Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Biology

Pumas are solitary cats, with the exception of one to six day associations during mating periods and contact between females and their young (8). Males occupy large territories that overlap those of several females; the boundaries of the territory are marked by scrapes left in prominent positions (3). Females advertise their receptivity to mating with loud scream-like calls (5). Mating occurs year-round, but is concentrated from December to March in northern latitudes (8). The female gives birth to her litter of between one and six kittens within a den; the kittens are initially blind and helpless, remaining in the den whilst their mother forages for food (3) (8). At around two months of age they are able to accompany their mother on hunting forays and remain with her until around 1.5 to 2 years old (9). Pumas are primarily nocturnal and crepuscular, being most active at dawn and dusk, and rarely emerging in the day (3). These agile yet powerful cats hunt by stalking and ambushing their prey (6). Pumas predominantly feed on ungulates, but are known to occasionally take smaller prey (10). In the northern areas of their range, they feed primarily on large ungulates, including elk and occasionally domestic cattle, whereas in tropical areas their diet seems to consist of more medium-sized prey (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Cougars avoid open habitats such as flat, shrubless deserts and farm fields, but can make a living in swamps, forests, and desert scrub habitat. They live solitary lives at low population densities, and usually avoid humans, but about four attacks are reported annually in the United States and Canada. Cougars hunt at night, either stalking their prey or waiting in ambush to pounce. They take hoofed mammals, sometimes including domestic livestock, and other prey, including rabbits, hares, porcupines, bobcats, coyotes, beavers, opossums, skunks, and even other Cougars. They rarely bed down in the same place two days in a row unless they are watching young or consuming a large kill. Some states and provinces allow Cougars to be hunted for sport

Links:
Mammal Species of the World
Visit ARKive for more images of the Florida panther  More images, video and sound of the Florida panther, a subspecies
  • Original description: Linné, Carl von, 1771.  Mantissa Plantarum altera, Generum editionis VI et Specierum ed., Supplement to Genera Plantarum and Species Plantarum.  Holmiæ: Impensis Direct. L. Salvii, 2:522.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Other than man, this large, slender cat has the greatest natural distribution of any terrestrial mammal in the Western Hemisphere (5). The puma, also known as the cougar, mountain lion and panther, is powerfully built and extremely agile. These cats are characterised by a long body with unusually long hindlimbs, thought to be an adaptation to bursts of high-speed running and jumping, used to chase and ambush prey (5) (6). The cat has a long neck, a small, broad head, short, rounded ears that are black on the back, and a long, cylindrical tail with a black tip (5) (6). The coat is of uniform colour, hence the Latin name, concolor, varying from silvery-grey through tawny-yellow to light reddish brown (3) (7). The throat, chest and belly are a pale buff to whitish colour (8) and the sides of the muzzle are framed in black (5). Faint horizontal stripes may occasionally be seen on the upper forelegs, and melanism has been widely reported though not confirmed (3) (5). Young kittens are spotted, with blue eyes (3). Males rarely weigh more than 100 kilograms, and depending on sex and age, tend to be larger in the north of their range (3), and the coat is generally longer to insulate against extreme temperatures (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Historically had widest distribution of any native American mammal (other than humans); from Canada south to southern Chile and southern Argentina and from the Pacific to the Atlantic coast. In eastern North America, now definitely known to occur only in southern Florida and Upper Peninsula of Michigan (Evers 1992). Possibly a small population exists in southeastern Canada; see Stocek (1995) for a review of recent reports from the Maritime Provinces. Elsewhere in North America, currently restricted mainly to mountainous, relatively unpopulated areas. Sea level to 14,800 ft.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The geographic range of the puma is the largest of any terrestrial mammal in the Western Hemisphere (Sunquist and Sunquist 2002), from Canada through the US, Central and South America to the southern tip of Chile. While the puma is an adaptable cat, being found in every major habitat type of the Americas, including the high Andes (5,800 m in southern Peru: Sunquist and Sunquist 2002), it was eliminated from the entire eastern half of North America within 200 years following European colonization (Nowell and Jackson, 1996). A remnant Endangered subpopulation persists in Florida, and records of pumas in northeastern Canada and the eastern US are on the rise, indicating possible recolonization (M. Kelly pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Canada to South America

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Historically, mountain lions had the largest distribution of all American terrestrial mammals. They ranged from coast to coast in North America, and from southern Argentina and Chile, in South America, to southeastern Alaska. Extermination efforts, hunting pressure, and habitat destruction have isolated populations of mountain lions to relatively mountainous, unpopulated areas throughout much of their range. Populations in eastern North America were entirely exterminated, except for a small population of Florida panthers (Puma_concolor_coryi). In recent years populations have begun to expand into areas of human habitation, especially in the western United States. Mountain lions are now fairly common in suburban areas of California and have recently been sighted as far east as urban Kansas City, Missouri, where several have been hit by cars. Mountain lion sightings in eastern North America, outside of southern Florida, are still more likely to be escaped or abandoned "pet" mountain lions or other large cats.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mountain lions have the widest distribution of any native mammal in the
western hemisphere [12,56,34]. During presettlement times, mountain
lions ranged from northern British Columbia to southern Chile and
Argentina, and from coast to coast in North America [12]. Although
still covering over 100 degrees latitude from the Straits of Magellan to
the Canadian Yukon Territory and now also Alaska, there has been an
overall reduction in mountain lion distribution. In North America
substantial mountain lion populations occur only in the western United
States and Canada, and these ranges have been reduced from presettlement
times [56]. Isolated populations and incidental sightings have been
reported in the central and eastern United States [10,12]. At present
the only known mountain lion population east of Texas exists in southern
Florida, although a small population may exist in western Arkansas and
eastern Oklahoma [30]. The specific distributions of the North American
subspecies are listed below:

P. c. azteca - Occurs in Arizona, New Mexico, and Mexico [19].

Yuma puma - Yuma pumas live along the lower Colorado River in
California, Arizona, and Mexico [20].

P. c. californica - Occurs in southern Oregon, California, and Nevada
[19].

Florida panther - Historically Florida panthers ranged from the lower
Mississippi River valley east through the southeastern states to the
Florida Everglades. At present the Florida panther is found only south
of Lake Okeechobee, Florida, in four areas: the Fakahatchee Strand; Big
Cypress National Preserve; the southern portion of the Everglades
Conservation Area; and Everglades National Park, from the
Hole-in-the-Donut area north [16,34,53]. In addition to the above
areas, a number of recent, verified reports or specimens have come from
Highlands, Palm Beach, Broward, Martin, Osceola, Volusia, and St. Johns
counties. However, no reproduction has been recorded in these areas
[34]. Only 30 to 50 Florida panthers are believed to exist in the wild
[34,53]. The population of Florida panthers that existed in Everglades
National Park in the mid-1980's is now functionally extinct, with only
one male remaining [3].

Eastern cougar - Historically eastern cougars ranged throughout the
eastern United States from Michigan and Indiana east to the Atlantic
coast, and from southern Canada south to Tennessee and South Carolina.
Today eastern cougars may be extinct. No breeding populations have been
positively identified within the historic range since the 1920's.
Unconfirmed sightings continue to be reported from the mountains of
North Carolina and the Virginias. Tracks and scat were observed in the
Jefferson-George Washington-Monongahela National Forest as recently as
1981, but no positive confirmation was made [53].

