Overview

Brief Summary

Introduction

Sometimes known as the dew worm, squirrel tail, twachel or night crawler, it is common in gardens and parks. You may have come across it in a school biology dissection. It is also a favourite bait worm for anglers.Lumbricus terrestris was first described by Linneus in 1758 and is the largest UK species of earthworm.It is preyed upon by the invasive New Zealand flatworm, which has established itself on the west coast of Scotland and in Northern Ireland.Worms are critical for soil turnover and fertility. They eat dead plant material, and their burrows help aerate the soil and let water through easily. Worm casts (faeces) are rich in recycled plant nutrients that help maintain soil fertility.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The importance of earthworms in the aeration and fertilisation of the soil is well known. They bring organic matter down into their burrows from the surface, and the familiar 'worm casts' consist of soil excreted by earthworms (3). Charles Darwin estimated that the population of earthworms moved 100 tonnes of soil per hectare in a year (5). Oxygen is taken in across the surface of the body, and the skin has to be kept moist to facilitate this process; earthworms only venture to the surface after rain or at night for this reason (3). All earthworms are hermaphrodites, meaning that a single individual possesses both male and female reproductive organs, but self-fertilisation does not occur. On damp days in summer, earthworms surface in order to mate. During copulation, two individuals lie side by side, with their 'head' ends overlapping. The overlapping parts of their bodies become surrounded by a single mucous tube, which holds them closely together. They simultaneously secrete sperm, which passes along a groove in the body of each worm and enters a small sac in the partner. After mating, the worms separate, and the saddle begins to secrete a mucous cylinder into which eggs and sperm are released. The worm wriggles out of the cylinder, which then closes, forming a protective cocoon in which fertilisation and development of the eggs take place (3). Earthworms have been used for bait by anglers, and are an important food source for many species of mammals and birds. They have been used in folk medicine as a remedy for stomach problems and toothache (5). Contrary to popular belief, it is not true that cutting a worm in half will result in the regeneration of two seperate worms (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common earthworm is an abundant species, which has an important role in the aeration and fertilisation of soil (3). It is the largest British earthworm (5) and has a reddish-brown back, a yellowish underside and an often prominent orange-red 'saddle' region known as the 'clitellum', close to the reproductive organs. Although this earthworm has a cylindrical body, the tail region may become flattened (2). The body is segmented, and has visible rings known as annuli; each segment bears small hairs known as 'chaetae', which help the worm to move through the soil (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Earthworms have tube-shaped bodies that are divided into rings. Worms are important for healthy soil. Their tunnels let air and water pass through the soil. Their waste has nutrients that plants need. The common earthworm is seen more than other worms because it comes aboveground to feed and mate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sebastian Velvez

Supplier: Life on Earth

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

This species has a flattened tail which it uses to anchor itself into its burrow during its night-time forays. If it is threatened or disturbed, it can rapidly pull itself back into its burrow using this anchor. Darwin studied L. terrestris in detail in his book The Formation of Vegetable Mould through the action of Earthworms.He sprinkled paper triangles across his lawn at Down House and monitored which way the earthworms pulled them into their burrows. He noticed that they generally pulled them in using the tip of the triangle, just like they would with leaves. Darwin showed that earthworms could work out the shape of the leaves and pull them into their burrows in the easiest way.

Reproduction
Like all earthworms, L. terrestris is a hermaphrodite. It needs another earthworm to mate with and produce fertilised cocoons - it is obligatory biparental. It mates on the soil surface at night. The cocoons - hardened shells covering the egg - of L. terrestris are 4.4–7.3mm long and 3.9–5.7mm in diameter. When the young earthworm hatches it is 25mm long. L. terrestris reaches sexual maturity in about 52 weeks and they can live for up to 10 years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Widespread and common throughout Britain and Europe, and has been introduced to many other countries (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

This wholly terrestrial species lives in pastures and forests, and shows a marked preference for clay soils (2). It is most numerous in grasslands, including garden lawns (1), and is not adversely affected by cultivation (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Distribution ecology

It is widespread and common in Britain, often in undisturbed habitats - particularly grasslands and pastures. It is also commonly found in lawns, parks and gardens, but less common in woodlands and arable soils.Lumbricus terrestris is an anecic species as it creates permanent vertical burrows in the soil. An L. terrrestris burrow can be 1–3m deep and the earthworm inhabits it for its entire life cycle.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Electric current reduces friction: common earthworm
 

Skin of earthworms repels soil adhesion with a thin water film, created by electro-osmotic flow.

