Articles on this page are available in 1 other language: Dutch (2) (learn more)

Overview

Brief Summary

Blue crabs are immigrants from the east coast of North America, where they are common and extensively fished. They are sporadically found in the Netherlands. It is unknown whether the animals are able to reproduce here or that the larvae come from elsewhere. If you should see one, you can't be mistaken. The blue crab is large, has beautiful colors, blue legs and two tips on the sides of its carapace. They eat everything. If food is scarse, they will even eat each other. The Latin name means 'tasty synchornized swimmer'.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The Blue Crab (Callinectes sapidus) is found from Cape Cod to Uruguay, occurring especially in estuaries. It is a beautifully colored crustacean with bright blue claws--the mature female's claws are tipped in red--and an olive to bluish green carapace. The Blue Crab is a commercially important species and is popular with recreational crabbers as well. (Gosner 1978; Lippson and Lippson 1997). The Greek and Latin roots of its scientific name translate to "savory beautiful swimmer".

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

The Blue Crab (Callinectes sapidus) is found from Cape Cod to Uruguay, sometimes north at least to Massachusetts Bay (Gosner 1978). Blue Crabs have also been introduced accidentally or intentionally in Hawaii, Europe, Japan, and Africa.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Atlantic Europe, Baltic sea, Belgian Exclusive Economic Zone, Black Sea, Danish Exclusive Economic Zone, East American Coast, East Coast of England, European waters (ERMS scope), French Exclusive Economic Zone [Atlantic part], French Exclusive Economic Zone [Mediterranean part], German Bight, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, Knokke, Knokke-Heist, Malta, Mediterranean Sea, North East Atlantic, North Sea, North West Atlantic, Nova Scotia, Oostduinkerke, United Kingdom Exclusive Economic Zone, Uruguay, West Atlantic, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Although the natural range of Callinectes sapidus spreads from the western Atlantic Ocean from Nova Scotia to Argentina, it was introduced, accidentally or deliberately, into both Asia and Europe. It has also been introduced into Hawaii and Japan. Callinectes sapidus is mostly found from Cape Cod (Massachussets) to Uruguay, but is also found north to at least Massachusetts Bay.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); ethiopian (Introduced ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The adult crab C. sapidus inhabits estuaries and river mouths.
  • Adema, J.P.H.M. (1991). De krabben van Nederland en Belgie (Crustacea, Decapoda, Brachyura) [The crabs of the Netherlands and Belgium (Crustacea, Decapoda, Brachyura)]. Nationaal Natuurhistorisch Museum: Leiden, The Netherlands. ISBN 90-73239-02-8. 244 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=51 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Scattered records from Denmark to Mediterranean. Firmly established in east Mediterrenean.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nova Scotia to Florida and Texas; Bermuda; West Indies to Uruguay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Callinectes sapidus is easily identified by its body color which is generally a bright blue along the frontal area, especially along the chelipeds (the appendages bearing a "chela" or pincher-like claw). The remainder of the body is shaded an olive brown color. To accommodate swimming, the fifth leg is adapted to a paddle-like shape, as is the same with other portunids. Females have broad triangular or rounded aprons and red fingers on the chelae, whereas in the male the abdominal flap, or apron, is shaped like an inverted "T". Callinectes sapidus can grow to 25 cm in carapace length (CL), with carapace width being approximately twice the length. Growth is rapid during the first summer, with crabs growing from 70-100 mm CL. By the second year, maturity is reached at carapace lengths of 120-170 mm. Callinectes sapidus grows to adult size after 18 to 20 molts.

Range length: 120 to 170 mm.

Other Physical Features: ectothermic ; heterothermic

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The last pair of the Blue Crab's legs are paddle-shaped for swimming. The shell is more than twice as wide as long with 9 marginal teeth (the 9th is a strong spine). The shell is usually olive or bluish-green above and the claws are bright blue below (young are paler). The male's abdomen is abruptly tapered, while the female's is more broadly rounded. Adults may reach a width of 225 mm between the tips of the longest spines. (Gosner 1978)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Callinectes sapidus acutidens Rathbun, 1896
Catalog Number: USNM 19083
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Alcohol (Ethanol)
Locality: Rio De Janeiro, Brazil, South Atlantic Ocean
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Lookalikes

Several other Callinectes species overlap in range with the Blue Crab (C. sapidus). Callinectes similis is quite similar in appearance, but has 6 teeth along the front of the carapace between the eyes (often more technically described as "4 teeth, not counting the inner orbital teeth"), while C. sapidus has just 4 (or 2, not counting the inner orbitals)(Gosner 1978; Pollock 1998). It also reaches a size of only about 125 mm across (vesus 225 mm for C. sapidus). Callinectes similis is a common estuarine crab south of Cape Hatteras, North Carolina (U.S.A.), ranging into fresh water; from Cape May, New Jersey, south to Cape Hatteras it is usually recorded from depths of at least 9 meters or more and salinities of about 15 ppt (Gosner 1978; Pollock 1998). Other Callinectes species in the Atlantic/Caribbean/Gulf of Mexico region also have 6 frontal teeth (4, not counting inner orbitals), although the inner pair may be very reduced.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The Blue Crab (Callinectes sapidus) is especially common in estuaries, where it ranges into fresh water, but may be found offshore to at least 36 meters (Gosner 1978). Females remain in higher salinity portions of an estuary system, especially for egg laying (Lippson and Lippson 1997). Blue Crabs migrate to deeper water in winter (Gosner 1978).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Callinectes sapidus, the blue crab, is a bottom-dweller found in a variety of habitats ranging from the saltiest water of the gulf to almost fresh water of the back bays. Especially common in estuaries, this species ranges into fresh water, and may be found offshore. The blue crab's habitat ranges from the low tide line to waters 120 feet (36 m) deep. Females remain in higher salinity portions of an estuary system, especially for egg laying. During times of the year when temperatures are colder, C. sapidus tends to migrate to deeper water.

