Overview

Distribution

Range Description

The small Asian mongoose occurs across a wide range from Iran through northern India and into Indochina (Lekagul and McNeely 1977). In Asia, this species ranges from sea level to 2,100 m (Simberloff et al. 2000).

Outside of its natural range, this species has many well established populations. Introduced mongoose has been implicated in the devastation of the native fauna, especially on islands (Baldwin et al. 1952, Seaman and Randall 1962, Nellis and Everard 1983, Coblentz and Coblentz 1985). The IUCN lists the Small Asian Mongoose as one of the world’s 100 worst invasive alien species (Lowe et al. 2000). This species was introduced to the West Indies, the Hawaiian Islands, Mauritius, the Fijian Islands, and Okinawa (Simberloff et al. 2000), as well as the Comores and Amami-Oshima Island, Japan (Abe 2005). The reasoning behind these introductions was primarily control of rat and snake populations (S. Abe pers. comm. 2006). The Small Asian Mongoose is also often taken aboard ships, indirectly introducing them to new areas (J.W. Duckworth pers. comm.). The species recently reached Hong Kong (M. Lau pers. comm. 2006), and has also been recorded from the island of Madura, Indonesia (Meiri 2005), but it is not known whether this was due to human introduction or natural dispersal. There are several individuals from northern Sumatra (see van Strien 2001), which were described by Sody (1949) as H. javanicus tjerapai. Within its introduced range, the Small Asian Mongoose has been recorded from sea level to maximum elevations of 3,000 m on the Hawaiian Islands (Baldwin et al. 1952).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The small Indian mongoose was originally found across southeast Asia from Pakistan to the south coast of China, and throughout the Malay Peninsula and Java (Corbet and Hill 1992). However, this species has been widely introduced, including to the West Indies, South America, Japan, Europe and several Pacific islands, to help control rodent and snake populations (Nellis and Everard 1983, Tyrtkovic and Krystufek 1990, Ogura et al. 1998).

Biogeographic Regions: oriental (Native )

  • Corbet, G., J. Hill. 1992. The Mammals of the Indomalayan Region. Oxford: Oxford University Press.
  • Ogura, G., M. Sakashita, Y. Kawashima. 1998. External morphology and classification of mongoose on Okinawa island. Honyurui Kagaku, 38: 259-270.
  • Tyrtkovic, N., B. Krysufek. 1990. Small Indian mongoose, Herpestes auropunctatus (Hodgson 1936) on the Adriatic Islands of Yugoslavia. Bonner Zoologische Beitrage, 41: 3-8.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native from Middle East to Southeast Asia. Introduced in the West Indies (29 islands, including Puerto Rico [first introduced 1877] and Virgin Islands, Nellis and Everard 1983), Hawaii (first introduced 1883; now on Oahu, Molokai, Maui, Hawaii; has been observed on Kauai), and elsewhere. See Hoagland et al. (1989) for history of introductions in West Indies. A Jamaican population (derived from India in 1872) was the source of most introductions in the Caribbean region and Hawaii (Hoagland and Kilpatrick 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Javan mongoose shares the typical traits of mongooses but is small. They have a pointed head, a long tail, and thick hair except on their lower legs (Ewer 1977). Their fur coat can stand on end, which make the animal appear twice as large when it combats such enemies as poisonous reptiles.

Males average 650 g in weight and females 430 g.

Range mass: 0 to 0 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 2.248 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 66 cm

Weight: 1270 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The ecology of the Small Asian Mongoose has been studied in introduced parts of its range (Nellis 1989), but its ecology in its native range is known only to the level of coarse habitat correlations. The species is known to occur in a variety of habitats but appears to prefer well-watered naturally open deciduous forests, shrublands and grasslands (Shekar 2003; J.W. Duckworth pers. comm.). While it tends to avoid closed evergreen forests, it will utilize secondary forest, degraded sites and areas of former evergreen forest opened by logging or similar practices (Lekagul and McNeely 1977; J.W. Duckworth pers. comm.). Where it has been introduced in the West Indies (Pimentel 1955, Nellis and Everard 1983) and the Hawaiian Islands (Baldwin et al. 1952) the species is found in grasslands, crops, and forest of various kinds, coastal areas, and even settled suburbs (Simberloff et al. 2000). It tends to prefer edge habitat in most areas.