P. c. missoulensis and P. c. hippolestes - Historically, P. c.
missoulensis ranged from British Columbia east to Manitoba, and south to
eastern Oregon, Idaho, Montana, northern Wyoming, and northern North
Dakota. P. c. hippolestes ranged from southern Idaho and northern Utah
east to eastern North Dakota, South Dakota, Nebraska, and western Kansas
[19]. Hansen [20] stated that both subspecies are now restricted to the
western portion of their historic ranges. However, sightings still
occur in Kansas, the Black Hills of South Dakota, and the Nebraska
panhandle [20].

P. c. kaibabensis - Occurs from southern Oregon south through Nevada,
western Utah, and northern Arizona [19].

P. c. olympus - Occurs in the Olympic Mountains of Washington [12].

P. c. oregonensis - Occurs in southwestern British Columbia, western
Washington, and Oregon [19].

Wisconsin puma - The current distribution of this subspecies was not
described in the available literature.

Texas panther - This subspecies formerly occupied most of Texas and
Oklahoma, but is now restricted to eastern New Mexico and western Texas
[20].

P. c. vancouverensis - Occurs on Vancouver Island, British Columbia
[19].
  • 3. Belden, Robert C. 1988. The Florida panther. In: Audubon Wildlife Report: 515-532. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24557]
  • 10. Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; [and others]
  • 12. Currier, Mary Jean P. 1983. Felis concolor. Mammalian Species No. 200: 1-7. [24559]
  • 16. Florida Panther Interagency Committee. 1987. Florida panther (Felis concolor coryi). Revised Recovery Plan. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 75 p. [24575]
  • 19. Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons. 1271 p. [14765]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 30. Lindzey, Frederick. 1987. Mountain lion. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 656-668. [24560]
  • 34. Maehr, David S. 1992. Florida panther: Felis concolor coryi. In: Humphrey, Stephen R., ed. Rare and endangered biota of Florida. Mammals: Volume 1. Naples, FL: Florida Game and Fresh Water Fish Commission: 176-189. [21069]
  • 53. Lowe, David W.; Matthews, John R.; Moseley, Charles J. 1990. The official World Wildlife Fund guide to endangered species of North America. Volume 1. Plants: Mammals. Washington, DC: Beacham Publishing, Inc. 556 p. [+ appendices]
  • 56. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID IL IA KS KY MD MA MI MN MS
MO MT NE NV NH NJ NM NC ND OK
OR PA SC SD TN TX UT VT VA WA
WV WI WY


AB BC MB NT ON SK YK



MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Historically, mountain lions had the most extensive distribution of all American terrestrial mammals. They ranged from coast to coast in North America, and from southern Argentina and Chile to southeastern Alaska. Extermination efforts, hunting pressure, and habitat destruction have restricted their range to relatively mountainous, unpopulated areas throughout much of their range. Populations in eastern North America were entirely exterminated, except for a small population of Florida panthers (Puma concolor coryi). In recent years populations have begun to expand into areas of human habitation, especially in the western United States. Mountain lions are now fairly common in suburban areas of California and have recently been sighted as far east as urban Kansas City, Missouri, where several have been hit by cars. Mountain lion sightings in eastern North America, outside of southern Florida, are still more likely to be escaped or abandoned "pet" mountain lions or other large cats.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread, ranging from areas in Canada, down through the United States, south to Central and South America. However, the species' range has greatly retracted, having been eliminated from the almost the entire eastern half of Northern America following European colonisation (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mountain lions are large, slender cats. The fur is short, coarse, and ranges from yellowish brown to grayish brown on the upper parts and a paler, almost buffy, color on the belly. The throat and chest are whitish. Mountain lions have a pinkish nose with a black border that extends to the lips. The muzzle stripes, the area behind ears, and the tip of tail are black. The eyes of adult animals are grayish brown to golden. The tail is long, cylindrical, and about one-third of total body length. The limbs are short and muscular. The feet are broad, with four digits on hind feet and five on forefeet. The retractile claws are sharp and curved. The skull is broad and short, with a high, arched forehead and massive teeth modified for grabbing and slicing prey.

Males are larger than females. Head and body length ranges from 1020 to 1540 mm in males and 860 to 1310 mm in females. Tail length ranges from 680 to 960 mm in males and 630 to 790 mm in females. Males weigh from 36 to 120 kg and females from 29 to 64 kg.

Range mass: 29 to 120 kg.

Range length: 860 to 1540 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 49.326 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Mountain lions are large, slender cats. The pelage has a short and coarse texture. The general coloration ranges from a yellowish brown to grayish brown on the upper parts and a paler, almost buffy, color on the belly. The throat and chest are whitish. Mountain lions have a pinkish nose with a black border that extends to the lips. The muzzle stripes, the area behind ears, and the tip of tail are black. The eyes of mature animals are grayish brown to golden. The tail is long, cylindrical, and about one-third of the animal's total length. The limbs are short and muscular. The feet are broad, with four digits on hind feet and five on forefeet. The pollex is small and set above the other digits. The retractile claws are sharp and curved. The skull is noticeably broad and short. The forehead region is high and arched. The rostrum and the nasal bones are broad. The dental formula is 3/3 1/1 3/2 1/1. The mandible is short, deep, and powerfully constructed. The carnassial teeth are massive and long. The canines are heavy and compressed. The incisors are small and straight. Mountain lions have one more small premolar on each side of the upper jaw than do bobcats and lynx.

Males are larger than females. Head and body length ranges from 1020 to 1540 mm in males and 860 to 1310 mm in females. Tail length ranges from 680 to 960 mm in males and 630 to 790 mm in females. Males weigh from 36 to 120 kg and females from 29 to 64 kg.

Range mass: 29 to 120 kg.

Range length: 860 to 1540 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 49.326 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 274 cm

Weight: 120000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are significantly heavier than females.

Length:
Average: 1,270 mm males; 1,140 mm females
Range: 1,020-1,540 mm males; 860-1,310 mm females

Weight:
Average: 62 kg males; 42 kg females
Range: 36-120 kg males; 29-64 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the jaguarundi in much larger size (maximum total length of jaguarundi is 137 cm). Differs from the lynx and bobcat in having a much longer tail (less than 25 cm in bobcat and lynx). Differs from other cats in lack of spotting in adult pelage. Young mountain lion differs from the ocelot in having the spot not arranged in rows or chainlike streaks. See Hoffmeister (1986) for cranial differences between mountain lion and jaguar.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Chocó-Darién Moist Forests Habitat

This taxon can be found in the Chocó-Darién moist forests ecoregion, one of the most species rich lowland areas on Earth, with exceptional abundance and endemism over a broad range of taxa including plants, birds, amphibians and arthropods. The biological distinctiveness is exceptional, with considerable biodiversity.