Range depth: 1 to 36 m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in brackish waters from the sublittoral zone to 37 m depth, prefers mud substrate.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1165 specimens in 1 taxon.
Water temperature and chemistry ranges based on 307 samples.

Environmental ranges
  Depth range (m): 0 - 72
  Temperature range (°C): 7.337 - 25.874
  Nitrate (umol/L): 0.289 - 4.585
  Salinity (PPS): 32.507 - 36.335
  Oxygen (ml/l): 4.233 - 6.494
  Phosphate (umol/l): 0.071 - 0.736
  Silicate (umol/l): 0.756 - 4.744

Graphical representation

Depth range (m): 0 - 72

Temperature range (°C): 7.337 - 25.874

Nitrate (umol/L): 0.289 - 4.585

Salinity (PPS): 32.507 - 36.335

Oxygen (ml/l): 4.233 - 6.494

Phosphate (umol/l): 0.071 - 0.736

Silicate (umol/l): 0.756 - 4.744
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Alien species

The blue crab Callinectes sapidus is a crab species that occurs naturally along the Atlantic coast of America. It lives in shallow estuaries, and female blue crabs migrate to the sea to lay their eggs. After the eggs have hatched, the young crabs migrate to estuaries. In 1989, a dead blue crab was found in the cooling system of a factory in Antwerp, Belgium. Four years later, in 1993, the first living specimen was discovered in the cooling system of a nuclear factory in Doel, Belgium. The cold winter temperatures of Belgian waters more than likely prevent an explosive growth of this species in this region…
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Callinectes sapidus eats a large range of foods. Typically this species eats clams, oysters, and mussels as well as almost any vegetable or animal matter. This species will scavenge freshly dead animals but not long dead animals. The crabs will sometimes also eat young crabs.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Plant Foods: leaves

Primary Diet: carnivore (Piscivore , Vermivore, Eats other marine invertebrates, Scavenger ); herbivore (Folivore , Algivore); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blue Crabs feed on plants, shellfish, recently dead fish, and a wide variety of other prey they can kill or scavenge, including recently molted soft-shelled individuals of their own species (Lippson and Lippson 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Parasites are very common on Callinectes sapidus. Barnacles, worms and leeches attach themselves to the outer shell; small animals called isopods live in the gills or on the abdomen; and small worms live in the muscles. Although C. sapidus is a host to many parasites, most of these do not affect the life of the crab.

Commensal/Parasitic Species:

  • Barnacles
  • Leeches
  • Worms
  • Isopods

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Callinectes sapidus is preyed on by the red drum, Atlantic croaker, herons, sea turtles and humans. They are also an important link in the food chain, being both predator and prey. They feed on fish, aquatic vegetation, mollusks, crustaceans, and annelids.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barnacles often attach themselves to Blue Crabs, especially in southern regions. The Striped Barnacle (Balanus amphitrite) and Turtle Barnacle (Chelonibia testudinaria) are found externally; a small goose barnacle, Octolasmus lowei, occurs in the Blue Crab's gill chamber, and the bean-shaped sacculinid barnacle Loxothylacus texanus attaches itself under the abdomen. A parasitic nemertean worm, Carcinonemertes carcinophila, is found on the gills of female crabs; on virgin crabs, it is pinkish, while on breeders it is red. (Gosner 1978)

Feeding experiments carried out by Harding (2003) suggest that the Blue Crab may be an effective predator of the Rapa Whelk (Rapana venosa), a large predatory gastropod from Asia that was discovered in Chesapeake Bay in 1998. Although mature Rapa Whelks are probably too large and well protected to be attacked by Blue Crabs, available data suggest that predation by Blue Crabs on juvenile Rapa Whelks might control whelk populations in Chesapeake Bay and other estuarine habitats along the North American Atlantic coast.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Callinectes sapidus (Blue crabs) is prey of:
Sciaenops ocellatus
Actinopterygii
Aves
Other suspension feeders
Mya arenaria
Crassostrea virginica
Polychaeta
Nereis
Crustacea
Callinectes sapidus
Larus argentatus
Larus delawarensis
Larus atricilla
Sterna forsteri
sediment POC