This species is terrestrial, seldom climbing trees and feeds, during both the day and the night, on a wide diet, which includes rats, birds, reptiles, frogs, crabs, insects, and even scorpions (Lekagul and McNeely 1977). It produces litters of two to four at short intervals, with a gestation period of about 7 weeks (Lekagul and McNeely 1977).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

In the Caribbean, small Indian mongooses are found only in dry forest and scrubland (Nellis and Everard 1983). On Pacific islands, they are found both in these dry habitats and also in rainforest (Tomich 1979). No study has been done to determine their habitat in the natural range.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

  • Tomich, P. 1979. Studies of leptospirosis in natural host populations. 1 Small mammals of Waipio valley, island of Hawaii. Pacific Science, 33: 257-279.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Terrestrial, though occasionally may climb trees; in nearly all kinds of habitats, though rare in interior of dense forest; dens in burrow, termite mound, in hole under rock or tree, in thick vegetation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Several large field studies have revealed the small Indian mongoose to be primarily an insectivore, though it also feeds opportunistically on small vertebrates (studies summarized in Cavallini and Serafini 1995). An early field study of the amount and type of food eaten by a mongoose was done on the small Indian mongoose on the island of Trinidad (Williams 1918). In this study, the nature of their foodstuffs depended largely on the opportunities available. An examination of the stomachs of 180 individuals revealed insects, spiders, snails, slugs, frogs, lizards, snakes, birds, eggs of birds and reptiles, all kinds of rodents, crabs, fish and fruits (Williams 1918). Members of this species have also been known to catch mammals many times their size, up to the size of hares and even the young of white-tailed deer (Seaman & Randall 1962).

Small Indian mongooses, like many other mongoose species, are famous for their killing techniques, particular when it comes to venomous snakes such as fer-de-lance and habu pit vipers, which they kill in captivity. Vertebrate prey is usually killed with a bite to the back of the head (Ewer 1977).

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

  • Cavallini, P., J. Nel. 1995. Comparative behavior and ecology of two sympatric mongoose species (Cynictis penicillata and Galerella pulverulenta). South African Journal of Zoology, 30: 46-49.
  • Seaman, G., J. Randall. 1962. The mongoose as a predator in the Virgin Islands. Journal Mammal, 43: 544-546.
  • Williams, C. 1918. The food habits of the mongoose in Trinidad. Bulletin of Dept. of Agriculture of Trinidad & Tobago, 17: 167-186.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic; eats various animals (e.g., rodents, insects, reptiles, birds up to poultry size, carrion, eggs (including sea turtle), etc.; also eats fruits (may climb to reach). In West Indies, apparently an effective predator on Rattus norvegicus but not on Mus musculus or Rattus rattus (Hoagland et al. 1989). May dig for grubs. Attacked deer fawns on St. Croix (Seaman and Randall 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Herpestes javanicus preys on:
Rattus exulans

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Up to several/ha where food abundant, especially on islands (1-7 per ha in Jamaica, 2-14 per ha in St. Croix; generally averages 3-7 per ha on Caribbean islands, with higher densities on smaller islands than on larger islands; Hoagland et al. 1989). Apparently does not defend feeding territory (Baldwin et al. 1952). Reported as nomadic in some areas, maintains home range in other areas; home range encompasses a few ha, long-term range length usually less than 1.6 km in Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Mainly diurnal; normally not active after dusk. Activity is reduced during periods of rain (Pimentel 1955). Most activity is between 1000 and 1600 h (Nellis 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.6 years (captivity) Observations: One animal at Gdansk Zoo lived for 16.6 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The males of the species become sexually mature in as little as four months following birth. Once the male's testes become fully mature, they continue to contain spermatozoa for the rest of the life of the individual. In the Northern Hemisphere, breeding females are found from the end of February until early September (Pearson & Baldwin 1953, Nellis and Everard 1983), and in the Southern Hemisphere from August through February (Gorman 1976).

The duration of pregnancy is 49 days. A litter typically consists of two young, but as many as five have been recorded (Nellis and Everard 1983).

Breeding season: Breeding occurs during the summer months of the year.

Range number of offspring: 1 to 5.

Average number of offspring: 2.

Average gestation period: 49 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 25.92 g.

Average gestation period: 49 days.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (male)

Sex: male:
122 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
301 days.