     
  "When a soil animal is in contact with soil, a microscopic Electro-osmotic system is formed between the stimulated body parts and the other parts nearby. As a result, water in the adjacent soil moves to the contact zones by the action of potential difference, the water film at the contact interfaces become thicker, so that the soil adhesion to the body surfaces would be reduced through lubrication. Although the amplitude of the action potential of soil animals is small, a microscopic Electro-osmostic system can be formed because the distance between the positive pole and the negative pole is very short. The zone of negative polarity produced by stimulation from the contacting soil is on the same surface as the resting body part near to stimulating zone." (Collins 2004:220)
  Learn more about this functional adaptation.
  • Collins, M. 2004. Design and nature II: comparing design in nature with science and engineering. Southampton: WIT.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Small structures burrow efficiently: earthworms
 

Smaller earthworms exert more force relative to body mass because of the scaling limitations governing hydrostatic structures, thus allowing them to burrow more efficiently.

     
  "From the work of Quillin (2000), we have some information on the forces that earthworms can exert against the walls of their burrows. The worms push hard, with radial forces running about seven times the anchoring forces involved in crawling in preexisting burrows or in resisting extraction by a robin. We noted that if membrane thickness remains constant, tolerable pressure (still assuming constant breaking stress) will vary inversely with radius. Pressure, of course, is force divided by area, and thus is proportional to force divided by radius and cylinder length. So outward force per unit body length should be independent of size or, put in the usual terms, it should scale with body mass to the zero power--F [is proportional to] Mb0.4. If, by contrast, membrane thickness scales with radius, then tolerable pressure remains constant. That implies that outward force should vary directly with radius or with body mass to the one-third--F [is proportional to] Mb0.33.

"So what does happen? For earthworms ranging from 0.01 to 8 grams, Quillin found that F [is proportional to] Mb0.4, reasonably close to the assumptions of a thickness proportional to radius and constant material strength. The bigger is the more forceful, but more closely proportional to diameter than to mass, so relative to mass, big worms are wimps. Earthworm hatchlings can push at a monumental 500 times their weight; large adults can push at (only) a still impressive ten times their weight." (Vogel 2003:411)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
  • Quillin, KJ. 2000. Ontogenetic scaling of burrowing forces in the earthworm, Lumbricus terrestris. Journal of Experimental Biology. 203: 2757-2770.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Large volumes move through small spaces: common earthworm
 

Organisms, such as the common earthworm, move large volumes of matter through narrow spaces via flexible cylindrical structures.

         
  "Flexible cylinders make body skeletons which have enormous advantages when it comes to moving around: a considerable volume of body can be passed through a small space -- hence the earthworm burrowing through the ground, or the snake slithering through tiny chinks in the rock. As a hollow tube, the cylinder can be used to conduct liquids in or out of small spaces. The mosquito sucks up blood through its cylindrical mouthparts. The elephant's trunk acts as a two-way conduit that can suck water in and blow it out with the force of a garden hose. Provided the constructive material of a cylinder is flexible enough, the cylinder can be bent round corners, or curled up tightly like a butterfly's proboscis which curls into a spiral when not in use." (Foy and Oxford Scientific Films 1982:21)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lumbricus terrestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 154 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATTCTACTCAACTAATCACAAAGATATTGGAACTTTATACTTCATTCTTGGGGTATGGGCTGGCATGGTGGGAGCCGGAATAAGACTTCTTATCCGTATTGAGCTAAGACAACCTGGTGCATTCCTAGGAAGT---GACCAATTATACAATACAATCGTTACTGCGCACNNNTTTGTTATAATTTTCTTCCTAGTGATACCAGTCTTCATTGGCGGGTTTGGGAACTGACTTCTTCCCCTAATACTGGGCGCTCCTGATATAGCATTCCCACGCCTTAATAACATAAGATTTTGACTTCTACCCCCCTCTCTTATTCTCCTAGTTTCCTCAGCTGCCGTAGAGAAGGGAGCCGGAACAGGCTGAACAGTGTACCCCCCTCTTGCCAGAAATCTCGCCCATGCTGGGCCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCAGGTGCGTCATCTATTCTAGGGGCTATTAATTTTATTACCACTGTAATCAACATACGCTGAAGTGGGTTACGACTAGAACGAATCCCTCTGTTTGTCTGAGCTGTATTAATTACAGTAGTTCTCCTCCTCCTATCCCTTCCTGTACTTGCCGGAGCAATCACAATACTCCTAACAGATCGAAATCTTAATACCTCATTTTTCGACCCCGCTGGTGGAGGGGATCCAATTTTATATCAACACCTTTTCTGATTCTTTGGTCACCCAGAAGTATATATTCTTATTCTTCCTGGGTTTGGGGCCATTTCCCACATTGTTAGACACTATACAGCTAAACTTGAGCCATTTGGAGCCTTAGGGATAATTTATGCAATACTAGGAATCGCAGTTTTAGGATTTATTGTCTGAGCACACCACATATTTACCGTTGGCTTAGATGTGGACACCCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lumbricus terrestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 152
Specimens with Barcodes: 298
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Common and widespread in Britain (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lumbricus terrestris