There are three principal geomorphologic types in the ecoregion: alluvial plains of recent origin, low mountains formed by the relatively recent dissection of sediments from the Tertiary and Pleistocene periods, and the complexes in mountain areas consisting of mesozoic rocks. The high precipitation and the topography mean that the ecoregion includes a complex of great hydrographic basins, the most important being those of the Atrato, Baudó, and San Juan Rivers and the Micay and Patía Rivers in the south. The force of the water in many of these rivers form deep gorges cutting through the mountains, creating spectacular rapids and waterfalls in the mountains. At lower elevations, large rivers become very wide and with many meanders. Given the high precipitation in the region, it is not surprising that the soils are severely leached and poor in nutrients. Most of the ecoregion has typical laterite soils with reddish clay, although the soils are younger and less leached in some areas, especially close to the base of the Andes and in the floodplains of the major rivers. Of particular botanical interest are the white clay soils in the region of Bajo Calima in Colombia, which are associated with the gigantic sclerophyllous leafed and unusually large fruited vegetation.

Depending on the altitudinal gradient, soil water content and the effect of the sea, there are various types of vegetation that make up the ecoregion. In broad terms, in the northern part of the ecoregion, the lowland rainforests correlate to the Brosimun utilis alliance, including communities dominated by the deciduous Cuipo tree (Cavanillesia platanifolia), the Espavé wild cashew (Anacardium excelsum), the Panamanian rubber tree (Castilla elastica), Brosimum guianense, Bombacopsis spp., Ceiba pentandra, Dipteryx panamensis, and others. In the undergrowth Mabea occidentalis, Clidemia spp., Conostegia spp. and Miconia spp. are abundant. In zones that are occasionally flooded, the Cativo (Prioria copaifera) flourishes as well. In the southern part of the ecoregion, these rainforests have multiple strata, with two layers of trees, lianas, and epiphytes with vigorous growth rates. The number of deciduous plants increases in the north and south, where there is a dry season, particularly near the coast. The forests at higher altitudes, starting at 600 meters, have communities with the following species: Guamos (Inga spp.), Billia columbiana, Brosimum sp., Sorocea spp., Jacaranda hesperia, Pourouma chocoana, Guatteria ferruginea, Cecropia spp., Elaegia utilis, and Brunellia spp.

There are at least 127 species of amphibians in the Choco-Darien, including the following endemic anuran species: Isla Bonita robber frog (Craugastor crassidigitus); Kokoe poison frog (Phyllobates aurotaenia NT), found on western slopes of the Cordillera Occidental , along the Ra­o San Juan drainage south to the Ra­o Raposo; Golden poison frog (Phyllobates terribilis EN); La Brea poison frog (Oophaga occultator); Andagoya robber frog (Pristimantis roseus); Antioquia beaked toad (Rhinella tenrec); Atrato glass frog (Hyalinobatrachium aureoguttatum); Blue-bellied poison arrow frog (Ranitomeya minuta); Colombian egg frog (Ctenophryne minor), known only to the in the upper Ra­o Saija drainage; Condoto stubfoot toad (Atelopus spurrelli VU); Flecked leaf frog (Phyllomedusa psilopygion); LeDanubio robber frog (Strabomantis zygodactylus). An endemic salamander present in the Choco-Darien is the Finca Chibigui salamander (Bolitoglossa medemi VU).

Some other non-endemic anurans found here are: Anatipes robber frog (Strabomantis anatipes); Banded horned treefrog (Hemiphractus fasciatus); Black-legged poison frog (Phyllobates bicolor NT); Horned marsupial frog (Gastrotheca cornuta EN), known for having the largest amphibian eggs in the world; El Tambo stubfoot toad (Atelopus longibrachius EN); Elegant stubfoot toad (Atelopus elegans CR). Endemic caecilians in the ecoregion include the Andagoya caecilian (Caecilia perdita).

There are a number of reptilian taxa within the ecoregion, including: Adorned graceful brown snake (Rhadinaea decorata); the endemic Black centipede snake (Tantilla nigra); Boulenger's least gecko (Sphaerodactylus scapularis VU); the endemic Iridescent ground snake (Atractus iridescens); the endemic Cauca coral snake (Micrurus multiscutatus); the endemic Colombian coral snake (Micrurus spurelli); the endemic Dark ground snake (Atractus melas); the endemic Colombian mud turtle (Atractus melas VU); and the endemic Echternacht's ameiva (Ameiva anomala).

There are 577 species of birds recorded; Tyrannidae is listed as the most diverse avian family, presenting 28 genera and 60 species within the ecoregion. The Choco-Daroemis is a center of avian endemism of the Neotropics; moreover, according to Stattersfield, this ecoregion spans two Endemic Bird Areas, one in Central America and one in South America.

Between these two Endemic Bird Areas there are over sixty restricted range species, including the Chocó tinamou (Crypturellus kerriae VU), Chestnut-mantled Oropendola (Psarocolius cassini EN), Viridian dacnis (Dacnis viguieri), Crested ant-tanager (Habia cristata), Lita woodpecker (Piculus litea), and Plumbeous forest-falcon (Micrastur plumbeus EN). Also to be noted is the presence of the Harpy eagle (Harpia harpyja), the Black and white crowned eagle (Spizastur melanoleucus), taxa increasingly rare in many areas of the Neotropics, and possibly the Speckled antshrike (Xenornis setifrons EN) although one has not been recorded in Colombia since the 1940s.

The region is rich in mammalian taxa, but the larger animals have received inadequate research. These include the Bush dog (Speothos venaticus NT); Chocó tamarin (Saguinus geoffroyi EN), the Baird's Tapir (Tapirus bairdii EN), the Giant anteater (Myrmecophaga tridactyla VU), the Brown-headed spider monkey (Ateles fuscipens CR), the Puma (Puma concolor VU), the Ocelot (Leopardus pardalis LC), and the jaguar (Panthera onca NT).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Sierra Juarez and San Pedro Martir pine-oak forests Habitat

This taxon can be found in the Sierra Juarez and San Pedro Martir pine-oak forests. The ecoregion is located in two mountain ranges in the state of Baja California, Mexico: the Sierra de Juarez and the Sierra de San Pedro Martir. Both mountain ranges belong to the physiographical province of Baja California, and constitute the northernmost elevated peaks of the Baja Peninsula. The mountainous range that descends into a large portion of Baja California becomes more abrupt at Juarez and San Pedro Martir; the eastern slope is steeper than the western. Altitudes range between 1100-2800 meters. The granitic mountains of Juarez and San Pedro Martir have young rocky soils and are poorly developed, shallow, and low in organic matter.

Dominant trees in the ecoregion are: Pinus quadrifolia, P. jeffreyi, P. contorta, P. lambertiana, Abies concolor, and Libocedrus decurren. The herbaceous stratum is formed by Bromus sp. and Artemisia tridentata. Epiphytes and fungi are abundant throughout the forests.

Characteristic mammals of the ecoregion include: Ornate shrew (Sorex ornatus), Puma (Puma concolor), Fringed Myotis bat (Myotis thysanodes), California chipmunk (Tamias obscurus), Bobcat (Lynx rufus), Coyote (Canis latrans), San Joaquin kit fox (Vulpes macrotis) and Bighorn sheep (Ovis canadensis).