Based on studies in:
USA: Florida (Estuarine)
USA: Florida, Everglades (Estuarine)
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • W. M. Kemp, W. H. B. Smith, H. N. McKellar, M. E. Lehman, M. Homer, D. L. Young and H. T. Odum, Energy cost-benefit analysis applied to power plants near Crystal River, Florida. In: Ecosystem Modeling in Theory and Practice: An Introduction with Case His
  • W. E. Odum and E. J. Heald, The detritus-based food web of an estuarine mangrove community, In Estuarine Research, Vol. 1, Chemistry, Biology and the Estuarine System, Academic Press, New York, pp. 265-286, from p. 281 (1975).
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Callinectes sapidus (Blue crabs) preys on:
benthic invertebrates
Modiolus demissus
Littorina littorea
Urosalpinx cinerea
Neopanope texana sayi
Nematoda
Crustacea
Polychaeta
Bivalvia
Actinopterygii
Cumacea
Decapoda
Floridichthys carpio
Lophogobius cyprinoides
phytoplankton
microzooplankton
zooplankton
Ctenophora
Chrysaora quinquecirrha
Other suspension feeders
Mya arenaria
Crassostrea virginica
Nereis
Macoma
meiofauna
Callinectes sapidus
Brachiodontes exustus
Crepidula fornicata
Crepidula convexa
Argopecten irradians
Chione cancellata
Pagurus
Pagurus maclaughlinae
Libinia dubia
Pinixia floridana
Neopanope texana
Alpheus normani
Hippolyte zostericola
Processa bermudiensis
Penaeus duoarum
Palaemonetes floridanus

Based on studies in:
USA: Florida (Estuarine)
USA: New Jersey (Brackish water)
USA: Florida, Everglades (Estuarine)
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • W. M. Kemp, W. H. B. Smith, H. N. McKellar, M. E. Lehman, M. Homer, D. L. Young and H. T. Odum, Energy cost-benefit analysis applied to power plants near Crystal River, Florida. In: Ecosystem Modeling in Theory and Practice: An Introduction with Case His
  • C. H. Peterson, The importance of predation and competition in organizing the intertidal epifaunal communities of Barnegat Inlet, New Jersey, Oecologia (Berlin) 39:1-24, from p. 8 (1979).
  • W. E. Odum and E. J. Heald, The detritus-based food web of an estuarine mangrove community, In Estuarine Research, Vol. 1, Chemistry, Biology and the Estuarine System, Academic Press, New York, pp. 265-286, from p. 281 (1975).
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

DMS in the odor landscape of the sea

Dimethyl Sulfide or DMS is present throughout the ocean(1). It’s an important odor component of many fish and shellfish, including clams, mussels, oysters, scallops, crabs and shrimp(2-9). Where does it come from? Usually from the marine plants they feed on.

Many species of plants and algae produce DMS, but not all species produce significant amounts of it. Nearly all of these are marine, and they tend to be in closely related groups with other DMS-producers, including Chlorophyte (green) seaweeds, the Dinophyceae in the dinoflagellates, and some members of the Chrysophyceae and the Bacillariophyceae (two classes of diatoms). Other large groups, like cyanobacteria and freshwater algae, tend not to produce DMS. (10,11)

Why do these groups produce DMS? In algae, most researchers believe a related chemical, DMSP, is used by the algae for osmoregulation- by ensuring the ion concentration inside their cells stays fairly close to the salinity in the seawater outside, they prevent osmotic shock. Otherwise, after a sudden exposure to fresh water (rain at the sea surface, for instance) cells could swell up and explode. In vascular plants, like marsh grasses and sugar cane, it’s not clear what DMS is used for. (12,13)

Freshly harvested shellfish can smell like DMS because DMSP has accumulated in their tissue from the algae in their diet. Some animals, including giant Tridacna clams and the intertidal flatworm Convoluta roscoffensis, harbor symbiotic algae in their tissues, which produce DMSP; this may not be important to their symbioses, but for Tridacna, the high DMS levels can be a problem for marketing the clams to human consumers. After death, DMSP begins to break down into DMS. A little DMS creates a pleasant flavor, but high concentrations offend the human palate.(2,14)

Not all grazers retain DMS in their tissues, though. At sea, DMS is released when zooplankton feed on algae. It’s been shown in the marine copepods Labidocera aestiva and Centropages hamatus feeding on the dinoflagellate Gymnodinium nelson that nearly all the DMS in the consumed algae is quickly released during feeding and digestion.(15) This has a disadvantage for the grazing zooplankton. Marine predators, like procellariiform seabirds, harbor seals, penguins, whale sharks, cod, and coral reef fishes like brown chromis, Creole wrasse and boga, can use the smell of DMS to locate zooplankton to feed on. (8,16,17)

It’s not easy to measure how much DMS is released from the Ocean into the air every year. Recent estimates suggest 13-37 Teragrams, or 1.3-3.7 billion kilograms. This accounts for about half the natural transport of Sulfur into the atmosphere, is the conveyor belt by which Sulfur cycles from the ocean back to land. In the atmosphere, DMS is oxidized into several compounds that serve as Cloud Condensation Nuclei (CCN). The presence of CCN in the air determines when and where clouds form, which affects not only the Water cycle, but the reflection of sunlight away from the Earth. This is why climate scientists believe DMS plays an important role in regulating the Earth’s climate. (12,18)

