Ecology

Associations

Fungus / infection vector
conidium of Amylostereum chailletii is spread by mycangial pouches of female of Urocerus gigas

In Great Britain and/or Ireland:
Foodplant / internal feeder
larva of Urocerus gigas feeds within wood of Pinaceae
Other: sole host/prey

Fungus / feeder
larva of Urocerus gigas feeds on wood rot imperfect state of Amylostereum chailletii

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Urocerus gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Urocerus gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCTTATACTTTTTATTTGGATTATGAGCAGGAATTATTGGTTCATCAATAAGAATAATTATTCGTATTGAACTAATATCTCCTCAACCCTTTTTTATCAAT---GATCACCTTTTTAATTCAATTATTACTGCTCATGGACTATTAATAATTTTTTTCATAATTATACCTATTATAATAGGAGGATTTGGAAATTGATTAATTCCCCTATCTATAAATTCTCCTGATATAGCATTTCCTCGAATAAATAATTTAAGATTTTGACTCCTTCCACCTGCTTTATTTATTCTATTACTTAGAATACTTACAGGATTTGGACCAGGGACAGGATGAACTTTTTATCCCCCTCTATCCTCCTTTCCCTCTCATTCCAGTCTTGCAATTGATTTAAGTATTCTTTCTATACACTTAGCTGGACTATCTTCAATTATAGGATCAATTAATTTTATTACAACTTTTATTAATATACATTGTTCTTCATTAAACTTTGAACATCTATCTTTATTTTCATGATCAATTAATATTACTGCAATTCTTTTAATTATCTCCCTTCCTGTTCTAGCAGGAACAATCACTATACTTTTTACTGATCGAAATTTTAATTCAACATTTTTTGATCCTTCTGGAGGGGGAGACCCTATTTTATTTCAACATTTATTTTGATTCTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCCGGATTTGGAATAATCTCTCATTTAATTATTAATGAAAGAGGAAAAAAAGAAACTTTTGGTGCTTTAAGAATAATTTATGCTATTATTTCAATTGGTCTCCTTGGATTTATTGTCTGAGCCCATCATATATTTACTGTAGGATTAGATATTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Urocerus gigas

The Giant Woodwasp, Banded Horntail, or Greater Horntail (Urocerus gigas) is a species of Sawfly, native to the Holarctic and North Africa. Adults are usually between 10 to 40mm (0.5 to 1.5 inches) in length.[1]

Subspecies include[verification needed]:

References

Media related to Urocerus gigas at Wikimedia Commons

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!