  • Gorman, M. 1976. Seasonal changes in the reproductive pattern of feral Herpestes auropunctatus in the Fijian Islands. Journal of Zoology, 178: 237-246.
  • Pearson, O., P. Baldwin. 1953. Reproduction and age structure of a mongoose population in Hawaii. Journal Mammal, 34: 436-447.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hawaii: pregnancies apparently peak February-April and May-July. Puerto Rico: births peak March-April and July-August. St. Croix: births peak June-July. Gestation lasts about 7 weeks Hawaii and West Indies: most females produce 2 litters/year; litter size usually is 2-4. St. Croix: most of population is less than 2 years old. Young make first excursions from den at about 4 weeks. Sexually mature by 1 year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Herpestes javanicus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0388-06|AY873843|Herpestes javanicus| GATCGTTGATTGTTCTCTACCAACCACAAAGATATTGGCACCCTATATCTTCTATTTGGAGCCTGGGCTGGTATAGTGGGAACTGCTCTT---AGTCTTTTAATTCGGGCCGAACTTGGCCAACCAGGTTCTCTGTTCGGAGAT---GACCAGATTTATAACGTAATCGTTACCGCCCATGCATTCGTAATAATCTTCTTCATGGTTATACCAATCATAATCGGCGGGTTTGGAAACTGGCTAGTACCACTAATA---ATTGGAGCACCTGACATGGCGTTCCCCCGAATAAATAACATGAGCTTCTGACTCCTCCCTCCATCCTTCCTACTTCTTCTAGCATCATCAATAGTGGAAGCGGGAGCAGGAACTGGATGAACCGTGTATCCACCCTTAGCCGGCAACTTAGCCCATGCAGGAGCATCCGTAGACCTG---ACTATTTTCTCTCTTCACCTTGCAGGTGTTTCCTCTATTCTAGGAGCCATTAATTTTATCACAACAATCATTAACATAAAACCACCAGCTATATCTCAATATCAAACACCCCTATTCGTTTGATCCGTACTAATCACAGCTGTGTTACTTCTTCTATCCTTACCTGTACTAGCAGCT---GGCATTACAATACTCTTAACAGACCGAAATCTAAATACCACATTTTTCGACCCTGCTGGAGGAGGAGACCCAATTCTGTACCAGCACTTATTCTGATTCTTCGGTCATCCAGAAGTCTATATCCTGATTCTACCAGGCTTTGGCATAATCTCTCATATTGTCACATATTATTCAGGTAAAAAA---GAACCTTTCGGTTATATAGGAATGGTTTGAGCAATAATATCTATTGGCTTCCTAGGCTTCATTGTGTGAGCCCACCACATATTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Herpestes javanicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Wozencraft, C., Duckworth, J.W., Choudury, A., Muddapa, D., Yonzon, P., Kanchanasaka, B., Jennings A. & Veron, G.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern (LC) in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. The species is found in a wide variety of open habitats including low intensity use agriculture, and thus habitat modification is very unlikely to significantly effect the species to warrant a list category higher than LC (especially given the species presumed short generation time). Records of the species especially from agricultural areas in Lao where hunting of wildlife has been very intense, strongly suggest a high degree of resilience to persecution. In very large areas of Cambodia, a significant portion of the species' mainland SE Asian population, both pressure from habitat modification and hunting are very low. No other threats have been identified that could be leading to a significant decline in the species.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Its conservation is not an issue; in fact in the West Indies and Hawaiian islands control measures are necessary and expensive.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Small Asian Mongoose has a relatively large population across its range, and tolerates a wide degree of habitat conversion perhaps preferring degraded habitats in some areas. In mainland Southeast Asia, this species reaches high densities in well-watered naturally open deciduous forests, shrublands and grassy areas as in southern Lao PDR, Viet Nam and much of Cambodia. Given adequate habitat the species is locally common (Le Xuan Canh et al. 1997), and widespread (Robertson et al. in prep.).

Snaring and other trapping pressures keep population numbers low in degraded habitats of large parts of Lao PDR - where the species might, if unmolested, be quite common (J.W. Duckworth pers. comm.). In India, it occurs at low densities and is not as common as Hespestes edwardsii (Shekhar 2003). In Myanmar, where village harvest of small carnivores and other similar-sized mammals seems to be much lower than in Lao PDR and Viet Nam, the species is so common in places that it is trapped by conservation agencies as a pest (Su 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The Small Asian Mongoose faces heavy exploitation in localized parts of its range, such as the Mekong Delta, but on the whole appears to be quite common and adaptable. This species is often captured and sold as pets (Shekhar 2003) and there is some commercial trade in China, India and Nepal. (A. Choudury pers. comm.). In northern Viet Nam it is hunted and sold in wild meat markets in both Viet Nam and China (S. Robertson pers. comm.). None of these threats seem to be contributing to the decline of the species globally.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Small Asian Mongoose is listed under CITES Appendix III in India (as Herpestes javanicus auropunctatus) (Wozencraft 2005). It is totally protected in Peninsular Malaysia and Thailand, and was listed as Vulnerable on the Chinese Red List (A1cd). In central India people consider the mongoose to be sacred, and thus it is not killed there (Shekhar 2003).

