Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Species Abstract

The Southern right whale (scientific name: Eubalaena australis) is one of four species of marine mammal in the family Balaenidae, part of the order of cetaceans. The Southern right whale is a baleen whale, meaning that instead of teeth, it has long plates which hang in a row (like the teeth of a comb) from its upper jaws. Baleen plates are strong and flexible; they are made of a protein similar to human fingernails. Baleen plates are broad at the base (gumline) and taper into a fringe which forms a curtain or mat inside the whale's mouth. Baleen whales strain huge volumes of ocean water through their baleen plates to capture food: tons of krill, other zooplankton, crustaceans, and small fish.

The right whale got its name because during the height of whaling efforts, this was the 'right' whale to catch, as it is large, slow-moving and floats when dead. Following serious over-exploitation from the 1600s until the 1930s, the southern right whale population became dangerously low. International protection in 1935 allowed a slow increase in population, but illegal whaling continued into the 1960s. However, whilst this huge and unsustainable threat has largely been eliminated, pressures on the southern right whale still exist. Disturbance from vessels, divers, coastal industrial activity, entanglement in fishing gear and water pollution are all concerns.

This whale is easy to identify as it has a uniformly dark colour with white callosities (outgrowths of hard skin) on and around the head which can even be used to distinguish individuals. The body is rotund and the head is very large, making up one third of the total length. Unusually for baleen whales, the Southern right whale does not have a dorsal fin or a grooved throat. The flippers are short and wide, and the blow hole is V-shaped.

Southern right whales belong in separate breeding groups which travel to their own areas to reproduce. Up to eight males may mate with one female between July and August, but unusually for mammals, aggression between males is minimal. Females calve once every three years between June and August, with a gestation period of 11 to 12 months. Calving females go for four months during the winter months without eating, and give birth to a single, large calf weighing up to 1500 kilograms. Females will nurture and feed their calves in the shallows where they are well protected from attacks by orcas and great white sharks. Calves are weaned after a year, and will reach sexual maturity at nine to ten years. These enormous animals eat some of the smallest creatures in the ocean, filtering water through long and numerous baleen plates to feed on the small plankton including larval crustaceans and copepods. Southern right whales produce short, low-frequency moans, groans, belches and pulses. Typical feeding dives last between 10 and 20 metres and southern right whales are also frequently seen at or above the surface of the water, slapping the water with its tail and flippers, rolling, and breaching (launching out of the water and landing on the side or back). The function of these behaviours is not known.
  • Encyclopedia of Earth. Lead Author: Encyclopedia of Life. 2011. Topic ed. C.Michael Hogan. ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment. Washington DC http://www.eoearth.org/article/Southern_Right_Whale?topic=49540
  • Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. 2008. Eubalaena australis. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4.
  • Best, P. B. 1994. Seasonality of reproduction and the length of gestation in southern right whale Eubalaena australis. Journal of Zoology (London) 232: 175-189.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Southern right whales belong in separate breeding groups which travel to their own areas to reproduce (5). Up to eight males may mate with one female (5) between July and August, but unusually for mammals, aggression between males is minimal (2). Females calve once every three years between June and August, with a gestation period of 11 to 12 months. Calving females go for four months during the winter months without eating, and give birth to a single, large calf weighing up to 1,500 kilograms (2). Females will nurture and feed their calves in the shallows where they are well protected from attacks by orcas and great white sharks (5). Calves are weaned after a year, and will reach sexual maturity at nine to ten years (2). These enormous animals eat some of the smallest creatures in the ocean, filtering water through long and numerous baleen plates to feed on the small plankton including larval crustaceans and copepods (2). Southern right whales produce short, low-frequency moans, groans, belches and pulses (7). Typical feeding dives last between 10 and 20 metres and southern right whales are also frequently seen at or above the surface of the water, slapping the water with its tail and flippers, rolling, and breaching (launching out of the water and landing on the side or back). The function of these behaviours is not known (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Comprehensive Description

