Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

The range of the Long-tailed Pocket Mouse is mostly within the Mojave Desert, Colorado Desert, and the Great Basin. On cold nights, this animal becomes inactive, and usually remains within its burrow system during winter. It nearly always is found in habitats where there are rocks. Small piles of soil at the bases of rocks may indicate its presence.

Links:
Mammal Species of the World
  • Original description: Merriam, C.H., 1889.  Preliminary revision of the North American pocket mice (genera Perognathus et Cricetodipus auct.) with descriptions of new species and subspecies and a key to the known forms, p., 17.  North American Fauna, 1:1-36.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in western North America, mostly within the Great Basin and Mojave and Colorado deserts and including parts of Nevada, Utah, Arizona, and California (United States), and the eastern coastal plain of Baja California (Mexico).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Chaetodipus formosus is found in the western United States including southern Nevada, western Utah, southeastern California into the Baja peninsula, and the northwest corner of Arizona. Chaetodipus formosus also is found in Northern Mexico.

Biogeographic Regions: nearctic (Native )

  • Brylski, P. 1999. "Long tailed Pocket Mouse" (On-line). California Wildlife Habitat Relationships System. Accessed March 29, 2004 at http://www.dfg.ca.gov/whdab/html/M091.html.
  • Guinn, E. 2002. "Long-tailed pocket mouse" (On-line). Utah Division of Wildlife Resources. Accessed March 29, 2004 at http://dwrcdc.nr.utah.gov/rsgis2/Search/Display.asp?FlNm=chaeform.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern North America. From central Baja California, Mexico, north through southeastern California, northwestern Arizona, Nevada, and western Utah. To elevations of 8000 ft.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Body length of these animals is between 76 and 101 mm, with a crested tail usually adding 80 to 110 mm in length. They weigh between 10.5 and 17 grams. The dorsal pelage is grey with a white underside. Chaetodipus formosus has the same dental formula as all heteromyids: I 1/1, C 0/0, P 1/1, M 3/3 X 2 = 20

Range mass: 10.5 to 17.0 g.

Range length: 76 to 101 mm.

Other Physical Features: endothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.103 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 21 cm

Weight: 24 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 171-211 mm

Weight:
Range: 17-25 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species usually occurs in rocky habitats (lava beds, pebbly soils, gravel surfaces of stream beds, and among large boulders. It may occur in sandy soils along creek beds and under shrubs. Vegetation includes various desert shrub species.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Chaetodipus formosus occupies a wide variety of elevations, from 85 m below sea level to 1,970 meters above. They are most often found in rocky desert areas that contain sagebrush, desert scrub, and desert succulent shrubs with hard groundcover and/or rocky soils. These areas are often at the base of cliffs or at the mouth of canyons. They are found in the lava beds of Vulcan's Throne, on rocky or gravelly soil of dry stream beds, or among marble-sized rocks of the desert scrub floor and Colorado River beaches.

Range elevation: -85 to 1,970 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune

  • The New Mexico Department of Game & Fish. 2004. "Long-tailed pocket mouse" (On-line). Biota Information System Of New Mexico. Accessed March 29, 2004 at http://fwie.fw.vt.edu/states/nmex_main/species/050436.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Gravelly ground; often inhabits rocky desert slopes and canyons. Sleeping and birthing occur in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Chaetodipus formosus has external fur lined cheek pouches to carry seed and other food items. Seed caching and food storage is common among the family Heteromyidae. Although this species is primarily granivorous, they also eat fruits and arthropods, and feed opportunistically on stems and leaves of green vegetation. Seeds are collected on the ground beneath and between shrubs, and on rocky surfaces. Water is obtained from food, especially green vegetation.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: leaves; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Granivore )

  • Jenkins, S., S. Breck. 1998. Differences in Food Hoarding Among Six Species Of Heteromyid Rodents. Journal of Mammalogy, 79: 1221-1232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds mainly on seeds, but may also eat some green vegeta- tion and insects. Food is stored in underground storage chamber within burrow system.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Burrows are excavated in gravely or rocky banks, or at the base of shrubs. This provides aeration of the soil because they are burrowing and turning up the soil. As seed cachers, they probably help to disperse seeds. Because they are a prey species, it is likely they could affect predator populations--especially in years where reproduction is high.

Ecosystem Impact: disperses seeds; soil aeration

Commensal/Parasitic Species:

  • 10 species of mite, 3 flea species and 3 tick species use this pocket mouse as a host.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators include owls, snakes, leopard lizards, swift foxes, and other predatory mammals.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Chaetodipus formosus is prey of:
Strigiformes
Vulpes velox

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Chaetodipus formosus preys on:
non-insect arthropods
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary. Populations probably fluctuate seasonally and year to year. In Nevada, population density was 0.04-1.3 per ha. Home ranges were estimated at 0.8 ha for females and 2.4 ha for males (Bureau of Land Management, no date).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

No information could be found on the communication techniques of C. formosus. However, as mammals, they are able to perceive visual stimuli, and have senses of smell and taste. It is likely that these senses are involved in communication. Tactile communication is probably important between mates, rivals, or between mother and offspring.

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Remains in underground burrow during the winter (alternate periods of dormancy & activity, depending on weather). Periods of surface activity increase gradually in spring. In summer individuals spend 30-40% of their time above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

No information could be found on the lifespan of long-tailed pocket mice, but generally pocket mice only live 1 to 2 years.

