Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

As their name indicates, Rock Pocket Mice dwell in rocky habitats, and only rarely live in areas with sandy or silty soils. Their inconspicuous burrows are located near or under rocks, in rocky gulches or canyons, or near boulders. The mouse pictured is sitting on a lava rock, probably in New Mexico, and the color of its fur blends with the dark rock. This is typical of pocket mice - their color often matches the background color of their habitat. Rock Pocket Mice breed from February or March through July, and young have been seen from April through August.

Links:
Mammal Species of the World
  • Original description: Merriam, C.H., 1889.  Preliminary revision of the North American pocket mice (genera Perognathus et Cricetodipus auct.) with descriptions of new species and subspecies and a key to the known forms, p. 18.  North American Fauna, 1:1-36.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs from south-central Utah south through Arizona, central and southern New Mexico and the Trans-Pecos, Texas, (United States), and into northern Sonora and Chihuahua (Mexico).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Rock pocket mice occur in rocky habitats in the southwestern United States, from south-central Utah through much of Arizona, New Mexico, Texas (western Sonora, Chihuahua and Trans-Pecos), as well as northwestern Mexico (Wilson and Ruff, 1999; Weckerly et. al., 1985; Weckerly et. al., 1988).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southwestern North America. From extreme south-central Utah south through Arizona and New Mexico to northern Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Rock pocket mice range from 157 to 188mm in total length, with a tail length from 84 to 112mm. They weigh between 10.5g. and 19.9g. The tails are long and tufted at the tip (Wilson and Ruff, 1999). Their relative size is small in contrast to other members in their genus (Vaughn, 2000). Body size varies regionally (Weckerly et. al., 1988) Pelage is grayish brown on the back with pale orange brown lines on the sides and white underneath. Hairs are coarse with weak "spines" on the rump (Wilson and Ruff, 1999). The bottoms of their hind feet are bare to the heels (Wilson and Ruff, 1999). Dental formula is 1/1 0/0 1/1 3/3=20 and cheek teeth of are ever growing (Vaughn, 2000). Sexual dimorphism is observed, with males being larger overall and in certain morphological features such as mastoid width, nasal length, and mandible length (Wilson and Ruff, 1999; Weckerly et al., 1988).

Range mass: 10.5 to 19.9 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 18 cm

Weight: 18 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Average: 172 mm
Range: 157-188 mm

Weight:
Range: 10.5-19.9 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Zonally confined to lower grasslands and deserts. Commonly found in creosote-bush, mesquite, saltbush, and creosote-bush-lechuguilla areas. Associated with rocky habitats rather than sandy soils, particularly cliffs, canyons, rocky gulches, old lava flows.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Rock pocket mice inhabit desert and are particularly associated with rocky areas. (Wilson and Ruff, 1999). Average home range size is 400 meters (Krebs et al., 1990).

Terrestrial Biomes: desert or dune

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Cliffs, canyons, rocky gulches, old lava flows. Zonally confined to lower grasslands and deserts. Commonly found in creosote-bush, mesquite, saltbush, and creosote-bush-lechuguilla areas. Sleeping and birthing occur in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Rock pocket mice are granivorous, feeding on a variety of seeds depending on availability (Rebar, 1995; Wilson and Ruff, 1999). They are capable of collecting seeds in fur-lined cheek pouches. Cheek pouch volume is directly proportional to body size (Vander-Wall et al., 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet mainly seeds; also eats insects. Stores food in burrow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Population density was estimated at about 10-58 per ha in one area in Arizona (Hoffmeister 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Reportedly inactive November-February (Hoffmeister 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding season begins in February or March and progresses into July. Litter size varies from three to six (Wilson and Ruff, 1999). Similar to other species of pocket mice, rock pocket mice live for a maximum of three years (Paulson, 1988). Van de Graff (1975) observed that males tend to be in reproductive condition for longer periods each year than females. In southeastern Arizona all males captured from February until September were fertile. Females are reproductively active from February until the end of July. Males in reproductive condition averaged 2.3g. heavier than those that were not (Van de Graff, 1975). During prolonged droughts reproduction is often delayed and survivorship of young is 7.3% (Paulson, 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding season begins in February or March and continues for several months. Pregnant females have been trapped March-July. Litter size is 1-7. See Schmidly (1977) and Hoffmeister (1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodipus intermedius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1815-08|EF156861|Chaetodipus intermedius| AATCGTTGACTTTTCTCAACAAATCATAAAGATATTGGAACTCTATACTTAATTTTTGGTGCATGAGCTGGAATAGTAGGAACAGGTCTT---AGTATTCTAATCCGAGCAGAACTGGGACAACCTGGCGCACTTTTAGGGGAT---GATCAGATCTATAATGTCGTAGTTACAGCCCATGCTTTTGTTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTTCCTTTAATA---ATTGGAGCTCCAGATATAGCATTCCCTCGAATAAATAACATGAGCTTCTGGCTCCTCCCACCATCTTTCCTTCTTCTTCTAGCTTCTTCTATAGTTGAAGCAGGAGCTGGAACTGGCTGAACAGTATACCCTCCATTAGCTGGAAACCTCGCCCACGCAGGAGCATCAGTTGACCTG---ACTATTTTTTCCCTTCACTTAGCTGGGGTTTCCTCAATCCTAGGTGCCATTAATTTTATTACTACAATTATTAATATAAAACCTCCCGCAGTTTCTCAATACCAAACACCCTTATTCGTGTGATCAGTTCTTATTACTGCTGTGCTCCTTCTTCTTTCCTTACCAGTTCTAGCTGCT---GGAATTACTATATTATTGACGGATCGAAATCTAAATACTACTTTTTTTGATCCTGCTGGAGGAGGGGATCCTATTTTATATCAACACCTATTCTGATTCTTTGGTCACCCTGAAGTTTACATTTTAATTTTACCAGGATTCGGAATTATCTCTCATATTGTCACTTTTTACTCAGGGAAAAAA---GAGCCATTTGGTTACATAGGGATAGTTTGAGCTATAATATCTATTGGATTCCTAGGTTTTATTGTTTGAGCCCATCATATATTTCCAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodipus intermedius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
None known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No literature available to identify negative economic importance to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