  • 1) BATES, T. S., J. D. Cline, R. H. Gammon, and S. R. Kelly-Hansen. 1987. Regional and seasonal variations in the flux of oceanic dimethylsulfide to the atmosphere. J. Geophys. Res.92: 2930- 2938
  • 2) Hill, RW, Dacey, JW and A Edward. 2000. Dimethylsulfoniopropionate in giant clams (Tridacnidae). The Biological Bulletin, 199(2):108-115
  • 3) Brooke, R.O., Mendelsohn, J.M., King, F.J. 1968. Significance of Dimethyl Sulfide to the Odor of Soft-Shell Clams. Journal of the Fisheries Research Board of Canada, 25:(11) 2453-2460
  • 4) Linder, M., Ackman, R.G. 2002. Volatile Compounds Recovered by Solid-Phase Microextraction from Fresh Adductor Muscle and Total Lipids of Sea Scallop (Placopecten magellanicus) from Georges Bank (Nova Scotia). Journal of Food Science, 67(6): 2032–2037
  • 5) Le Guen, S., Prost, C., Demaimay, M. 2000. Critical Comparison of Three Olfactometric Methods for the Identification of the Most Potent Odorants in Cooked Mussels (Mytilus edulis). J. Agric. Food Chem., 48(4): 1307–1314
  • 6) Piveteau, F., Le Guen, S., Gandemer, G., Baud, J.P., Prost, C., Demaimay, M. 2000. Aroma of Fresh Oysters Crassostrea gigas: Composition and Aroma Notes. J. Agric. Food Chem., 48(10): 4851–4857
  • 7) Tanchotikul, U., Hsieh, T.C.Y. 2006. Analysis of Volatile Flavor Components in Steamed Rangia Clam by Dynamic Headspace Sampling and Simultaneous Distillation and Extraction. Journal of Food Science, 56(2): 327–331
  • 8) Ellingsen, O.F., Doving, K.B. 1986. Chemical fractionation of shrimp extracts inducing bottom food search behavior in cod (Gadus morhua L.). J. Chem. Ecol., 12(1): 155-168
  • 9) Sarnoski, P.J., O’Keefe, S.F., Jahncke, M.L., Mallikarjunan, P., Flick, G. 2010. Analysis of crab meat volatiles as possible spoilage indicators for blue crab (Callinectes sapidus) meat by gas chromatography–mass spectrometry. Food Chemistry, 122(3):930–935
  • 10) Malin, G., Kirst, G.O. 1997. Algal Production of Dimethyl Sulfide and its Atmospheric Role. J. Phycol., 33:889-896
  • 11) Keller, M.D., Bellows, W.K., Guillard, R.L. 1989. Dimethyl Sulfide Production in Marine Phytoplankton. Biogenic Sulfur in the Environment. Chapter 11, pp 167–182. ACS Symposium Series, Vol. 393. ISBN13: 9780841216129eISBN: 9780841212442.
  • 12) Yoch, D.C. 2002. Dimethylsulfoniopropionate: Its Sources, Role in the Marine Food Web, and Biological Degradation to Dimethylsulfide. Appl Environ Microbiol., 68(12):5804–5815.
  • 13) Otte ML, Wilson G, Morris JT, Moran BM. 2004. Dimethylsulphoniopropionate (DMSP) and related compounds in higher plants. J Exp Bot., 55(404):1919-25
  • 14) Van Bergeijk, S.A., Stal, L.J. 2001. Dimethylsulfonopropionate and dimethylsulfide in the marine flatworm Convoluta roscoffensis and its algal symbiont. Marine Biology, 138:209-216
  • 15) Dacey , J.W.H. and Stuart G. Wakeham. 1986. Oceanic Dimethylsulfide: Production during Zooplankton Grazing on Phytoplankton. Science, 233( 4770):1314-1316
  • 16) Nevitt, G. A., Veit, R. R. & Kareiva, P. (1995) Dimethyl Sulphide as a Foraging Cue for Antarctic Procellariiform Seabirds. Nature 376, 680-682.
  • 17) Debose, J.L., Lema, S.C., & Nevitt, G.A. (2008). Dimethylsulfionoproprianate as a foraging cue for reef fishes. Science, 319, 1356.
  • 18) Charlson, R.J., Lovelock, J.E., Andraea, M.O., Warren, S.G. 1987. Oceanic phytoplankton, atmospheric sulphur, cloud albedo and climate. Nature, 326:655-661
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Callinectes sapidus is both colorful and highly visually responsive, yet almost all studies of their courtship have focused on chemical cues. In the underwater environment of C. sapidus, visual cues may function more rapidly and over a longer distance than chemical cues. Given that C. sapidus is aggressive and cannibalistic, visual cues may allow them to quickly evaluate potential mates from safer distances. The crabs will use color vision and color in mate choice with males having a preference for females with red claw dactyls.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; tactile ; chemical

  • Baldwin, J., S. Johnson. 2009. The importance of color in mate choice of the blue crab Callinectes sapidus. Journal of Experimental Biology, 212: 3762-3768. Accessed June 22, 2011 at http://www.ncbi.nlm.nih.gov/pubmed/19880739.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Except when they have recently molted and have still-soft shells, Blue Crabs are very aggressive when threatened, although they will also burrow into sand to hide (Gosner 1978; Pollock 1998).

