Overview

Comprehensive Description

Urocerus gigas (Linnaeus, 1758)

Ichneumon gigas Linnaeus, 1758

Sirex bizonatus (Stephens, 1835, Sirex )

Urocerus taiganus Benson, 1943

Distribution

England, Scotland, Wales, Ireland

  • Liston, Andrew D., Knight, Guy T., Sheppard, David A., Broad, Gavin R., Livermore, Laurence (2014): Checklist of British and Irish Hymenoptera - Sawflies, ' Symphyta'. Biodiversity Data Journal 2, 1168: 1168-1168, URL:http://dx.doi.org/10.3897/BDJ.2.e1168
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Fungus / infection vector
conidium of Amylostereum chailletii is spread by mycangial pouches of female of Urocerus gigas

In Great Britain and/or Ireland:
Foodplant / internal feeder
larva of Urocerus gigas feeds within wood of Pinaceae
Other: sole host/prey

Fungus / feeder
larva of Urocerus gigas feeds on wood rot imperfect state of Amylostereum chailletii

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Urocerus gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCTTATACTTTTTATTTGGATTATGAGCAGGAATTATTGGTTCATCAATAAGAATAATTATTCGTATTGAACTAATATCTCCTCAACCCTTTTTTATCAAT---GATCACCTTTTTAATTCAATTATTACTGCTCATGGACTATTAATAATTTTTTTCATAATTATACCTATTATAATAGGAGGATTTGGAAATTGATTAATTCCCCTATCTATAAATTCTCCTGATATAGCATTTCCTCGAATAAATAATTTAAGATTTTGACTCCTTCCACCTGCTTTATTTATTCTATTACTTAGAATACTTACAGGATTTGGACCAGGGACAGGATGAACTTTTTATCCCCCTCTATCCTCCTTTCCCTCTCATTCCAGTCTTGCAATTGATTTAAGTATTCTTTCTATACACTTAGCTGGACTATCTTCAATTATAGGATCAATTAATTTTATTACAACTTTTATTAATATACATTGTTCTTCATTAAACTTTGAACATCTATCTTTATTTTCATGATCAATTAATATTACTGCAATTCTTTTAATTATCTCCCTTCCTGTTCTAGCAGGAACAATCACTATACTTTTTACTGATCGAAATTTTAATTCAACATTTTTTGATCCTTCTGGAGGGGGAGACCCTATTTTATTTCAACATTTATTTTGATTCTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCCGGATTTGGAATAATCTCTCATTTAATTATTAATGAAAGAGGAAAAAAAGAAACTTTTGGTGCTTTAAGAATAATTTATGCTATTATTTCAATTGGTCTCCTTGGATTTATTGTCTGAGCCCATCATATATTTACTGTAGGATTAGATATTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Urocerus gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Urocerus gigas

The Giant Woodwasp, Banded Horntail, or Greater Horntail (Urocerus gigas) is a species of Sawfly, native to the Holarctic and North Africa. Adults are usually between 10 to 40mm (0.5 to 1.5 inches) in length.[1]

Subspecies include[verification needed]:

References[edit]

  1. ^ "Giant Woodwasp- Urocerus gigas". Massnrc.org. 2008-02-25. Retrieved 2014-06-18. 

Media related to Urocerus gigas at Wikimedia Commons


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!