It occurs inside and outside of several Protected Areas throughout its range (Su 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Easily trapped, but this eradication method may be successful only on small islands. Chemical control by use of anticoagulant baits shows promise (Nellis 1989). See Nellis and Everard (1983) for trapping and handling methods, and discussion of eradiacation; see also Baldwin et al. 1952 and Pimentel (1955).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No study has checked whether small Indian mongooses in their native range affect humans. Populations in many areas of introduction carry rabies, and immense programs are occasionally needed to control these populations (Nellis and Everard 1983). Introduced populations have also driven at least one bird species extinct, and have extirpated dozens of vertebrates from islands around the world, including many endangered species (Hays and Conant, in review).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This mongoose was introduced into many nations of the West Indies, beginning in the 1870s, for the purpose of controlling rats in sugar cane plantations. In 1883 they were imported to the Hawaiian Islands for the same reason. Both cases proved to be among the most disastrous attempts ever made at biological control. In both instances the mongoose not only did tremendous damage on its own account (extirpating many native species), but at best only partially reduced the populations of rats (Hinton & Dunn 1967).

  • Hinton, H., A. Dunn. 1967. Mongooses: Their Natural History & Behavior. London: Oliver & Boyd Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Sometimes an important reservoir and vector of rabies (Pimentel 1955, Nellis and Everard 1983). Where introduced, detrimental effects on native fauna outweigh any possible economic benefits (such as destruction of rodents). See Nellis (1989) for further discussion.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Highly destructive to native terrestrial fauna; implicated in several extinctions and population declines reductions in Hawaii, Puerto Rico, Virgin Islands, and Jamaica (Nellis and Everard 1983, Dewey and Nellis 1980, Farr 1984, Henderson 1992). On western Mauna Kea, Hawaii, Amarasekare (1994) found no evidence that this species preys on eggs, young, or adults of endemic birds. In Puerto Rico, differences in habitat requirements may restrict overlap between the mongoose and the endangered Puerto Rican nightjar (Vilella and Zwank 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Small Asian mongoose

The small Asian mongoose (Herpestes javanicus) is a species of mongoose found in the wild in South and Southeast Asia. It has also been introduced to various parts of the world. The western subspecies group is sometimes treated as a separate species, the Indian mongoose or small Indian mongoose (Herpestes palustris).

Contents

Description

This species of mongoose is sympatric with Herpestes edwardsii in much of its native range and can be readily distinguished from the latter species by its much smaller size. The body is slender and the head is elongated with a pointed snout. The lengths of the head and body is 509-671mm. The ears are short. They have five toed feet with long claws. The sexes differ in size with males having a wider head and bigger size.[2]

They use about 12 different vocalizations.[3]

Distribution and habitat

This species occurs naturally throughout most of southern mainland Asia, from Iraq to China, as well as on the island of Java, at altitudes up to 2200 m. It has also been introduced to dozens of islands in the Pacific and Caribbean example, Saint Lucia and Jamaica, and a few in the Indian Ocean and Mediterranean, as well as to mainland Venezuela. It is capable of living among fairly dense human populations.

The mongoose was introduced onto Okinawa Island in 1910 and Amami Ōshima Island in 1979 in an attempt to control the population of venomous habu[disambiguation needed ] and other pests; an invasive species, they have since become pests themselves.[4][5]

Mongooses live in scrublands and dry forest. On Pacific Islands they live in rainforests as well.

Diet

These mongooses mostly eat insects but are opportunistic feeders and will eat crabs, frogs, spiders, scorpions, snakes, and birds and bird eggs.

Behavior and reproduction

Mongooses are mostly solitary although males will sometimes form social groups and share burrows. Pregnancy duration is up to 49 days. A litter can consist of 2-5 young.

Introduction to Hawai'i

The 1800s were a huge century for sugar cane, and plantations shot up on many tropical islands including Hawai'i, Fiji and Jamaica. With sugar cane came rats, attracted to the sweet plant, which ended up causing crop destruction and loss. Attempts were made to introduce the species in Trinidad in 1870 but this failed.[6] A subsequent trial with four males and five females from Calcutta however established in Jamaica in 1872. A paper published by W. B. Espeut that praised the results intrigued Hawaiian plantation owners who, in 1883, brought 72 mongooses from Jamaica to the Hamakua Coast on the Big Island. These were raised and their offspring were shipped to plantations on other islands.[7] Populations that have been introduced to these islands show larger range sizes than in their native ranges.[8] They also show genetic diversification due to drift and population isolation.[9]

Only the islands of Lana'i and Kaua'i are (thought to be) free of mongooses. There are two conflicting stories of why Kaua'i was spared. The first is that the residents of Kaua'i were opposed to having the animals on the island and when the ship carrying the offspring reached Kaua'i, the animals were thrown overboard and drowned. A second story tells that on arriving on Kaua'i one of the mongooses bit a dockworker who, in a fit of anger, threw the caged animals into the harbor to drown.