Baldwin and Johnsen (2009) investigated mate choice in Blue Crabs, carrying out mate choice experiments using males and manipulated photographs of females. Their results indicated that courtship and mate choice behavior in Blue Crabs can be stimulated by visual cues alone. Males showed a preference for females with red claw dactyls ("pincers"). In binary choice experiments, males displayed more often to photographs of females with red claws than to those with white claws or black claws, strongly suggesting that these male crabs made their choices based on the hue of the red claws and, more broadly, that Blue Crabs are capable of color vision and use color in mate choice.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Callinectes sapidus usually goes through seven zoeal stages and 1 postlarval, or megalopal stage. Sometimes an eighth zoeal stage is observed. Larval abundance is greatest when the tide begins to recede, because the larval release often occurs at the peak of high tide. Blue crab larvae are advected offshore, completing development in coastal shelf waters. Typical development through the seven zoeal stages is between thirty and fifty days before metamorphosis to the megalopal stage. The megalopa persists between six and fifty-eight days. The megalopal stage returns to estuaries for settlement, and eventual recruitment to adult populations.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lippson and Lippson (1997) describe the life cycle of the Blue Crab in Chesapeake Bay, Maryland, U.S.A., which is famous for its Blue Crabs. Blue Crabs spawn near the mouth of the Chesapeake from May to October. The sponge, or egg mass, which may contain up to 2 million eggs, adheres to the undersurface of the crab. The color of the egg mass is golden orange at first, but changes to black as hatching approaches. After a few weeks, small semi-transparent zoae larvae are released. Many of these larvae are swept out into the ocean, where they mix with Blue Crab larvae from other regions of the coast and, eventually, are blown into regional estuaries such as the Delaware and Chesapeake Bays. After additional molts, a second larval form, the megalops, is produced. The megalops, which resembles a tiny lobster, moves along the bottom and up into the Bay system, where it molts into a tiny but recognizable Blue Crab. By 12 to 16 months, the crabs have molted several times and reached sexual maturity at an average size of about 13 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Callinectes sapidus has an average life span of 1-2 years. Many are harvested by humans before they would die naturally. In the St. Johns River, some blue crabs survive to four years of age.

Range lifespan

Status: wild:
1 to 4 years.

Average lifespan

Status: wild:
2 years.

Typical lifespan

Status: wild:
1 to 2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning peaks in Callinectes sapidus are closely associated with the region they inhabit. Unlike males, female C. sapidus mate only once in their lifetime, after the pubertal or terminal molt. When approaching this final molt, females attract males by releasing a pheromone in their urine. Male crabs compete for females and until molting occurs they will protect them. At this time mating occurs, and may last as long as 5-12 hours.

Mating System: polygynous

Callinectes sapidus is highly fertile, with females producing from 2 - 8 million eggs per spawn. When females are in their soft-shell stage immediately after molting, the males transfer their sperm to them for storage. The male then protects the female until her new shell hardens. The females will spawn two to nine months after mating, laying up to eight million eggs. Spawning season is from December to October, with a peak both in spring and summer. When females are ready to spawn, they fertilize the eggs with the stored sperm and place them on the tiny hairs of the appendages on their abdomen. The female is called a "sponge" or "berry" crab while she carries eggs like this. The blue crab's incubation time is 14-17 days, which is when the eggs are brooded. During this time females migrate to the mouths of estuaries so that larvae may be released into high salinity waters. Blue crab larvae have a salinity requirement of at least 20 ppt, and show poor survival below this threshold. The megalops (or larvae) pass through eight stages in about two months before they begin to resemble adult crabs. Usually only one or two crabs survive to become adults, and they have a lifespan up to three years.

Breeding interval: Males mate more than once, during each mating season, where females only mate once in their lifetime.

Breeding season: All year, but spawning occurs mostly during the months of December until October.

Range number of offspring: 2 million to 8 million.

Average number of offspring: 1.

Range gestation period: 14 to 17 days.

Average time to independence: 2 months.

Range age at sexual or reproductive maturity (female): 12 to 18 months.

Range age at sexual or reproductive maturity (male): 12 to 18 months.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); broadcast (group) spawning; ovoviviparous

Males tend to stay and protect the female until she has grown her hard shell after molting, but males have no interaction with the young. The female will protect the young while they hatch, but do not have a significant role in parenting. This is because there are so many eggs, and the maturing time is much too long for her to watch over them. They have to be independent from the time they hatch, which is why most of them will die before they reach the adult age.

Parental Investment: pre-fertilization (Protecting: Male); pre-hatching/birth (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Fluid pressure provides support: blue crab
 

The body of the blue crab functions during exoskeletal molt using hydrostatic pressure.

     
  "The aquatic blue crab Callinectes sapidus maintains mobility by switching to a hydrostatic skeleton 10 — a fluid-based skeleton that is common in soft-bodied invertebrates 11. Hydrostatic skeletons are arranged so that the force of muscle contraction is transmitted by an essentially incompressible aqueous fluid 11–13. Muscle contraction increases the pressure in the fluid, causing the deformations or stiffening required for support, movement and locomotion." (Taylor and Kier 2006:1005)