Description

Known as a right whale because during the height of whaling efforts, this was the 'right' whale to catch, as it is large, slow-moving and floats when dead (5). This whale is easy to identify as it has a uniformly dark colour with white callosities (outgrowths of hard skin) on and around the head which can even be used to distinguish individuals (2). The body is rotund and the head is very large, making up one third of the total length. Unusually for baleen whales, the southern right whale does not have a dorsal fin or a grooved throat. The flippers are short and wide, and the blow hole is V-shaped (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Southern right whales have a circumpolar distribution in the Southern Hemisphere. The distribution in winter, at least of the breeding component of the population, is concentrated near coastlines in the northern part of the range. Major current breeding areas are nearshore off southern Australia, New Zealand (particularly Auckland Islands and Campbell Islands), Atlantic coast of South America (Argentina and Brazil), and southern Africa (mainly South Africa). Small numbers are also seen off central Chile, Peru, Tristan da Cunha (British Overseas Territory), and the east coast of Madagascar (IWC 2001, Rosenbaum et al. 2001). In summer right whales are found mainly in latitudes 40-50°S (Ohsumi and Kasamatsu 1986) but have been seen, especially in recent years, in the Antarctic as far south as 65°S (IWC 2007, Bannister et al. 1999) and around South Georgia (Rowntree et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Southern right whales have a circumpolar distribution in the Southern Hemisphere, but various breeding components of this species are concentrated near coastlines in the northern part of the range. In the case of Chile-Peru, the northernmost sighting is from 15° 08’ S in Bahia San Fernando, Peru. During the austral winter and spring, these whales are known from southern Peru (Santillan et al. 2004) to central Chile (Aguayo and Torres 1986, Aguayo et al. 1992). During the same seasons, they are observed passing through coastal waters between southern Peru and central Chile. The right whales in this population need to be considered isolated due to their breeding location and lack of any observable increase in numbers over the past four decades.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Found only in the southern hemisphere, southern right whales have a circumpolar distribution between 30 and 50 degrees south, inhabiting sub-Antartic waters (Ridgeway 1985).

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Madagascar, Mozambique, New Zealand Exclusive Economic Zone, Southern Ocean, Subantarctic Waters, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The southern right whale is only found in the southern hemisphere in all waters between 30 and 60 º south (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Physical Description

Morphology

Physical Description

Southern right whales are characterized by their uniformly dark color and white callosities found on and around the head. Callosities, which are outgrowths of tough skin, are often used in identifying individual whales, as they are unique to each animal, similar to fingerprints in humans. The largest of these excrescences (callosities) is located on the anterior-most portion of the head and is referred to as the "bonnet." Other excrescences are on the upper edge of the lower jaw, behind the blowhole, and above the eye.

Eubalaena australis is on average between 16 and 18 meters long at maturity, males being slightly shorter than females. It has a rotund appearance, a very large girth relative to the length, with an enormous head (approximately 1/3 the body length). Southern right whales do not have any dorsal fins, nor do they have the grooved throat that is typical of the balaenopterids. The flippers are also broad and relatively short.

Another distinguishing physical feature of southern right whales is the blowhole. The exterior of the blow hole is well-partitioned, resulting in a V-shaped exhaust of condensation and water vapor. Furthermore, uncharacteristic of balaenopterids, southern right whales have a well-developed dermis without fat, whereas most balaenopterids lack a dermis (Cummings 1985).

Range mass: 36000 to 73000 kg.

Average mass: 49000 kg.

Range length: 16 to 18 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Southern right whales have been well-studied on their winter breeding grounds, especially at Peninsula Valdés, Argentina, and in Australia and South Africa. Researchers have used callosity patterns to identify individuals on these grounds, and have learned much about the southern right whale's behavior, communication, and reproduction. Females produce calves at 3-5 year intervals, usually three years but with a lengthening of the cycle to five years when feeding conditions are poor (Leaper et al. 2006). Calves are born from June to October with a peak in August after a 12-13 month gestation period (Best 1994). Where feeding occurs north of 40°S the diet consists mainly of copepods, south of 50°S mainly euphausiids (krill), and varying proportions of the two food items at intermediate latitudes (Tormosov et al. 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

Based of sightings of right whales in recent years off Chile, all coastal waters appear to be important areas used as migratory corridors. Southern right whale habitat is poorly known because of the small population size. Females have been recorded with calves in southern Peru 15°– 17° S, Antofagasta, Chile 23°-25°S, Valparaiso, Chile (31°-33°S), and Arauco to Osorno, Chile (37°-40°S), and there is a single record from Punta Arenas, Chile (53°S). Females in other populations produce calves at 3-5 year intervals and calves are born between June and October with a peak in August (Best 1994). The diet consists mainly of copepods and euphausiids (Tormosov et al. 1998).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

While avoiding warm equatorial regions, southern right whales remain near continents and island masses.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 285 specimens in 1 taxon.
Water temperature and chemistry ranges based on 80 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.857 - 25.748
  Nitrate (umol/L): 0.085 - 28.535
  Salinity (PPS): 33.841 - 36.938
  Oxygen (ml/l): 4.611 - 8.135
  Phosphate (umol/l): 0.098 - 1.987
  Silicate (umol/l): 0.856 - 65.182

Graphical representation

Temperature range (°C): -0.857 - 25.748

Nitrate (umol/L): 0.085 - 28.535

Salinity (PPS): 33.841 - 36.938

Oxygen (ml/l): 4.611 - 8.135

Phosphate (umol/l): 0.098 - 1.987

Silicate (umol/l): 0.856 - 65.182
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

A migratory species, the southern right whale is found in the open ocean of the most southern region of its range during the summer months where prey populations are more abundant, but migrates up to the coastal regions of more northerly regions of its range during the winter and spring (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Using their long and numerous baleen plates, southern right whales feed on small plankton, including pelagic larval crustaceans and copepods. They are most often observed using one of two feeding techniques. The first, surface feeding, occurs when the whales selectively swim through densely-populated plankton slicks with their mouths wide open and baleen exposed. The other method occurs while submerged, presumably in highly dense populations of plankton.