Numerous birds are present in the ecoregion, including the rare Bald eagle (Haliaeetus leucocephalus), California condor (Gymnogyps californianus), Pinyon jay (Gymnohinus cyanocephalus), and White-breasted nuthatch (Sitta carolinensis).

A number of different reptilian taxa are found in these oak-pine forests; representative reptiles here are: the Banded rock lizard (Petrosaurus mearnsi); Common checkered whiptail (Cnemidophorus tesselatus), who is found in sparsely vegetated areas; Coast horned lizard (Phrynosoma coronatum), often found in locales of sandy soil, where individuals may burrow to escape surface heat; Night desert lizard (Xantusia vigilis), who is often found among bases of yucca, agaves and cacti; and the Baja California spiny lizard (Sceloporus zosteromus).

The Pacific chorus frog (Pseudacris regilla) is an anuran found within the Sierra Juarez and San Pedro Martir pine-oak forests as one of its western North America ecoregions of occurrence. The only other amphibian in the ecoregion is the Western toad (Anaxyrus boreas).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

California Montane Chaparral and Woodlands Habitat

This taxon can be found in the California montane chaparral and woodlands, a near coastal ecoregion in Central and Southern California, USA. This ecoregion is disjunctive, with a major element in Southern California and another along the Monterey County coast. The ecoregion encompasses most of the Transverse Range that includes the San Bernardino Mountains; San Gabriel Mountains; portions of the Santa Ynez and San Rafael Mountains; Topatopa Mountains; San Jacinto Mountains; the Tehachapi, Greenhorn, Piute, and Kiavah Mountains that extend roughly northeast-southwest from the southern Sierra Nevada; and the Santa Lucia Range that parallels the coast southward from Monterey Bay to Morro Bay.

The California montane chaparral and woodland ecoregion consists of a complex mosaic of coastal sage scrub, lower chaparral dominated by chamise, upper chaparral dominated by manzanita, desert chaparral, Piñon-juniper woodland, oak woodlands, closed-cone pine forests, yellow pine forests, sugar pine-white fir forests, lodgepole pine forests, and alpine habitats. The prevalence of drought-adapted scrub species in the flora of this ecoregion helps distinguish it from similar communities in the Sierras and other portions of northern California. Many of the shared Sierra Nevadan species typically are adapted to drier habitats in that ecoregion, Jeffrey Pine (Pinus jeffreyi) being a good example.

Oak species are an important component of many chaparral and forest communities throughout the ecoregion. Canyon Live Oak, Interior Live Oak, Tanbark Oak (not a true Quercus species), Engelmann Oak, Golden-cup Oak, and Scrub Oak are some examples. Mixed-conifer forests are found between 1371 to 2896 meters elevation with various combinations and dominance of incense cedar, sugar pine, and white fir, Jeffrey Pine, Ponderosa Pine, and mountain juniper. Subalpine forests consist of groves of Limber Pine (Pinus flexilis), Lodgepole Pine, and Jeffrey Pine. Very old individual trees are commonly observed in these relict subalpine forests. Within this zone are subalpine wet meadows, talus slope herbaceous communities, krumholz woodlands, and a few small aspen groves.

In addition to these general vegetation patterns, this ecoregion is noted for a variety of ecologic islands, communities with specialized conditions that are widely scattered and isolated and typically harbor endemic and relict species. Examples include two localities of Knobcone Pine (Pinus attenuata) on serpentine soils, scattered vernal pools with a number of endemic and relict species, and isolated populations of one of North America’s most diverse cypress floras, including the rare Gowen Cypress (Cupressus goveniana goveniana) restricted to two sites on acidic soils in the northern Santa Lucia Range, Monterey Cypress (Cupressus macrocarpa) found only at two coastal localities near Monterey Bay, and Sargent Cypress (Callitropsis sargentii LR/LC) restricted to serpentine outcrops. Monterey Pine (Pinus radiata) is also restricted to three coastal sites near Monterey Bay.

The ecoregion is also home to a few endemic or near-endemic mammalian vertebrates, such as the White-eared Pocket Mouse (Perognathus alticolus EN), a mammal known only to two disjunct mountain ranges in southern California: San Bernardino Mountains in San Bernardino County (ssp. alticolus), and the Tehachapi Mountains, in Kern, Ventura, and Los Angeles counties. The near-endemic fossorial Agile Kangaroo Rat (Dipodomys agilis) is found in the southern disjunctive unit of the ecoregion, and is known only to the Los Angeles Basin and foothills of San Gabriel and San Bernardino mountains in Ventura, Los Angeles, and Riverside counties north to Santa Barbara County and through the southern Sierra Nevada, including Mount Pinos, Tehachapi and San Gabriel mountains, and northern San Fernando Valley. Non-endemic mammals found in the ecoregion include Botta's Pocket Gopher (Thomomys bottae) and Trowbridge's Shrew (Sorex trowbridgii). Some larger vertebrate predators can be found in the ecoregion, including Puma (Puma concolor), Bobcat (Lynx rufus), Coyote (Canis latrans), and Ringtails (Bassariscus astutus).

The ecoregion boasts five endemic and near-endemic amphibians, largely Plethodontid salamanders. Some specific salamander taxa found here are the endemic Tehachapi Slender Salamander (Batrachoseps stebbinsi VU), known from isolated sites in the Caliente Creek drainage, Piute Mountains, and Kern County, California along with scattered populations in the Tehachapi Mountains to Fort Tejon, Kern County; the near-endemic Blackbelly Slender Salamander (Batrachoseps nigriventris); the Monterey Ensatina (Ensatina eschscholtzii); the Channel Islands Slender Salamander (Batrachoseps pacificus), endemic to a narrow range restricted solely on Anacapa, Santa Cruz, Santa Rosa, and San Miguel islands; and the Arboreal Salamander (Aneides lugubris), found only in California and Baja California. A newt found here is the Coast Range Newt (Taricha torosa). Anuran taxa in the ecoregion include the Foothill Yellow-legged Frog (Rana boylii NT); the Southern Mountain Yellow-legged Frog (Rana muscosa EN), a California endemic occurring in several disjunctive populations; and the Northern Red-legged Frog (Rana aurora).

The California montane chaparral and woodlands ecoregions contains a number of reptiles such as the Coast Horned Lizard (Phrynosoma coronatum), who ranges from Northern California to Baja California. Also found here is the Sagebrush Lizard (Sceloporus graciosus); the Western Fence Lizard (Sceloporus occidentalis); the Southern Alligator Lizard (Elgaria multicarinata); and the Side-blotched Lizard (Uta stansburiana). The Two-striped Garter Snake (Thamnophis hammondii) is a restricted range reptile found near-coastally from Monterey County, California southward to Baja California.

The California Condor once inhabited much of the ecoregion, with the western Transverse Range acting today as a refuge for some of the last wild populations, after considerable conservation efforts, especially in the Los Padres National Forest. The Heermann's Gull (Larus heermanni NT) is found in coastal areas of the ecoregion.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Sonoran Desert Habitat

This taxon is found in the Sonoran Desert, which comprises much of the state of Sonora, Mexico, most of the southern half of the USA states of Arizona, southeastern California, most of the Baja California peninsula, and the numerous islands of the Gulf of California. Its southern third straddles 30° north latitude and is a horse latitude desert; the rest is rainshadow desert. It is lush in comparison to most other deserts. There is a moderate diversity of faunal organisms present, with 550 distinct vertebrate species having been recorded here.