"Like vertebrates, crustaceans usually move their limbs using muscles attached to a hard skeleton--albeit one on the outside of the body rather than the inside. But when a crab sheds its skeleton to grow a bigger shell, the muscles are left without any rigid surface to pull against. How do they do it? William Kier and Jennifer Taylor of UNC-Chapel Hill investigated, and found that, during molting, crabs use hydrostatic pressure to create a stiff structure against which muscles can pull. Fluid pressure in the claw goes up as the muscles contract; if you remove a claw during molting, it deflates like a flat tire. Once the shell has hardened, however, pressure does not change during muscle use. Soft-shelled crabs are the first animals known to use both a skeleton and hydrostatic pressure for support." (Jones 2003:17)
  Learn more about this functional adaptation.
  • Taylor, J. R. A.; Kier, W. M. 2006. A pneumo-hydrostatic skeleton in land crabs. Nature. 440(7087): 1005.
  • Jones N. 2003. Soft-shelled crabs get all pumped up. New Scientist. 179(2404): 17.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Place et al. (2005) analyzed the complete mitochondrial genome of the Blue Crab.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Callinectes sapidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACGATGATTCTTTTCTACAAATCATAAAGACATTGGTACATTATATTTCATTTTTGGAGCATGATCTGGGATAGTAGGTACATCACTTAGTTTAATCATTCGAGCTGAACTAGGACAACCTGGAACCCTTATTGGAAACGACCAAATTTATAACGTTGTAGTCACAGCTCACGCCTTTGTTATAATTTTCTTCATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCCCTTATACTAGGAGCTCCTGATATAGCCTTCCCACGAATAAATAACATAAGATTCTGACTCCTACCTCCATCACTAACTCTATTACTAATAAGAGGTATGGTCGAAAGTGGAGTTGGTACAGGATGAACTGTTTACCCTCCCCTTGCTGCTGCTATTGCTCACGCAGGGGCCTCAGTTGATCTTGGTATTTTCTCTCTCCACTTAGCTGGTGTATCATCAATTCTAGGGGCTGTTAACTTTATAACTACCGTTATTAATATACGTTCATTTGGTATAAGAATAGACCAAATACCTTTATTCGTTTGATCTGTATTTATTACCGCTATTCTTCTACTTCTTTCTCTACCTGTATTAGCAGGTGCTATTACTATACTTCTCACTGATCGAAACTTAAATACCTCATTCTTCGACCCAGCTGGAGGAGGCGACCCTGTTCTCTACCAGCATCTATTCTGATTTTTCGGACATCCTGAAGTTTATATTCTTATTTTACCTGCCTTCGGTATAATTTCTCACATTGTGAGACAAGAATCAGGTAAAAAAGAATCCTTCGGAACATTAGGCATGATCTATGCTATAATGGCTATTGGTATTTTAGGATTCATTGTATGAGCCCACCATATGTTTACTGTTGGTATAGACGTAGACACCCGAGCATATTTTACTTCGGCTACTATAATCATTGCAGTGCCCACTGGTATTAAAATTTTTAGATGACTTAGAACCCTTCATGGAACACAAATCAATTATAGACCCTCAATACTTTGAGCTTTAGGTTTTATTTTCCTATTTACTGTAGGAGGGCTTACTGGAGTAGTACTTGCCAACTCTTCAATTGATATTATCCTACACGACACTTATTATGTAGTCGCCCACTTCCACTACGTTCTATCCATGGGCGCTGTATTCGGAATTTTCGCCGGTATCGCTCACTGATTCCCCTTATTCACAGGGATATCATTAAATCCTAAATGAATGAAAATCCACTTTGCCATTATGTTCATTGGAGTAAATGTTACATTCTTCCCCCAACACTTCTTAGGGCTTAACGGTATACCTCGTCGATACTCAGACTACCCAGATGCCTATACTACATGAAACGTAGTATCATCCATAGGATCCATAGTATCTCTTATTGCTATGCTAATCTTTATAATTATCATCTGAGAAGCACTTATTTCAAATCGTCCTGTTATATTTTCTCCTTTCCTTCCATCATCCATTGAATGAAACCACTCTTACCCACCAGCTGATCATTCTTATATAGAAATCCCTCTTATCACTAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Callinectes sapidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Callinectes sapidus is not listed by any conservation programs.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Callinectes sapidus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The main positive economic importance of Callinectes sapidus for humans is for food. The blue crab is often eaten because the meat is tasty and can be prepared in a number of ways. Commercially, crabs are captured in traps that are rectangular, two feet wide, and are made of wire. The crabs are lured in by being baited with freshly dead fish. In some areas, crabs are also caught in trawls and by trotlines. Many people also crab since it is easy and inexpensive. Although there aren't any harvest limits, there is a 5-inch minimum body width as measured from spine to spine.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Blue Crabs are the basis for a commercially valuable fishery in many regions, but as with so many other fisheries, overexploitation has been a major problem. The Chesapeake Bay has traditionally been one of North America’s most productive fishing grounds, supporting the world’s largest Blue Crab fishery. However, sustained fishing mortality and environmental deterioration led to an ∼70% decrease in Blue Crab abundance in Chesapeake Bay during the last decade of the 20th century and first few years of the 21st, from an estimated 900 million crabs down to ∼300 million, with 45–55% of those crabs harvested annually. Even more alarming, studied have found that spawning stock abundance and biomass in Chesapeake Bay declined by 81% and 84%, respectively, around this same period. Consequently, the Blue Crab fishery, which in the early 1990s was a 52,000-ton, $72-million industry, declined to a 28,000-ton, $61-million harvest in 2004. A multidisciplinary, multi-institutional program was developed to study the basic biology and life cycle of the Blue Crab, develop hatchery and nursery technologies for mass production of blue crab juveniles, and assess the potential of using cultured juveniles to enhance Blue Crab breeding stocks and, in turn, bay-wide abundance and harvests. Basic biology and culture studies yielded methods to mass produce larvae and juvenile Blue Crabs in captivity. Juvenile crabs have been produced year-round, with excellent survival. During 2002–2006, over 290,000 cultured crabs were tagged and experimentally released into the bay’s nursery habitats. Cultured crabs survived as well as their wild counterparts, increased local populations at release sites by 50–250%, grew quickly to sexual maturity, mated, and migrated from the release sites to spawning grounds, contributing to the breeding stock as soon as 5 to 6 months post-release. (Zohar et al. 2008 and references therein) Despite their enthusiasm and optimism regarding stock replenishment efforts, Zohar et al. (2008) emphasize their view that in addition to mass rearing and releasing of Blue Crab juveniles, successfully restoring Blue Crab populations will require the integration of adequate management strategies to protect the wild and released animals until sexual maturity and spawning, with fishery and seafood industry, policymakers, environmental activists, and scientists all working together.