Animal Foods: zooplankton

Foraging Behavior: filter-feeding

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
70 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 70 years (wild) Observations: These animals stop growing at about age 18 for females and 20 for males.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Southern right whales are polygamous, having up to seven males per one female. Courtship and copulation is described as being tender and graceful (Cummings 1985). The duration of courting bouts varies, but usually lasts for an hour or two, after which the males and females separate from one another. There seems to be no animosity between males mating with the same female, which is quite unusual for mammals. It is believed that this passive behavior implies intra-uterine sperm competition.

Mating System: polygynous

Southern right whales, so named because they were historically considered the "right" whale to catch, reach reproductive maturity at approximately ten years of age. The gestation period ordinarily lasts for one year, and lactation continues for four to six months. Calves, which are born weighing 1000-1500 kg and are five to six meters long, grow at a rate of 3 cm per day.

Southern right whales mate and calve between 20 and 30° S and mostly in protected bays during the months of June to November.

Breeding season: Southern right whales mate and calve during the months of June to November.

Average number of offspring: 1.

Average gestation period: 12 months.

Range weaning age: 4 to 6 months.

Average age at sexual or reproductive maturity (female): 10 years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 910000 g.

Average gestation period: 365 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
3285 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eubalaena australis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0173-06|AP006473|Eubalaena australis| AACCGCTGACTATTCTCAACCAACCACAAAGACATTGGCACCTTATATTTATTATTTGGCGCCTGAGCAGGAATAGTAGGCACTGGCCTA---AGCTTATTAATTCGCGCTGAACTAGGTCAGCCTGGCACACTAATCGGAGAC---GATCAAGTCTACAACGTATTAGTAACAGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCCATTATAATCGGTGGATTTGGAAACTGACTAGTTCCCTTAATA---ATTGGAGCACCTGACATGGCTTTCCCCCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTCCTACTGCTAATAGCATCCTCAATGGTCGAAGCCGGTGCAGGCACAGGCTGAACTGTATATCCCCCTCTAGCCGGAAACCTAGCACATGCAGGAGCTTCAGTCGACCTT---ACCATTTTCTCTCTACACCTAGCTGGCGTATCCTCTATCCTCGGAGCCATTAACTTTATCACAACTATTATTAACATAAAACCACCTGCCATAACCCAATACCAAACACCTCTTTTCGTATGATCAGTCCTAGTCACAGCAGTGCTGCTCCTACTATCACTACCTGTCCTAGCAGCT---GGAATCACCATGCTATTGACTGACCGAAACCTAAATACAACTTTCTTCGACCCTGCAGGCGGAGGAGACCCAATCCTGTATCAACACCTATTCTGATTTTTTGGTCACCCTGAAGTGTATATCTTAATCCTCCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAA---GAACCTTTCGGCTATATAGGAATAGTCTGAGCTATGGTATCTATCGGATTCTTAGGCTTCATCGTATGGGCGCACCACATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eubalaena australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Justification
Given the recent estimated population size (1,600 mature females in 1997, and approximately twice that number in 2007) and the strong observed rate of increase in some well-studied parts of the range, the species, although still scarce relative to its historic abundance, is not considered under threat at the hemispheric level. The population is estimated to be higher now than it was three generations (87 years, assuming a generation time of 29 years; Taylor et al. 2007) ago. Some breeding populations, in particular that off Chile/Peru (see separate listing), are still very small and may need special protection to become re-established.

History
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
D

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
Very little is known about this subpopulation except that it was once numerous off Chile. Although no estimate of abundance exists for right whales in the waters off Chile and Peru, the paucity of sightings over the past 50 years makes it very probable that the mature population size is below 50 individuals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Southern right whale populations are showing a slow increase since international protection in 1935, when over-exploitation nearly eradicated the species. There are estimated to be approximately 3,000 to 4,000 currently surviving in the southern hemisphere. Aside from international protection, individual countries are also protecting these whales and improving their ability to survive and reproduce. In Brazil the Right Whale project has been in effect since 1981. The program's goal is to protect the whales in their breeding grounds off the coast of South Brazil. Program participants monitor and research the current situation, and inform the public about the importance of environmental protection. Since its establishment, the program has, among other beneficial actions, gotten the government for the State of Santa Catarina to declare the southern right whales a state natural monument, thereby assuring its full protection. Other countries have also vowed to minimize human impacts on whale populations. This idea has been followed through by reducing direct disturbance and coastal industrial activity, as well as increasing awareness of the hazards of oceanic dumping that may lead to bioaccumulation and possible extinction.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The southern right whale is classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1). It is listed on Appendix I of CITES (3) and Appendix I of the Convention for the Conservation of Migratory Species (4). It is also classified as endangered under the Environment Protection and Biodiversity Conservation Act 1999 and protected within Australian waters under the Whale Protection Act 1980 (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The IWC conducted its last major review of southern right whales in 1998 (IWC 2001), from which most of this information is taken.