The visually dominant elements of the landscape are two lifeforms that distinguish the Sonoran Desert from the other North American deserts: legume trees and large columnar cacti. This desert also supports many other organisms, encompassing a rich spectrum of some 2000 species of plants, 550 species of vertebrates, and untolled thousands of invertebrate species.

The Sonoran Desert prominently differs from the other three deserts of North America in having mild winters. Most of the area rarely experiences frost, and the biota are partly tropical in origin. Many of the perennial plants and animals are derived from ancestors in the tropical thorn-scrub to the south, their life cycles attuned to the brief summer rainy season. The winter rains, when ample, support great populations of annuals (which make up nearly half of the plant species). Some of the plants and animals are opportunistic, growing or reproducing after significant rainfall in any season.

Creosote Bush (Larrea divaricata) and White Bursage (Ambrosia dumosa) vegetation characterize the lower Colorado River Valley section of the Sonoran. The Arizona upland section to the north and east is more mesic, resulting in greater species diversity and richness. Lower elevation areas are dominated by dense communities of Creosote Bush and White Bursage, but on slopes and higher portions of bajadas, subtrees such as palo verde (Cercidium floridum, C. microphyllum) and Ironwood (Olneya tesota), saguaros (Carnegiea gigantia), and other tall cacti are abundant. Cresosote Bush (Larrea tridentata) and White Bursage (Ambrosia dumosa) form the scrub that dominates the northwest part of the Sonoran Desert. This association thrives on deep, sandy soils in the flatlands. Where the dunes allow for slight inclination of the slope, species of Mesquite (Prosopis), Cercidium, Ironwood (Olneya tesota), Candalia, Lycium, Prickly-pear (Opuntia), Fouquieria, Burrobush (Hymenoclea) and Acacia are favored. The coastal plains of Sonora are composed of an almost pure Larrea scrub. Away from the Gulf influence in the area surrounding the Pinacate, Encelia farinosa, Larrea tridentataOlneya, Cercidium, Prosopis, Fouquieria and various cacti species dominate the desert.

Many wildlife species, such as Sonoran Pronghorn Antelope (Antilocapra sonoriensis EN), Desert Bighorn Sheep (Ovis canadensis nelsoni) and the endemic Bailey's Pocket Mouse (Chaetodipus baileyi) use ironwood, cacti species and other vegetation as both shelter from the harsh climate as well as a water supply. Other mammals include predators such as Puma (Felis concolor), Coyote (Canis latrans) and prey such as Black-tailed Jackrabbit (Lepus californicus), and the Round-tailed Ground Squirrel (Spermophilus tereticaudus). Other mammals able to withstand the extreme desert climate of this ecoregion include California Leaf-nosed Bat (Macrotus californicus) and Ring-tailed Cat (Bassariscus astutus).

Three endemic lizards to the Sonoran Desert are: the Coachella Fringe-toed Lizard (Uma inornata EN); the Flat-tail Horned Lizard (Phrynosoma mcallii NT); and the Colorado Desert Fringe-toed Lizard (Uma notata NT); an endemic whiptail is the San Esteban Island Whiptail (Cnemidophorus estebanensis). Non-endemic special status reptiles in the ecoregion include the Desert Tortoise (Gopherus agassizii VU) and the Gila Monster (Heloderma suspectum NT).

There are twenty-four  anuran species occurring in the Sonoran Desert, one of which is endemic, the Sonoran Green Toad (Anaxyrus retiformis). Other anurans in the ecoregion are: California Treefrog (Pseudacris cadaverina); Canyon Treefrog (Hyla arenicolor); Lowland Burrowing Frog (Smilisca fodiens); Mexican Treefrog (Smilisca baudinii); Madrean Treefrog (Hyla eximia); Sabinal Frog (Leptodactylus melanonotus); Northwest Mexico Leopard Frog (Lithobates magnaocularis); Brown's Leopard Frog (Lithobates brownorum); Yavapai Leopard Frog (Lithobates yavapaiensis); Mexican Cascade Frog (Lithobates pustulosus); Mexican Leaf Frog (Pachymedusa dacnicolor); Red Spotted Toad (Anaxyrus punctatus); Sinaloa Toad (Incilius mazatlanensis); Sonoran Desert Toad (Incilius alvarius); Eastern Green Toad  (Anaxyrus debilis); New Mexico Spadefoot (Spea multiplicata); Great Plains Toad (Anaxyrus cognatus); Couch's Spadefoot Toad (Scaphiopus couchii); Cane Toad (Rhinella marina); Elegant Narrowmouth Toad (Gastrophryne elegans);  Little Mexican Toad (Anaxyrus kelloggi); Great Plains Narrowmouth Toad (Gastrophryne olivacea); and Woodhouse's Toad (Anaxyrus woodhousii).

The Sonoran Desert is recognized as an exceptional birding area. Forty-one percent (261 of 622) of all terrestrial bird species found in the USA can be seen here during some season of the year. The Sonoran Desert, together with its eastern neighbor the Chihuahuan Desert, is the richest area in in the USA for birds, particularly hummingbirds. Among the bird species found in the Sonoran Desert are the saguaro-inhabiting Costa's Hummingbird (Calypte costae), Black-tailed Gnatcatcher (Polioptila melanura), Phainopepla (Phainopepla nitens) and Gila Woodpecker (Melanerpes uropygualis). Perhaps the most well-known Sonoran bird is the Greater Roadrunner (Geococcyx californianus), distinguished by its preference for running rather than flying, as it hunts scorpions, tarantulas, rattlesnakes, lizards, and other prey. The Sonoran Desert exhibits two endemic bird species, the highest level of bird endemism in the USA. The Rufous-winged Sparrow (Aimophila carpalis) is rather common in most parts of the Sonoran, but only along the central portion of the Arizona-Mexico border, seen in desert grasses admixed with brush. Rare in extreme southern Arizona along the Mexican border, the endemic Five-striped Sparrow (Aimophila quinquestriata) is predominantly found in canyons on hillsides and slopes among tall, dense scrub.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan, Mark Dimmitt, Arizona-Sonora Desert Museum, World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Sierra Madre Oriental Pine-oak Forests Habitat

This taxon is found in the Sierra Madre Oriental pine-oak forests, which exhibit a very diverse community of endemic and specialized species of plants, mammals, reptiles and amphibians. These high mountains run north to south, beginning in the USA and ending in Mexico. The Sierra Madre Oriental pine-oak forests are a highly disjunctive ecoregion, owing to the fact that they are present only at higher elevations, within a region with considerable expanses of lower elevation desert floor.

