis shrimp, known by common names including rainbow mantis shrimp and false mantis shrimp.[2] It is widespread in the tropical Indo-Pacific region and in both the western and eastern Atlantic Ocean.[3]

Description[edit]

P. ciliata can be distinguished from other closely related mantis shrimps by several characteristics; the eye is cylindrical with a hemispherical cornea; the rostral plate lacks a small spine at the front; the carapace does not bear large black spots; the telson has three keel-like ridges on either side of a central ridge; and the base of each uropod terminates in two slender flattened spines, the innermost of which is the shorter.[4]

The colour of P. ciliata varies greatly depending on an individual's environment; for example, P. ciliata living in a sea grass flat will often turn green, while one living in coralline algae will often turn red. P. ciliata may reach a total length of 95 millimetres (3.7 in).[2] The colour can range from yellowish to near black and may be plain, marbled or striped. There is often a dark patch on the last thoracic segment and first abdominal segment and another one on the edge of the telson just behind the intermediate spine on abdominal segment six.[5]

Distribution and habitat[edit]

P. ciliata has a widespread distribution in shallow seas across the tropical Indo-Pacific region and on both sides of the Atlantic Ocean. It is found burrowing in sandy and muddy areas and in seagrass meadows. It is also found on coral rubble, under boulders and on rocky reef flats. Its depth range is from the lower shore down to a depth of at least 86 m (282 ft).[5]

Biology[edit]

P. ciliata usually remains in its burrow during the day and emerges at night to forage. It is a predator and feeds on small fish, worms and small crustaceans, particularly shrimps.[2]

Use in aquaria[edit]

P. ciliata is sometimes kept in reef aquaria where it is hardy and safe with larger gastropods and crabs. A sand base to the tank will give it an opportunity to dig the U-shaped burrow in which it likes to spend its day.[2]

References[edit]

  1. ^ "Pseudosquilla ciliata". Integrated Taxonomic Information System. Retrieved October 10, 2010. 
  2. ^ a b c d Roy Caldwell. "Species: Pseudosquilla ciliata". Roy's List of Stomatopoda for the Aquarium. University of California Museum of Paleontology. Retrieved January 15, 2010. 
  3. ^ Ming-Hong Cheung, Joey K. W. Leung & Kenny Leung. "A photo record of the coral reef mantis shrimp, Pseudosquilla ciliata in Hong Kong" (PDF). University of Hong Kong. 
  4. ^ Chan, Tin-Yam. "Pseudosquilla Dana, 1852". BiotaTaiwanica. Retrieved 2014-02-10. 
  5. ^ a b Chan, Tin-Yam. "Pseudosquilla ciliata (Fabricius, 1787)". BiotaTaiwanica. Retrieved 2014-02-10. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!