Following severe historical depletion by commercial whaling, several breeding populations (Argentina/Brazil, South Africa, and Australia) of southern right whales (E. australis) have shown evidence of strong recovery, with a doubling time of 10-12 years (Bannister 2001, Best et al. 2001, Cooke et al. 2001). The other breeding populations are still very small, and data are insufficient to determine whether they are recovering. Estimated total population size as of 1997 was 7,500 animals (of which 1,600 were mature females, including 547 from Argentina and 659 from South Africa), and the three main populations have continued to increase at a similar rate since then (Best et al. 2005, Cooke et al. 2003, IWC 2007). Illegal Soviet catches (mainly in the 1960s) temporarily inhibited recovery, but overall the population appears to have grown strongly since then (see below).

There appears to be substantial interchange between breeding grounds off the same continent, e.g. between Argentina and Brazil (Groch et al. 2004), but a much smaller rate of interchange between land masses, e.g. between Australia and New Zealand (Anon. 2004) and Argentina and Tristan da Cunha (Best et al. 1993).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Best (1987) estimated that American whalers in the 19th century killed over 14,600 southern right whales in the South Pacific, but he did not attempt to allocate the catch to any geographic regions. French whalers in the 19th century took about 2,372 right whales along the coast of Chile (Du Pasquier 1986). These estimates do not include any allowance for struck and lost animals. During the 20th century between 1929 and 1966, a total of 119 right whales were killed by shore-based whalers in Chilean waters (Aguayo 1974). In only two decades between 1951 and 1971, Soviet pelagic whaling operations killed at least 3,368 right whales in the Southern Hemisphere (Tormosov et al. 1998). These catches occurred in all the major habitats where right whales are known to be increasing today but none of these Soviet catches occurred in the waters off Chile and Peru.


The IWC conducted its last major review of southern right whales in 1998 (IWC 2001), but little information was available for the whales in the waters off Chile and Peru. Between 1964 and 1991, only 16 female-calf pairs were recorded from south-central to northern Chile and none from Peru (Van Waerebeek et al. 1998). The first female-calf pair in southern Peru was recorded in 1996 (Van Waerebeek et al. 1998). There were no known major catches by coastal whalers off Chile in the past and Peru during the 20th century and no catches in this region by Soviet pelagic operations between the 1950s and early 1970s. Thus, it is surprising that no increase has been observed in this subpopulation. Other subpopulations (Australia, Argentina and South Africa) have shown increases with doubling of times around 10-12 years. The maximum 1-day count of only four whales (Aguayo et al. 1992) is extremely low compared to maximum daily counts of 15, 40, 155 and 256 (2 days) off southeast Australia, southwest Australia, Argentina, and South Africa respectively (IWC 2001).


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Southern right whales were hunted extensively by pre-modern whaling starting in the early 17th century, but especially in the 18th and 19th centuries by American and European whalers. Not all records have survived, and furthermore there is uncertainty over the numbers of animals killed but not caught. The total number processed between 1770 and 1900 is conservatively estimated at about 150,000, of which 48,000-60,000 were taken in the 1830s alone. By the start of modern whaling at the beginning of the 20th century, the species was already rare, and catches thereafter until right whales were legally protected in 1935 totalled only about 1,600 individuals. Over 3,000 were taken illegally by Soviet whaling fleets in the 1960s (Tormosov et al. 1998). The hemispheric population in 1770 is estimated at 55,000-70,000 and is estimated to have been depleted to a low of about 300 animals by the 1920s. The species presumably began to recover following protection in 1935, but the illegal Soviet catches in the 1960s are estimated to have removed over half of the remaining population and delayed recovery (IWC 2001).

Like their congeners in the Northern Hemisphere, southern right whales are subject to mortality due to entanglements in fishing gear and collisions with shipping (IWC 2001). However, this does not seem to have impeded their recovery, at least in some areas. The lower average density of human populations and thus fishing, shipping and other potentially harmful activities in the Southern Hemisphere, compared with the western North Atlantic, probably makes this species less affected by such activities than is the North Atlantic right whale.