The climate is temperate humid on the northeastern slope, and temperate sub-humid on the western slope and highest portions of the mountain range. Pine-oak forest habitat covers most of the region, even though most of the primary forest has been destroyed or degraded. However, the wettest portions house a community of cloud forests that constitute the northernmost patches of this vegetation in Mexico. The forests grow on soils derived from volcanic rocks that have a high content of organic matter. The soils of lower elevations are derived from sedimentary rocks, and some of them are formed purely of limestone. In the northernmost portions of the ecoregion, the forests occur on irregular hummocks that constitute biological "islands" of temperate forest in the middle of the Chihuahuan Desert. To the south, from Nuevo León southward until Guanajuato and Queretaro, the ecoregion is more continuous along the mainstem of the Sierra Madre Oriental.

Dominant tree species include the pines: the endemic Nelson's Pine (Pinus nelsonii), Mexican Pinyon (P. cembroides), Smooth-bark Mexican Pine (P. pseudostrobus), and Arizona Pine (P. arizonica); and the oaks Quercus castanea and Q. affinis. In mesic environments, the most common species are P. cembroides, and Alligator Juniper (Juniperus deppeana), but in more xeric environments on the west slopes of the mountains, the endemic P. pinceana is more abundant. Gregg's Pine (P. greggii) and Jelecote Pine (P. patula) are endemic.

Many mammalian species wander these rugged hills. Mule Deer (Odocoileus hemionus), Puma (Puma concolor), Cliff Chipmunk (Tamias dorsalis), Collared Peccary (Tayassu tajacu), Coati (Nasua narica), Jaguar (Panthera onca) and Coyote (Canis latrans) are a few of the many diverse mammals that inhabit this ecoregion. Some threatened mammals found in the ecoregion are: Bolaños Woodrat (Neotoma palatina VU); Diminutive Woodrat (Nelsonia neotomodon NT), known chiefly from the western versant of the Sierra Madre; Chihuahuan Mouse (Peromyscus polius NT); and Mexican Long-nosed Bat (Leptonycteris nivalis EN).

A considerable number of reptilian taxa are found in the Sierra Madre Oriental pine-oak forests, including three endemic snakes: Ridgenose Rattlesnake (Crotalus willardi); Fox´s Mountain Meadow Snake (Adelophis foxi); and the Longtail Rattlesnake (Crotalus stejnegeri VU), restricted to the central Sierra Madre. An endemic skink occurring in the ecoregion is the Fair-headed Skink (Plestiodon callicephalus). The Striped Plateau Lizard (Sceloporus virgatus) is endemic to the ecoregion. The Sonoran Mud Turtle (Kinosternon sonoriense VU) is found in the ecoregion and ranges from southwestern New Mexico south to northwestern Chihuahua.

The following anuran taxa occur in the Sierra Madre Oriental pine-oak forests: Red-spotted Toad (Anaxyrus punctatus); Cane Toad (Rhinella marina); Elegant Narrow-mouthed Toad (Gastrophryne elegans); New Mexico Spadefoot Toad (Spea multiplicata); Sinaloa Toad (Incilius mazatlanensis); Pine Toad (Incilius occidentalis); Southwestern Toad (Anaxyrus microscaphus); Woodhouse's Toad (Anaxyrus woodhousii); Great Plains Narrowmouth Toad (Gastrophryne olivacea); Great Plains Toad (Anaxyrus cognatus); Plateau Toad (Anaxyrus compactilis); Texas Toad (Anaxyrus speciosus); Sonoran Desert Toad (Incilius alvarius), found only at lower ecoregion elevations here; Rana-ladrona Silbadora (Eleutherodactylus teretistes); Sabinal Frog (Leptodactylus melanonotus); Mexican Leaf Frog (Pachymedusa dacnicolor); Montezuma Leopard Frog (Lithobates montezumae); Yavapai Leopard Frog (Lithobates yavapaiensis); Northwest Mexico Leopard Frog (Lithobates magnaocularis); Bigfoot Leopard Frog (Lithobates megapoda), who generally breeds in permanent surface water bodies; Mexican Cascade Frog (Lithobates pustulosus); Tarahumara Frog (Lithobates tarahumarae VU); Western Barking Frog (Craugastor augusti); Lowland Burrowing Frog (Smilisca fodiens); Taylor's Barking Frog (Craugastor occidentalis); Blunt-toed Chirping Frog (Eleutherodactylus modestus VU), found only at the very lowest elevations of the ecoregion; Shiny Peeping Frog (Eleutherodactylus nitidus); California Chorus Frog (Pseudacris cadaverina); Rio Grande Frog (Lithobates berlandieri); Madrean Treefrog (Hyla eximia); Mexican Treefrog (Smilisca baudinii); Dwarf Mexican Treefrog (Tlalocohyla smithii); Canyon Treefrog (Hyla arenicolor); Northern Sheep Frog (Hypopachus variolosus); Chiricahua Leopard Frog (Lithobates chiricahuensis). There are three salamanders found in the ecoregion: the endemic Sacramento Mountains Salamander (Aneides hardii), found only in very high montane reaches above 2400 meters; Tiger Salamander (Ambystoma tigrinum); and the Tarahumara Salamander (Ambystoma rosaceum).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Marismas Nacionales-San Blas Mangroves Habitat

This taxon is found in the Marismas Nacionales-San Blas mangroves ecoregion contains the most extensive block of mangrove ecosystem along the Pacific coastal zone of Mexico, comprising around 2000 square kilometres. Mangroves in Nayarit are among the most productive systems of northwest Mexico. These mangroves and their associated wetlands also serve as one of the most important winter habitat for birds in the Pacific coastal zone, by serving about eighty percent of the Pacific migratory shore bird populations.

Although the mangroves grow on flat terrain, the seven rivers that feed the mangroves descend from mountains, which belong to the physiographic province of the Sierra Madre Occidental. The climate varies from temperate-dry to sub-humid in the summer, when the region receives most of its rainfall (more than 1000 millimetres /year).

Red Mangrove (Rhizophora mangle), Black Mangrove (Avicennia germinans), Buttonwood (Conocarpus erectus) and White Mangrove trees (Laguncularia racemosa) occur in this ecoregion. In the northern part of the ecoregion near Teacapán the Black Mangrove tree is dominant; however, in the southern part nearer Agua Brava, White Mangrove dominates. Herbaceous vegetation is rare, but other species that can be found in association with mangrove trees are: Ciruelillo (Phyllanthus elsiae), Guiana-chestnut (Pachira aquatica), and Pond Apple (Annona glabra).

There are are a number of reptiles present, which including a important population of Morelet's Crocodile (Crocodylus moreletii) and American Crocodile (Crocodylus acutus) in the freshwater marshes associated with tropical Cohune Palm (Attalea cohune) forest. Also present in this ecoregion are reptiles such as the Green Iguana (Iguana iguana), Mexican Beaded Lizard (Heloderma horridum) and Yellow Bellied Slider (Trachemys scripta). Four species of endangered sea turtle use the coast of Nayarit for nesting sites including Leatherback Turtle (Dermochelys coriacea), Olive Ridley Turtle (Lepidochelys olivacea), Hawksbill Turtle (Eretmochelys imbricata) and Green Turtle (Chelonia mydas).