Lumbricus terrestris is a large, reddish worm species native to Europe[citation needed], but now also widely distributed elsewhere around the world (along with several other lumbricids) due to human introductions. In some areas where it has been introduced, some people consider it to be a serious pest species since it is outcompeting native worms.

Through much of Europe, it is the largest naturally occurring species of earthworm, typically reaching 20 - 25 cm in length when extended (though in parts of southern Europe, the native species are much larger). In September 2012, a specimen was found in SW China measuring roughly 50 cm in length. It has an unusual habit of copulating on the surface at night, which makes it more visible than most other earthworms.

Contents

Common names [edit]

Because it is widely known, Lumbricus terrestris goes under a variety of common names. In Britain, it is primarily called the common earthworm or lob worm (though that name is also applied to a marine polychaete). In North America, the term nightcrawler (or vitalis) is also used. In Canada, it is also called the dew worm, or "Grandaddy Earthworm". In the rest of the world, most references are just to the scientific name, though with occasional reference to the above names.

Although this is not the most abundant earthworm, even in its native range, it is a very conspicuous and familiar earthworm species in garden and agricultural soils of the temperate zone, and is frequently seen on the surface, unlike most other earthworms. It is also used as the example earthworm for millions of biology students around the world, even in areas where the species does not exist. However, 'earthworm' can be a source of confusion, since in most of the world, other species are more typical. For example, through much of the unirrigated temperate areas of the world, the "common earthworm" is actually Aporrectodea (=Allolobophora) trapezoides, which in those areas is a similar size and dark color to L. terrestris.

Biology [edit]

L. terrestris is an anecic worm. That is, it forms temporary deep burrows and comes to the surface to feed, as opposed to burrowing through the soil for its food as most other earthworms do. An unusual habit of this species is to pull leaves into the mouth of its burrow where they partially decay before being eaten. While they generally feed on plant material, they have been observed feeding on dead insects and feces.

The potential life span of L. terrestris is unknown, though it has lived up to the age of six years in captivity. The most widely accepted approximation is around four to eight years in the wild. The world record is 69 years according to the National zoo located in Washington D.C.

In parts of Europe, notably the Atlantic fringe of northwestern Europe, it is now locally endangered due to predation by the New Zealand flatworm (Arthurdendyus triangulatus) and the Australian flatworm (Australoplana sanguinea), two predatory flatworms accidentally introduced from New Zealand and Australia. These predators are very efficient earthworm eaters, being able to survive for lengthy periods with no food, so still persist even when their prey has dropped to unsustainably low populations. In some areas, this is having a seriously adverse effect on the soil structure and quality. The soil aeration and organic material mixing previously done by the earthworms has ceased in some areas.

As an invasive species in North America [edit]

L. terrestris is considered invasive in the north central United States. It does not do well in tilled fields because of a lack of nutrients, pesticide exposure, and physical injuries from farm equipment.[1][2] The species, however, thrives in fence rows and woodlots and can lead to reductions in native herbaceous and tree regrowth.[3][4]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!