Parasitism by kelp gulls Larus dominicanus, which gouge skin and blubber from the whales’ backs, has been increasing rapidly in the Península Valdés calving ground and may eventually drive the whales elsewhere (Rowntree et al. 1998). This appears to be a learned behaviour that has spread through the gull population, and which is likely exacerbated by the elevated gull populations provisioned by the prevalence of uncovered disposal sites for fishery and other waste.

Observed correlations between breeding success off Argentina and sea surface temperature anomalies at South Georgia suggest that as Antarctic feeding grounds warm up, the average calving rate of southern right whales can be expected to decline (Leaper et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Right whale mortality due to entanglements in fishing gear and collisions with ships is known throughout the Southern Hemisphere (IWC 2001). In Chile, two whale deaths from human activities are known. One was a calf harpooned by fishermen (Aguayo et al. 1992) and the other was a calf that stranded after being struck by a vessel (Canto et al.1991). Mortality caused by entanglements and vessel strikes is a very serious issue for western North Atlantic right whales. Similarly, any human-caused mortality in the subpopulation off Chile and Peru, especially of females, would have a serious impact on the subpopulation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Following serious over-exploitation from the 1600s until the 1930s, the southern right whale population became dangerously low (2) (7). International protection in 1935 allowed a slow increase, but illegal whaling continued into the 1960s. Since then, the population has been increasing at the calculated 'maximum rate' (6). However, whilst this huge and unsustainable threat has largely been eliminated, pressures on the southern right whale still exist. Disturbance from vessels, divers, coastal industrial activity, entanglement in fishing gear and pollution are all concerns (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Right whales have been protected internationally from commercial hunting since 1935, but this has only been fully respected since the early 1970s, when the presence of international observers ended illegal catches by Soviet fleets, and land stations in South America also stopped taking right whales. Although several countries have designated marine protected areas that include right whale breeding habitat, it is not always clear what additional level of protection is offered over and above that applying to whales in the country’s waters generally. Those protected areas with specific management measures aimed at protecting the right whales in their calving grounds include the Area de Proteção Ambiental de Baleia Franca (Right Whale Environmental Protection Area) off Catarina State in Brazil, the Golfo San José Provincial Marine Park (Parque Marino Golfo San José) in Argentina, and the Great Australian Bight Marine Park in South Australia.

The species is listed in Appendix I of CITES and CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions

Southern right whales have been protected from commercial whaling through international agreements in1935 and 1946, but not in Chile where the last right whale was killed in 1966 (Aguayo 1974). Although right whales were taken illegally by Soviet pelagic fleets until the early 1970s, none of these were taken in the southeast Pacific. No specific protection areas exist in Chile and Peru for right whales.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

International protection by the International Whaling Commission and individual country programs to protect whales has produced significant results since the ban on hunting this species (6). Conservation activities currently include monitoring population numbers and behaviour through the use of photo identification of individuals, assessing the effects of disturbance, and education programs (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although very rarely found stranded along beaches, southern right whales occasionally do cause harm to themselves and, indirectly, humans. They have collided with large vessels and entangled in fishing gear. This causes a loss or reduction of possible shipping routes (in order to avoid collisions) and an increased cost to the fishing industry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

For the past ten or fifteen years, humans have capitalized on southern right whales, as well as other whales and aquatic mammals. Currently, the increasing popularity of whale watching and coastal tourism has led to the whales having a positive economic impact on humans. The development of whale watching has promoted economic benefits to coastal communities while increasing the protection and awareness of the species - stressing the importance of environmental quality and conservation. This benefit to the whales and their habitat contrasts sharply with previous economic exploitation of southern right whales. They were extensively hunted for oil and meat before becoming protected.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category

subpopulation Chile-Peru right whale : Critically Endangered (CR)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern right whale

The southern right whale (Eubalaena australis) is a baleen whale, one of three species classified as right whales belonging to the genus Eubalaena. Like other right whales, the southern right whale is readily distinguished from others by the callosities on its head, a broad back without a dorsal fin, and a long arching mouth that begins above the eye. Its skin is very dark grey or black, occasionally with some white patches on the belly. The right whale's callosities appear white due to large colonies of cyamids (whale lice). It is almost indistinguishable from the closely related North Atlantic and the North Pacific right whales, displaying only minor skull differences. It may have fewer callosities on its head and more on its lower lips than the two northern species.[3][4] Approximately 10,000 southern right whales are spread throughout the southern part of the Southern Hemisphere.

The maximum size of an adult female is 15 m (49 ft)[5] and can weigh up to 47 tonnes (46 long tons; 52 short tons).[5] The testicles of right whales are likely to be the largest of any animal, each weighing around 500 kg (1,100 lb). This suggests that sperm competition is important in the mating process.[6] Right whales cannot cross the warm equatorial waters to connect with the other (sub)species and (inter)breed: their thick layers of insulating blubber make it impossible for them to dissipate their internal body heat in tropical waters.