A number of mammals are found in the ecoregion, including the Puma (Puma concolor), Ocelot (Leopardus pardalis), Jaguar (Panthera onca), Southern Pygmy Mouse (Baiomys musculus), Saussure's Shrew (Sorex saussurei). In addition many bat taxa are found in the ecoregion, including fruit eating species such as the Pygmy Fruit-eating Bat (Artibeus phaeotis); Aztec Fruit-eating Bat (Artibeus aztecus) and Toltec Fruit-eating Bat (Artibeus toltecus); there are also bat representatives from the genus myotis, such as the Long-legged Myotis (Myotis volans) and the Cinnamon Myotis (M. fortidens).

There are more than 252 species of birds, 40 percent of which are migratory, including 12 migratory ducks and approximately 36 endemic birds, including the Bumblebee Hummingbird, (Atthis heloisa) and the Mexican Woodnymph (Thalurania ridgwayi). Bojórquez considers the mangroves of Nayarit and Sinaloa among the areas of highest concentration of migratory birds. This ecoregion also serves as wintering habitat and as refuge from surrounding habitats during harsh climatic conditions for many species, especially birds; this sheltering effect further elevates the conservation value of this habitat.

Some of the many representative avifauna are Black-bellied Whistling Duck (Dendrocygna autumnalis), Great Blue Heron (Ardea herodias), Roseate Spoonbill (Ajaia ajaja), Snowy Egret (Egretta thula), sanderling (Calidris alba), American Kestrel (Falco sparverius), Blue-winged Teal (Anas discors), Mexican Jacana (Jacana spinosa), Elegant Trogan (Trogan elegans), Summer Tanager (Piranga rubra), White-tailed Hawk (Buteo albicaudatus), Merlin (Falco columbarius), Plain-capped Starthroat (Heliomaster constantii), Painted Bunting (Passerina ciris) and Wood Stork (Mycteria americana).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Belizean Pine Forests Habitat

This species is found in the Belizean pine forests along the Central America's northwestern Caribbean Sea coast; the ecoregion exhibits relatively well preserved fragments of vegetation as well as a considerable abundance of fauna. This ecoregion comprises a geographically small portion of the total land area of the ecoregions of Belize. There is relatively low endemism in the Belizean pine forests, and only a moderate species richness here; for example, only 447 vertebrate taxa have been recorded in the ecoregion. The ecoregion represents one of the few examples of lowland and premontane pine forests in the Neotropics, where the dominant tree species is Honduran Pine (Pinus caribaea var. hondurensis), which requires periodic low intensity burns for its regeneration. The vegetation is adapted to the xeric, acidic and nutrient-poor conditions that occur primarily in the dry season.

In the forest of the Maya Mountains, vegetation reaches higher altitudes, the topography is more rugged and crossed by various rivers, and nighttime temperatures are lower. The pine trees are larger and numerous, and the pine forest intersects other formations of interest such as rainforest, Cohune Palm (corozal), cactus associations, and others. About eleven percent of Belize is covered by natural pine vegetation. Only two percent represents totally closed forests; three percent semi-closed forests; and the remaining six percent pine savannas, that occupy coastal areas and contain isolated pine trees or stands of pine trees separated by extensive pastures. In addition to human activity, edaphic factors are a determining matter in this distribution, since the forests on the northern plain and southern coastal zone are on sandy soils or sandy-clay soils and usually have less drainage than the more fertile soils in the center of the country.

At elevations of 650 to 700 metres, the forests transition to premontane in terms of vegetation. At these higher levels, representative tree species are Egg-cone Pine (Pinus oocarpa), which crosses with Honduras Pine (P. hondurensis), where distributions overlap, although belonging to subsections of different genera; British Honduras Yellowwood (Podocarpus guatemalensis)  and Quercus spp.; moreover, and in even more moist areas there is a predominance of Jelecote Pine (Pinus patula), together with the palm Euterpe precatoria var. longivaginata and the arboreal ferns Cyathea myosuroides and Hemitelia multiflora.

A number of reptilian species are found in the Belizean pine forests, including: Guatemala Neckband Snake (Scaphiodontophis annulatus); Indigo Snake (Drymarchon corais); On the coasts, interior lakes and rivers of Belize and by extension in this ecoregion there are two species of threatened crocodiles: American Crocodile (Crocodylus acutus) and Morelet's Crocodile (C. moreletii), while observation of the Central American River Turtle (Dermatemys mawii CR) is not uncommon in this ecoregion.

Also to be noted is the use of this habitat by the Mexican Black Howler (Alouatta pigra), which can be considered the most endangered howler monkey of the genus, and the Central American spider monkey (Atteles geoffroyi). Both species experienced a decline due to the epidemic yellow fever that swept the country in the 1950s. The five feline species that exist in Belize: Jaguar (Panthera onca), Puma (F. concolor), Ocelot (Leopardus pardalis), Margay (Leopardus wiedii) and Jaguarundí (Herpailurus yagouaroundi) are in appendix I of CITES, as well as the Central American tapir (Tapirus bairdii) can been seen with relative frequency. Belize has the highest density of felines in Central America. The tapir is abundant around rivers. The White-lipped Peccary (Tayassu pecari) is also present in the ecoregion.

Although most of the amphibians and reptiles are found in humid premontane and lowland forests, the only endemic frog in this ecoregion, Maya Mountains Frog (Lithobates juliani), is restricted to the Mountain Pine Ridge in the Maya Mountains. Salamanders in the ecoregion are represented by the Alta Verapaz Salamander (Bolitoglossa dofleini NT), whose males are arboreal, while females live under logs. Anuran taxa found in the ecoregion include: Rio Grande Frog (Lithobates berlandieri); Sabinal Frog (Leptodactylus melanonotus); Northern Sheep Frog (Hypopachus variolosus); Stauffer's Long-nosed Treefrog (Scinax staufferi); and Tungara Treefrog (Engystomops pustulosus).

Present in the ecoregion are a number of avian species, including the endangered Yellow-headed Amazon Parrot (Amazona oratrix EN), although this bird is adversely affected by ongoing habitat destruction.  Of particular interest is the presence in this ecoregion of Central America's highest procreative colony of Jabiru (Jabiru mycteria), a large migratory bird, particularly in the Crooked Tree sanctuary, on the country's northern plains.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Now associated generally with mountainous or remote undisturbed areas. May occupy wide variety of habitats: swamps, riparian woodlands, broken country with good cover of brush or woodland. Beier (1993) determined that habitat areas of at least 2200 sq km are needed to ensure long-term population persistence; protection of corridors for immigration is highly desirable. Young are born in secluded places among rocks or dense vegetation (e.g., see Beier et al. 1995, Bleich et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species is found in a broad range of habitats, in all forest types as well as lowland and montane desert. Several studies have shown that habitat with dense understory vegetation is preferred, however, pumas can live in very open habitats with only a minimum of vegetative cover (Nowell and Jackson 1996). Pumas co-occur with jaguars in much of their Latin American range, and may favor more open habitats than their larger competitor, although both can be found in dense forest (Sunquist and Sunquist 2002).