Range lifespan

Status: wild:
5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.1 years (captivity) Observations: It is estimated that these animals can live up to 5 years in the wild (David Macdonald 1985). Record longevity in captivity is 7.1 years (Egoscue et al. 1970).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The is no information found on the mating systems of long-tailed pocket mice

Chaetodipus formosus is an iteroparous species breeding more than once in its life time. The breeding season occurs in the spring lasting about four months with a peak in the middle two months. Populations can increase rapidly, and under good conditions up to 70 per cent of the females in the population will become pregnant. With an average litter size just under 6 young, this can lead to up to a five fold increase in population size. In years with good precipitation and food suppy a second breeding season may occur, and those young born early in the year are able to reproduce by this second season.

Breeding interval: These animals usually produce one litter per year, but can produce two if the conditions are good.

Breeding season: Breeding season for these mice is from April to July.

Range number of offspring: 2 to 7.

Average number of offspring: 6.

Range age at sexual or reproductive maturity (female): 10 to 12 months.

Range age at sexual or reproductive maturity (male): 10 to 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 1 g.

Average gestation period: 28 days.

Average number of offspring: 5.

There is no information on the parental care of C. formosus. However, most small mice are altricial when they are born. Mothers typically care for the young in a nest of some sort until they are able to walk about. Most parental care in mice is provided by females, who groom, nurse, and protect the young. No information is available on the extent of male parental care in this species.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Brylski, P. 1999. "Long tailed Pocket Mouse" (On-line). California Wildlife Habitat Relationships System. Accessed March 29, 2004 at http://www.dfg.ca.gov/whdab/html/M091.html.
  • Geluso, K. 1999. Long-tailed pocket mouse (Chaetodipus formosus). Pp. 511-512 in D Wilson, S Ruff, eds. The Smithsonian Book of North American Mammals. Washington, D.C.: Smithsonian Institution Press.
  • Guinn, E. 2002. "Long-tailed pocket mouse" (On-line). Utah Division of Wildlife Resources. Accessed March 29, 2004 at http://dwrcdc.nr.utah.gov/rsgis2/Search/Display.asp?FlNm=chaeform.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Nevada, breeding season may extend from March to September, usually ends in May. Average litter size is about 5.6 (Bureau of Land Management, no date. Young are born in May-June. May not reproduce in years of low precipitation (Kenagy and Bartholomew 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodipus formosus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1817-08|EF156859|Chaetodipus formosus| AATCGTTGACTCTTCTCAACAAATCATAAAGATATTGGAACACTTTACTTAATCTTTGGAGCATGAGCCGGAATAGTAGGAACTGGACTC---AGTATTCTAATCCGTGCTGAACTTGGCCAGCCAGGAGCACTTTTAGGTGAT---GACCAAATCTATAATGTAGTAGTAACAGCACATGCTTTTGTTATAATTTTCTTTATAGTTATACCAATTATAATCGGTGGGTTTGGTAACTGATTAGTGCCATTAATA---ATTGGAGCCCCCGATATAGCCTTCCCACGAATAAATAATATAAGCTTCTGACTTTTACCACCCTCATTCCTTCTTCTCCTAGCTTCCTCTATAGTAGAAGCAGGAGCTGGAACAGGTTGAACAGTTTATCCTCCTTTAGCTGGAAATATAGCCCATGCAGGAGCATCTGTTGATCTC---ACTATTTTTTCTCTTCACCTTGCTGGAGTATCCTCAATTCTAGGGGCTATTAATTTCATCACTACTATTATTAATATGAAACCCCCTGCAGTCTCACAATACCAAACACCTTTATTCGTTTGGTCAGTCTTAATCACTGCTGTATTATTATTACTATCACTTCCAGTATTAGCCGCT---GGAATTACTATACTCCTAACAGACCGAAATCTCAACACCACTTTTTTCGATCCTGCAGGAGGTGGTGACCCAATCCTATACCAACATCTATTTTGATTCTTCGGACATCCTGAGGTTTACATTCTTATTCTTCCAGGATTTGGTATTATTTCTCATATTGTTACCTATTACTCGGGCAAAAAA---GAACCTTTTGGGTACATAGGGATAGTATGAGCCATGATATCTATTGGTTTCCTAGGATTTATTGTCTGAGCCCACCATATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodipus formosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Long-tailed pocket mice are not listed by IUCN or CITES.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in the United States. However, in Baja California, Mexico, this species is not very common. It has been found at densities of up to 30 mice/hectare in suitable habitat.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In Mexico, this species is found where there is a lot of infrastructure for tourism, which may threaten populations in this region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No known conservation measures exist for this species. There are protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Burrowing could be a potential conflict for farmers if the species is creating burrows in farm fields. Heteromyid rodents are also reservoirs for many zoonotic diseases.

Negative Impacts: injures humans (carries human disease); crop pest; causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

No information was found on positive economic impacts of long-tailed pocket mice.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-tailed Pocket Mouse

The Long-tailed Pocket Mouse (Chaetodipus formosus) is a species of rodent in the Heteromyidae family. It is found in Arizona, California, Nevada and Utah in the United States and Baja California in Mexico.[1]

References

  1. ^ a b Linzey, A. V., Timm, R., Álvarez-Castañeda, S. T., Castro-Arellano, I. & Lacher, T. (2008). Chaetodipus formosus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 27 March 2009.
  • Patton, J. L. 2005. Family Heteromyidae. Pp. 844-858 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was included in the genus Perognathus. Subgenus Chaetodipus was elevated to full genus status by Hafner and Hafner (1983); this treatment was supported by a phylogenetic analysis of Heteromyidae based on myology (Ryan 1989). Chaetodipus was accepted as a full genus by Jones et al. (1992), Patton (in Wilson and Reeder 1993, 2005), and most other authors subsequent to Hafner and Hafner (1983). In a phylogeny based on molecular data, Riddle (1995) found support for the monophyly of Chaetodipus, including C. formosus, relative to Perognathus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!