Contents

Taxonomy

The southern right whale was initially described as Balaena australis by Desmoulins in 1822. It has been reclassified repeatedly, most recently as a species separate from the other right whales, and may be reclassified again into its original genus because scientists now find greater differences among the three Balaenoptera species than between the bowhead whale, the only current member of Balaena, and the right whales. All four species may be placed in one genus in a future review.[7]

Synonyms for E. australis have included B. antarctica (Lesson, 1828), B. antipodarum (Gray, 1843), E. temminckii (Gray, 1864).[1]

Three species theory

In recent years, genetic studies have provided clear evidence that the northern and southern populations have not interbred for between 3 million and 12 million years, confirming that the southern right whale is a distinct species. More surprising is the finding that the northern Pacific and Atlantic populations are also distinct, and that the Pacific species (now known as the North Pacific right whale) is more closely related to the southern right whale than to the North Atlantic right whale.

While Rice continued to list two species in his 1998 classification,[8] Rosenbaum, et al. disputed this in 2000,[9] as did Brownell et al. in 2001.[10] In 2005, Mammal Species of the World listed three species, indicating a shift to this approach.[1] The communities first split because of the joining of North and South America. The heat of the equator then separated them further into northern and southern groups.

"Whale lice", parasitic cyamid crustaceans that live off skin debris, offer information through their own genetic patterns. Lice genetic diversity is greater than whales' because lice reproduce more quickly. Marine biologists at the University of Utah examined lice genes and determined that their hosts split into three species 5–6 million years ago, and that these species were equally abundant before whaling began in the 11th century.[11]

"This puts an end to the long debate about whether there are three [Eubalaena] species of right whale. They really are separate beyond a doubt," said Jon Seger, the project's leader.[12]

Behavior

One behavior unique to the southern right whale, known as sailing, is that of using their elevated flukes to catch the wind. It appears to be a form of play and is commonly seen off the coast of Argentina and South Africa.[3]

Population and distribution

The southern right whale spends summer in the far Southern Ocean feeding, probably close to Antarctica. It migrates north in winter for breeding and can be seen by the coasts of Argentina, Australia, Brazil, Chile, Namibia, Mozambique, Peru, Tristan de Cunha, Uruguay, Madagascar, New Zealand and South Africa. The total population is estimated to be around 10,000. Since hunting ceased, stocks are estimated to have grown by 7% a year. It appears that the South American, South African and Australasian groups intermix very little if at all, because maternal fidelity to feeding and calving habitats is very strong. The mother also passes these choices to her calves.[7]

The most recent population estimates, published by National Geographic in October 2008, put the southern whale population at 10,000. The estimate of 7,000 followed a March, 1998 IWC workshop. Researchers used data about adult female populations from three surveys (one in each of Argentina, South Africa and Australia, collected during the 1990s) and extrapolated to include unsurveyed areas, number of males and calves using available male:female and adult:calf ratios to give an estimated 1999 figure of 7,500 animals.[13]


South Africa

Hermanus has become known as a mecca for whale watching, during the southern hemisphere winter months (June - December) the Southern Right Whales migrate to the coastal waters of South Africa, with in excess of 100 whales known to be in the Hermanus area. Whilst in the area, the whales can be seen with their young, mating or many behaviors such as breaching, sailing, lobtailing, or spyhopping can be witnessed.

New Zealand

Many features are still unknown about right whale populations in New Zealand waters. However, studies by Department of Conservation and sightings reported by locals helped to deepen understanding. Scientists used to believe there was a very small, remnant population of southern right whales inhabiting New Zealand's "main" islands (North and South Island), containing probably 11 reproductive females.[14] In winter, whales migrate north to New Zealand waters and large concentrations occasionally visit the southern coasts of South Island. Bay areas along Foveaux Strait from Fiordland region to northern Otago are important breeding habitats for right whales, especially Preservation Inlet,[15] Te Waewae Bay,[16] and Otago coast.[17] The population at sub-Antarctic Auckland Islands is showing a remarkable recovery.

Recent study revealed that the right whale populations from New Zealand's main islands and the one from sub-Antarctic islands interbreed though it is still unknown whether the two stock originally came from a single population.[18] Some whales can be seen at Campbell Islands, too.

Brazil

In Brazil, more than 300 individuals have been cataloged through photo identification (using head callosities) by the Brazilian Right Whale Project, maintained jointly by Petrobras (the Brazilian state-owned oil company) and the International Wildlife Coalition. The State of Santa Catarina hosts a concentration of breeding and calving right whales from June to November, and females from this population also calve off Argentinian Patagonia and Uruguay.

Whaling

By 1750 the North Atlantic right whale was as good as extinct for commercial purposes and the Yankee whalers moved into the South Atlantic before the end of the 18th century. The southernmost Brazilian whaling station was established in 1796, in Imbituba. Over the next one hundred years, Yankee whaling spread into the Southern and Pacific Oceans, where the American fleet was joined by fleets from several European nations.