Paolisso (2007) explored the evolving role of the Blue Crab in the human culture around the Chesapeake Bay watershed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Callinectes sapidus

Callinectes sapidus (from the Greek calli- = "beautiful", nectes = "swimmer", and Latin sapidus = "savory"), the Chesapeake blue crab or Atlantic blue crab, or simply blue crab, is a species of crab native to the waters of the western Atlantic Ocean, the Pacific coast of Central America and the Gulf of Mexico, and introduced internationally.

C. sapidus is of significant culinary and economic importance in the United States, particularly in the Chesapeake Bay. It is the Maryland state crustacean and the subject of an extensive fishery.[2] On the Pacific coast of Central America it is largely ignored as a food source as picking the meat is considered too difficult.

Contents

Description

Females have a broad abdomen, like the dome of the Capitol.[3]
Males have a narrow abdomen, like the Washington Monument.[3]

Callinectes sapidus may grow to a carapace width of 230 mm (9.1 in). It can be distinguished from a related species occurring in the same area by the number of frontal teeth on the carapace; C. sapidus has four, while C. ornatus has six.[4]

Males and females of C. sapidus can be distinguished by the sexual dimorphism in the shape of the abdomen (known as the "apron"). It is long and slender in males, but wide and rounded in mature females; one popular mnemonic is that the male's is shaped like the Washington Monument, while the female's resembles the dome of the United States Capitol.[3] A female's abdomen changes as it matures: an immature female has a triangular-shaped abdomen, whereas a mature female's is rounded.[5]

The blue hue stems from a number of pigments in the shell, including alpha-crustacyanin, which interacts with a red pigment, astaxanthin, to form a greenish-blue coloration. When the crab is cooked, the alpha-crustacyanin breaks down, leaving only the astaxanthin, which turns the crab to a red-orange or a hot pink color.[6]

Distribution

Callinectes sapidus is native to the western edge of the Atlantic Ocean from Nova Scotia to Argentina and around the entire coast of the Gulf of Mexico.[7][8] It has been introduced (via ballast water) to Japanese and European waters, and has been observed in the Baltic, North, Mediterranean and Black Seas.[9] The first record from European waters was made in 1901 at Rochefort, France.[10] In some parts of its introduced range, C. sapidus has become the subject of crab fishery, including in Greece, where the local population may be decreasing as a result of overfishing.[10]

Ecology

The natural predators of C. sapidus include eels, drum, striped bass, spot, trout, some sharks, humans, and cownose sting rays. C. sapidus is an omnivore, eating both plants and animals. C. sapidus typically consumes thin-shelled bivalves, annelids, small fish, plants and nearly any other item it can find, including carrion, other C. sapidus individuals, and animal waste.[11] C. sapidus may be able to control populations of the invasive green crab, Carcinus maenas; numbers of the two species are negatively correlated, and C. maenas is not found in the Chesapeake Bay, where C. sapidus is most frequent.[12]

Callinectes sapidus is subject to a number of diseases and parasites.[13] They include a number of viruses, bacteria, microsporidians, ciliates, and others.[13] The nemertean worm Carcinonemertes carcinophila commonly parasitizes C. sapidus, especially females and older crabs, although it has little adverse effect on the crab.[13] A trematode that parasitizes C. sapidus is itself targeted by the hyperparasite Urosporidium crescens.[13] The most harmful parasites may be the microsporidian Ameson michaelis, the amoeba Paramoeba perniciosa and the dinoflagellate Hematodinium perezi, which causes "bitter crab disease".[14]

Life cycle

In the Chesapeake Bay, C. sapidus undergoes a seasonal migration. Female blue crabs only mate once in their lifetime. After mating, the female crab travels to the southern portion of the Chesapeake, using ebb tide transport to migrate from areas of low salinity to areas of high salinity.[15] fertilizing her eggs with sperm stored from her only mating months or almost a year before.[16] Up to two million eggs may be produced in a single brood, and a single female can produce over 8,000,000 eggs in her lifetime.[10] After brooding the eggs as an orange mass on her pleopods for around two weeks,[17] the female crab releases her eggs in November or December. The crabs hatch into larvae and float in the mouth of the bay for four to five weeks, after which the juvenile crabs make their way back into the bay.[16]

Commercial importance

Cooked blue crabs, shown here on sale at a fish market in Washington, D.C., are red.