No literature available to identify positive economic importance to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rock pocket mouse

The rock pocket mouse, C. intermedius, is one of 19 species of pocket mice in the genus Chaetodipus. (It is sometimes grouped in the genus Perognathus.[2])

Found mainly in rocky outcrops in the deserts of the southwestern United States and Mexico, the rock pocket mouse is medium-sized (length ~18 cm, weight ~12–18g) and nocturnal. It eats mainly plant seeds and makes small burrows in soil close to or under rocks to evade owls, its main predator. The breeding season spans a few months, starting in February or March, and the litter size is typically between three and six. As with most pocket mice, the tail is longer than the body (~10 cm).

Historically, rock pocket mice have been subdivided into as many as ten subspecies (Benson 1933; Dice and Blossom 1937) based on geographical distribution and coat colour. Most rock pocket mouse populations have light, tawny fur consistent with the colour of the desert rocks on which they live. However, darker coloured rock pocket mice are found living amid black, basaltic rock formations.

In 2003, scientists sampled DNA from both light- and dark-coloured rock pocket mice from areas in Pinacate Peaks, Mexico and New Mexico, USA. In the Pinacate mice, they discovered a perfect association between different versions of the Melanocortin-1 receptor (Mc1r) gene and coat colour .[3] Subsequent studies demonstrated that there is strong selective pressure maintaining Mc1r allele and coat colour frequencies across the short geographic distances between the light- and dark-coloured rock islands.[4]

Thus melanism in rock pocket mice is considered an elegant example of adaptation by natural selection. Changes in the Mc1r gene sequence are not responsible for the colour difference in the mice sampled from New Mexico, however, leading the researchers to conclude that the almost identical dark coat colours developed multiple times in rock pocket mice, an example of convergent evolution.[5]

See also

References

  1. ^ Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T. (2008). Chaetodipus intermedius. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 18 January 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ "ITIS Standard Report Page: Perognathus intermedius". http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180266. 
  3. ^ Nachman MW, Hoekstra HE, D'Agostino SL (April 2003). "The genetic basis of adaptive melanism in pocket mice". Proc. Natl. Acad. Sci. U.S.A. 100 (9): 5268–73. doi:10.1073/pnas.0431157100. PMC 154334. PMID 12704245. http://www.pnas.org/cgi/pmidlookup?view=long&pmid=12704245. 
  4. ^ Hoekstra HE, Drumm KE, Nachman MW (June 2004). "Ecological genetics of adaptive color polymorphism in pocket mice: geographic variation in selected and neutral genes". Evolution 58 (6): 1329–41. PMID 15266981. 
  5. ^ Hoekstra HE, Nachman MW (May 2003). "Different genes underlie adaptive melanism in different populations of rock pocket mice". Mol. Ecol. 12 (5): 1185–94. doi:10.1046/j.1365-294X.2003.01788.x. PMID 12694282. http://www.blackwell-synergy.com/doi/abs/10.1046/j.1365-294X.2003.01788.x. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was included in the genus Perognathus. Subgenus Chaetodipus was elevated to full genus status by Hafner and Hafner (1983); this treatment was supported by a phylogenetic analysis of Heteromyidae based on myology (Ryan 1989). Chaetodipus was accepted as a full genus by Jones et al. (1992), Patton (in Wilson and Reeder 1993, 2005), and most other authors subsequent to Hafner and Hafner (1983). In a phylogeny based on molecular data, Riddle (1995) found support for the monophyly of Chaetodipus, including C. formosus, relative to Perognathus.

See Weckerly et al. (1988) for description of new subspecies from Pedro Armendariz lava field, New Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!