Sculpture of Southern right whale at Cockle Creek on Recherche Bay, Tasmania, where bay whaling was performed extensively during the 1840s and 1850s.

The Southern right whale had been coming to New Zealand waters in large numbers before the 19th century, but was extensively hunted from 1830-1850. Hunting gradually declined with the whale population and then all but ended in coastal New Zealand waters.[19] The beginning of the 20th century brought industrial whaling, and the catch grew rapidly. By 1937, according to whalers' records, 38,000 were captured in the South Atlantic, 39,000 in the South Pacific, and 1,300 in the Indian Ocean. Given the incompleteness of these records, the total take was somewhat higher.[20]

As it became clear that stocks were nearly depleted, right whaling was banned in 1937. The ban was largely successful, although some illegal whaling continued for several decades. Madeira took its last two right whales in 1968. Illegal whaling continued off the coast of Brazil for many years and the Imbituba station processed right whales until 1973. The Soviet Union admitted illegally taking over 3,300 during the 1950s and '60s,[21] although it only reported taking 4.[22]

Whales began to be seen again in Australian and New Zealand waters from the early 1960s.[19]

Conservation

The southern right whale, listed as "endangered" by CITES, is protected by all countries with known breeding populations (Argentina, Australia, Brazil, Chile, New Zealand, South Africa and Uruguay). In Brazil, a federal Environmental Protection Area encompassing some 1,560 km2 (600 sq mi) and 130 km (81 mi) of coastline in Santa Catarina State was established in 2000 to protect the species' main breeding grounds in Brazil and promote regulated whale watching.[23]

The Southern right whale is listed on Appendix I[24] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS) as this species has been categorized as being in danger of extinction throughout all or a significant proportion of their range.

The Southern right whale is covered by the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MoU).

Gull attacks

Kelp gulls have been observed feeding on live southern right whales since at least 1996 off the coast of Patagonia.[25] The kelp gull uses its powerful beak to peck down centimetres into the skin and blubber, often leaving the whales with large open sores, some of which have been observed to be half a meter in diameter. This predatory behavior has been continually documented in Argentinian waters, and continues today. It is thought that open garbage pits that provide food for gulls contribute to an overpopulation of gulls. [26]

Whale watching

A southern right whale approaches close to whale watchers near Península Valdés in Patagonia.

The southern right whale has made Hermanus, South Africa one of the world centers for whale watching. During the winter months (June to November), southern right whales come so close to the shoreline that visitors can watch them from strategically placed hotels. Hermanus also has two boat–based whale watching operators. The town employs a "whale crier" (cf. town crier) to walk through the town announcing where whales have been seen. Southern right whales can also be watched at other winter breeding grounds.

In Brazil, Imbituba in Santa Catarina has been recognized as the National Right Whale Capital and holds annual Right Whale Week celebrations in September, when mothers and calves are more often seen. The old whaling station there is now a museum that documents the history of right whales in Brazil. In Argentina, Península Valdés in Patagonia hosts (in winter) the largest breeding population, with more than 2,000 catalogued by the Whale Conservation Institute and Ocean Alliance.[27] As in the south of Argentina, the whales come within 200 m (660 ft) of the main beach in the city of Puerto Madryn and form a part of the large ecotourism industry.

In Australia's winter and spring, southern right whales can be seen from the Bunda Cliffs and Twin Rocks, both along the remote Great Australian Bight in South Australia.[3] In Warrnambool, Victoria, there exists a nursery which is popular with tourists in the winter and spring.