Fisheries for C. sapidus exist along much of the Atlantic coast of the United States, and in the Gulf of Mexico. Although the fishery has been historically centered on the Chesapeake Bay, contributions from other localities are increasing in volume.[18] In 2002, around two-thirds of the total U.S. market of C. sapidus came from four states – Louisiana (22%), North Carolina (17%), Maryland (14%), and Virginia (13%).[18] No other state contributed more than 3%, with 17% of the market being supplied by imports, especially from Indonesia (6% of the total U.S. market) and Thailand (4%); no data are available on the amounts exported from the U.S.[18]

The Chesapeake Bay, located in Maryland and Virginia, is famous for its blue crabs, and they are one of the most important economic items harvested from it. In 1993, the combined harvest of C. sapidus was valued at around US$100 million. Over the years, the population of C. sapidus has dropped,[19] and the amount captured has fallen from over 125,000 t (280,000,000 lb) in 1993 to 81,000 t (180,000,000 lb) in 2008.[1] In the Chesapeake Bay, the population fell from 900 million to around 300 million, and capture fell from 52,000 t (110,000,000 lb) in the mid 1990s to 28,000 t (62,000,000 lb) in 2004, with revenue falling from $72 million to $61 million.[20]

Because of its commercial and environmental value, C. sapidus is the subject of management plans over much of its range.[8][21] In 2012, the C. sapidus population in Louisiana was recognized as a certified sustainable fishery by the Marine Stewardship Council.[22]

See also

References

  1. ^ a b "Species Fact Sheet: Callinectes sapidus (Rathbun, 1896)". Food and Agriculture Organization. Retrieved November 28, 2010. 
  2. ^ "Maryland State Crustacean". Maryland State Archives. 2005-12-27. 
  3. ^ a b c "Callinectes spiadus". Field Guide to the Indian River Lagoon. Smithsonian Marine Station at Fort Pierce. Retrieved September 12, 2012. 
  4. ^ Susan B. Rothschild (2004). "Sandy beaches". Beachcomber's Guide to Gulf Coast Marine Life: Texas, Louisiana, Mississippi, Alabama, and Florida (3rd ed.). Taylor Trade Publications. pp. 21–38. ISBN 978-1-58979-061-2. 
  5. ^ "Blue crab, Callinectes sapidus". Maryland Fish Facts. Maryland Department of Natural Resources. April 4, 2007. Retrieved February 17, 2011. 
  6. ^ "Blue Crab Frequently Asked Questions". Blue Crab Archives. December 2008. 
  7. ^ "Callinectes sapidus". Smithsonian Marine Station at Fort Pierce. October 11, 2004. 
  8. ^ a b "Blue crabs". National Geographic. Retrieved July 22, 2011. 
  9. ^ "Callinectes sapidus". CIESM: The Mediterranean Marine Research Network. August 2006. 
  10. ^ a b c A. Brockerhoff & C. McLay (2011). "Human-mediated spread of alien crabs". In Bella S. Galil, Paul F. Clark & James T. Carlton. In the Wrong Place – Alien Marine Crustaceans: Distribution, Biology and Impacts. Invading Nature 6. Springer. pp. 27–106. ISBN 978-94-007-0590-6. 
  11. ^ "Blue Crab-About The bay". The Chesapeake Bay Foundation. 
  12. ^ Catherine E. DeRivera, Gregory M. Ruiz, Anson H. Hines & Paul Jivoff (2005). "Biotic resistance to invasion: Native predator limits abundance and distribution of an introduced crab" (PDF). Ecology 86 (12): 3367–3376. doi:10.1890/05-0479. 
  13. ^ a b c d Gretchen A. Messick (1998). "Diseases, parasites, and symbionts and blue crabs (Callinectes sapidus) dredged from Chesapeake Bay" (PDF). Journal of Crustacean Biology 18 (3): 533–548. JSTOR 1549418. 
  14. ^ Gretchen A. Messick & Carl J. Sindermann (1992). "Synopsis of principal diseases of the blue crab, Callinectes sapidus" (PDF). NOAA Technical Memorandum. National Oceanic and Atmospheric Administration. NMFS-F/NEC-88. 
  15. ^ James L. Hench, Richard B. Forward, Sarah D. Carr, Daniel Rittschof & Richard A. Luettich (2004). "Testing a selective tidal-stream transport model: observations of female blue crab (Callinectes sapidus) vertical migration during the spawning season". Limnology and Oceanography 49 (5): 1857–1870. doi:10.4319/lo.2004.49.5.1857. 
  16. ^ a b "Migration". SERC: Smithsonian Environmental Research Center. 
  17. ^ Michelle Sempsrott (March 8, 2011). "Florida's Commercial Blue Crab (Callinectes sapidus) Fishery: Managing Harvest with Output Control" (PDF). Oregon State University. Capstone Project – FW 506. 
  18. ^ a b c Alice Cascorbi (February 14, 2004). "Seafood Report: Blue Crab, Callinectes sapidus" (PDF). Seafood Watch. Monterey Bay Aquarium. Retrieved September 12, 2012. 
  19. ^ "Number of blue brabs in Bay remains below long-term average". National Oceanic and Atmospheric Administration. July 28, 2008. 
  20. ^ Yonathan Zohar, Anson H. Hines, Oded Zmora, Eric G. Johnson, Romuald N. Lipcius, Rochelle D. Seitz, David B. Eggleston, Allen R. Place, Eric J. Schott, John D. Stubblefield & J. Sook Chung (2008). "The Chesapeake Bay blue crab (Callinectes sapidus): a multidisciplinary approach to responsible stock replenishment". Reviews in Fisheries Science 16 (1): 24–34. doi:10.1080/10641260701681623. 
  21. ^ Vincent Guillory, Harriet Perry & Steve VanderKooy, ed. (October 2001). The Blue Crab Fishery of the Gulf of Mexico, United States: a Regional Management Plan (PDF) 96. Gulf States Marine Fisheries Commission. Retrieved July 22, 2011. 
  22. ^ Benjamin Alexander-Bloch (March 19, 2012). "Louisiana blue crab earns a blue ribbon". The Times-Picayune. Retrieved March 19, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!