Introduction to St. Croix

The small Asian mongoose was introduced to St. Croix in 1884, also to prey upon black rats (Rattus rattus) that were ravaging the sugarcane industry. This introduction has had a negative impact on many species of reptiles. For instance, the green iguana (Iguana iguana) has been greatly reduced in number and the St. Croix ground lizard (Ameiva polops) was eliminated from the island of St. Croix (but not from Protestant Cay, Green Cay, Ruth Cay, and Buck Island) before 1962. Ground nesting birds have also been greatly affected. Mongooses have even preyed upon fawns of white-tailed deer (Odocoileus virginianus)[10]

Invasive species

The mongoose introduction did not have the desired effect of rat control, either in Hawai'i or St. Croix. The mongoose hunted birds and bird eggs, threatening many local island species. The mongooses bred prolifically with males becoming sexually mature at 4 months and females producing litters of 2-5 pups a year.

Mongooses can carry leptospirosis.[11]

References

  1. ^ Wozencraft, C., Duckworth, J.W., Choudury, A., Muddapa, D., Yonzon, P., Kanchanasaka, B., Jennings A. & Veron, G. (2008). Herpestes javanicus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 22 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Nellis, D. W (1989) Herpestes auropunctatus. Mammalian species 342:1-6 PDF
  3. ^ Mulligan, B E and D W Nellis (1973) Sounds of the Mongoose Herpestes auropunctatus. J. Acoust. Soc. Am. 54(1):320-320
  4. ^ "The Small Asian Mongoose introduced to the Island of Okinawa and Amami-Oshima: The Impact and Control Measure." Science Links Japan. Accessed 15 Feb 2009.
  5. ^ Fisher, Cindy. "Marines defend Camp Gonsalves from encroaching mongoose." Stars and Stripes. 9 July 2006. Accessed 15 Feb 2009.
  6. ^ Hoagland, D. B., G. R. Horst, and C. W. Kilpatrick (1989) Biogeography and population biology of the mongoose in the West Indies. Pages 611–634 in C. A. Woods, editor. Biogeography of the West Indies. Sand Hill Crane Press, Gainesville, Florida, USA.
  7. ^ Espeut, W. B. 1882. On the acclimatization of the Indian mongoose in Jamaica. Proceedings of the Zoological Society of London 1882:712–714.
  8. ^ Simberloff, D; T. Dayan; C. Jones & Go Ogura (2000). "Character displacement and release in the small Indian mongoose, Herpestes javanicus". Ecology 81 (8): 2086–2099. http://www.tau.ac.il/lifesci/zoology/members/dayan_files/articles/javanicus.pdf. 
  9. ^ Carl-Gustaf Thulin, Daniel Simberloff, Arijana Barun, Gary McCracken, Michel Pascal & M. Anwarul Islam (2006). "Genetic divergence in the small Indian mongoose (Herpestes auropunctatus), a widely distributed invasive species". Molecular Ecology 15 (13): 3947–3956. doi:10.1111/j.1365-294X.2006.03084.x. PMID 17054495. http://www.iee.uu.se/popbiol/pdf/articles/1112.pdf. 
  10. ^ George A. Seaman & John E. Randall (1962). "The Mongoose as a Preditor in the Virgin Islands". Journal of Mammalogy (American Society of Mammalogists) 43 (4): 544-546. http://www.jstor.org/pss/1376922. 
  11. ^ ISHIBASHI Osamu ; AHAGON Ayako ; NAKAMURA Masaji ; MORINE Nobuya ; TAIRA Katsuya ; OGURA Go ; NAKACHI Manabu ; KAWASHIMA Yoshitsugu ; NAKADA Tadashi (2006) Distribution of Leptospira Spp. on the Small Asian Mongoose and the Roof Rat Inhabiting the Northern Part of Okinawa Island. Japanese Journal of Zoo and Wildlife Medicine 11(1):35-41
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Names and Taxonomy

Taxonomy

Comments: Herpestes auropunctatus (Mangusta auropunctata) was regarded as a subspecies of Herpestes javanicus by Wozencraft (in Wilson and Reeder 2005) and other authors.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!