References

  1. ^ a b c Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300007. 
  2. ^ Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). "Eubalaena australis". IUCN Red List of Threatened Species. Version 2009.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/8153. Retrieved 12 September 2009. 
  3. ^ a b c Carwardine MH, Hoyt E (1998). Whales, Dolphins and Porpoises. Surry Hills, NSW: Reader's Digest. ISBN 0-86449-096-8. 
  4. ^ J. Müller (1954). "Observations of the orbital region of the skull of the Mystacoceti". Zoologische Mededelingen 32: 239–290. http://www.repository.naturalis.nl/record/318263. 
  5. ^ a b Branch, G.M., Branch, M.L, Griffiths, C.L. and Beckley, L.E. 2010. Two Oceans: a guide to the marine life of southern Africa ISBN 978-1-77007-772-0
  6. ^ Crane, J. and R. Scott. (2002). "Eubalaena glacialis". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Eubalaena_glacialis.html. Retrieved 2009-06-27. 
  7. ^ a b Kenney, Robert D. (2002). "North Atlantic, North Pacific and southern right whales". In William F. Perrin, Bernd Wursig and J. G. M. Thewissen. The Encyclopedia of Marine Mammals. Academic Press. pp. 806–813. ISBN 0-12-551340-2. 
  8. ^ Rice, Dale W. (1998). "Marine mammals of the world: systematics and distribution". Society of Marine Mammalogy Special Publication Number 4: 231pp. 
  9. ^ Rosenbaum, H. C., R. L. Brownell Jr., M. W. Brown, C. Schaeff, V. Portway, B. N. White, S. Malik, L. A. Pastene, N. J. Patenaude, C. S. Baker, M. Goto, P. Best, P. J. Clapham, P. Hamilton, M. Moore, R. Payne, V. Rowntree, C. T. Tynan, J. L. Bannister and R. Desalle (2000). "World-wide genetic differentiation of Eubalaena: Questioning the number of right whale species" (PDF). Molecular Ecology 9 (11): 1793–802. doi:10.1046/j.1365-294x.2000.01066.x. PMID 11091315. http://www.nefsc.noaa.gov/psb/pubs/rosenbaummolecol.pdf. 
  10. ^ Brownell, R. L. Jr., P.J. Clapham, T. Miyashita and T. Kasuya (2001). "Conservation status of North Pacific right whales". Journal of Cetacean Research and Management (Special Issue) 2: 269–286. 
  11. ^ Kaliszewska, Z. A., J. Seger, S. G. Barco, R. Benegas, P. B. Best, M. W. Brown, R. L. Brownell Jr., A. Carribero, R. Harcourt, A. R. Knowlton, K. Marshalltilas, N. J. Patenaude, M. Rivarola, C. M. Schaeff, M. Sironi, W. A. Smith & T. K. Yamada (2005). "Population histories of right whales (Cetacea: Eubalaena) inferred from mitochondrial sequence diversities and divergences of their whale lice (Amphipoda: Cyamus)". Molecular Ecology 14 (11): 3439–3456. doi:10.1111/j.1365-294X.2005.02664.x. PMID 16156814. 
  12. ^ Ross, Alison. "'Whale riders' reveal evolution." BBC News (20 September 2005).
  13. ^ http://www.graysreef.nos.noaa.gov/rtwh/rwmay98.html Right Whale News, May 1998. Retrieved 24 July 2007.
  14. ^ http://www.doc.org.nz/upload/documents/science-and-technical/SFC225.pdf
  15. ^ http://www.doc.govt.nz/upload/documents/conservation/marine-and-coastal/fiordlandcoastalnewsletter-oct07.pdf
  16. ^ http://www.doc.govt.nz/about-doc/news/media-releases/2009/southern-right-whales-something-really-special/
  17. ^ http://123.100.97.202/news/article.cfm?c_id=1501010&objectid=10445600&ref=imthis
  18. ^ http://www.doc.govt.nz/about-doc/news/media-releases/2009/southern-right-whale-expedition-2009/
  19. ^ a b Gaskin, D.E. (July 1964). "Return of the Southern Right Whale (Eubalaena australis Desm.) to New Zealand Waters, 1963". Tuatara 12 (2): 115–118. http://www.nzetc.org/tm/scholarly/tei-Bio12Tuat02-t1-body-d7.html. Retrieved 2007-07-22. 
  20. ^ Tonnessen, J. N. and A. O. Johnsen (1982). The History of Modern Whaling. United Kingdom: C. Hurst & Co.. ISBN 0-905838-23-8. 
  21. ^ Tormosov D.D., Mikhaliev Y.A., Best P.B., Zemsky V.A., Sekiguchi K., Brownell R.L. (November 1998). (abstract) "Soviet catches of southern right whales Eubalaena australis, 1951-1971. Biological data and conservation implications". Biological Conservation 86 (2): 185–197. doi:10.1016/S0006-3207(98)00008-1. http://www.ingentaconnect.com/content/els/00063207/1998/00000086/00000002/art00008 (abstract). Retrieved 2007-07-22. 
  22. ^ Reeves, Randall R., Brent S. Stewart, Phillip J. Clapham and James. A Powell (2002). National Audubon Society: Guide to Marine Mammals of the World. United States: Alfred A. Knopf, Inc.. ISBN 0-375-41141-0. 
  23. ^ Petrobras, Projeto Baleia Franca. http://www.baleiafranca.org.br/ More information on Brazilian right whales is available in Portuguese
  24. ^ "Appendix I" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  25. ^ Increased harassment of Right Whales (Eubalaena australis) by Kelp Gulls (Larus dominicanus) at Península Valdés, Argentina. Rowntree, V.J., P. MacGuiness, K. Marshall, R. Payne, J. Seger, and M. Sironi, 1998. Marine Mammal Science. 14(1): 99 - 115. doi:10.1111/j.1748-7692.1998.tb00693.x
  26. ^ Gulls' vicious attacks on whales. BBC News, June 24, 2009.
  27. ^ http://www.oceanalliance.org Ocean Alliance website
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!