Pumas are capable of taking large prey, but when available small to medium-sized prey are more important in their diet (in tropical portions of the range). This is true of wild prey as well as livestock (IUCN Cats Red List workshop, 2007). In North America, deer make up 60-80% of the puma's diet, and the mean weight of prey taken is 39-48 kg. In Florida, however, where deer numbers are low, pumas take smaller prey including feral pigs, raccoons and armadilllos, and deer account for only about 1/3 of the diet (Sunquist and Sunquist 2002).

Home range sizes of pumas vary considerably across their geographic distribution, and the smallest ranges tend to occur in areas where prey densities are high and prey are not migratory (Sunquist and Sunquist 2002). In North America, home range sizes ranged from 32-1,031 km² (Lindzey et al. 1987).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mountain lions use a wide variety of habitats including montane coniferous forests, lowland tropical forests, grassland, dry brush country, swamps, and any areas with adequate cover and prey. Dense vegetation, caves, and rocky crevices provide shelter.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the term: cover

Stalking cover - The best stalking cover for mountain lions is thick
enough for mountain lions to remain hidden, and sparse enough for them
to see their prey [20]. Mountain lions commonly use terrain such as
steep canyons, rock outcroppings, and boulders, or vegetation such as
dense brush and thickets to remain hidden while stalking [3,20].

Protective cover - Dense vegetation or piles of boulders are often
selected as den sites to help protect kittens from harsh weather and
predators [20,32].
  • 3. Belden, Robert C. 1988. The Florida panther. In: Audubon Wildlife Report: 515-532. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24557]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 32. Maehr, D. S. 1990. Florida panther research: Florida panther recovery plan implementation: Florida panther movements, social organization and habitat utilization. Final performance report. Tallahassee, FL: Florida Game and Fresh Water Fish Commission. 165 p. [24574]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, density, shrubs

Mountain lion habitat is essentially the same as that of their primary
prey. Within this habitat, mountain lions tend to prefer rocky cliffs,
ledges, vegetated ridgetops, or other areas that provide cover for
undetected surveillance of prey [46,56]. Stream courses and ridgetops
are frequently used as travel corridors and hunting routes. Riparian
vegetation along streams provides cover for mountain lions traveling in
open areas [46].

Florida panthers generally inhabit ecotones and subtropical, dense
forests in low-lying swampy areas composed mainly of trees, shrubs, and
vines. They also occur in pine forests [20,53]. In Everglades National
Park, edge habitat provides good forage and cover for white-tailed deer
(Odocoileus virginianus), which in turn may attract Florida panthers
[20].

In the Frank Church River of No Return Wilderness, Idaho, mountain lions
preferred steep, rocky areas covered with "dense" Douglas-fir and
ponderosa pine mixed with sagebrush and grassland. Mountain lions
avoided crossing large open areas with sparse cover, preferring to
travel around perimeters [20,43]. In the Bighorn Mountains of northern
Wyoming, mountain lions frequented canyons with steep, rugged slopes (>
45 deg). Areas with gentle slopes (< 20 deg) were generally avoided
[31].

Den sites - In rough terrain mountain lion dens are usually located in a
shallow nook on the face of a cliff or rock outcrop. In less
mountainous areas dens are located in dense thickets or under fallen
logs. Little bedding is used in dens. Females may use the same den for
several years [56]. A radio-collared female Florida panther chose the
same large sawpalmetto thicket surrounded by hammock and freshwater
marsh for her den in 1986 and 1988 [34].

Home range - The home range consists of a first-order home area, used
primarily for resting, and a much larger area used for hunting [56].
Home ranges are maintained by resident mountain lions but not transient
mountain lions [56]. Mountain lions are capable of covering large
distances in short periods of time [30].

Home range size varies by sex and age of the mountain lion, season, and
spatial distribution and density of prey [20,30,43,56]. Home ranges as
large as 196 square miles (510 sq. km) and as small as 25 square miles
(65 sq. km) have been reported. Resident male mountain lion home ranges
are typically larger than those of females and overlap a number of
female home ranges, but only occasionally overlap those of other
resident males. Mean home range for resident male Florida panthers is
between 168 and 196 square miles (437-510 sq. km); for resident females
it is between 68 and 74 square miles (177-192 sq. km) [34]. Home ranges
of resident females commonly overlap, but females avoid each other in
the areas of overlap [20,30,56]. Female mountain lions probably select
areas with relatively high prey densities. Male home ranges may reflect
the density and distribution of females [34].

Mountain lions move from summer range to winter range in areas where
their main prey congregates during the winter [10,30,37]. The smallest
documented home ranges appear to occur in areas where deer (Odocoileus
spp.) do not exhibit seasonal movements [30]. Seasonal and sex
differences in home range size were reported by Seidensticker and others
[43] on the Frank Church River of No Return Wilderness.
  • 10. Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; [and others]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 30. Lindzey, Frederick. 1987. Mountain lion. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 656-668. [24560]
  • 31. Logan, Kenneth A.; Irwin, Larry L. 1985. Mountain lion habitats in the Big Horn Mountains, Wyoming. Wildlife Society Bulletin. 13: 257-262. [4526]
  • 34. Maehr, David S. 1992. Florida panther: Felis concolor coryi. In: Humphrey, Stephen R., ed. Rare and endangered biota of Florida. Mammals: Volume 1. Naples, FL: Florida Game and Fresh Water Fish Commission: 176-189. [21069]
  • 37. McCarthy, John; Williams, Jim. 1995. Cougar. Montana Outdoors. 26(2): 24-28. [24573]
  • 43. Seidensticker, J. C., IV; Hornocker, M. G.; Wiles, W. V.; Messick, J. P. 1973. Mountain lion social organization in the Idaho Primitive Area. Wildlife Monograph No. 35. 66 p. [17589]
  • 46. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 53. Lowe, David W.; Matthews, John R.; Moseley, Charles J. 1990. The official World Wildlife Fund guide to endangered species of North America. Volume 1. Plants: Mammals. Washington, DC: Beacham Publishing, Inc. 556 p. [+ appendices]
  • 56. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the terms: cover, shrub, swamp

Mountain lions occupy a wide variety of plant communities. They are
found in montane coniferous forests, lowland tropical forests, swamps,
grasslands, dry brushlands, and any other area with adequate cover and
prey [16,20,31,46,56]. Typical mountain lion habitat in western North
America is open woodland such as oak (Quercus spp.) scrub, pinyon (Pinus
spp.), juniper (Juniperus spp.), curlleaf mountain-mahogany (Cercocarpus
ledifolius), snowbrush ceanothus (Ceanothus velutinus), and manzanita
(Arctostaphylos spp.) communities [56].

Logan and Irwin [31] investigated habitat use by mountain lions in the
Bighorn Mountains, Wyoming, and found that mixed conifer and curlleaf
mountain-mahogany communities were preferred. In southern Utah mountain
lion habitat consists of desert shrub and sagebrush (Artemisia
spp.)-grassland communities at lower elevations (4,445 to 5,940 feet
[1,330-1,780 m]). Mountain lions also occupy pinyon-juniper woodlands,
Gambel oak (Q. gambelii) scrub, open ponderosa pine (Pinus ponderosa)
forests which dominate at mid-elevations (5,940 to 8,910 feet
[1,780-2,670 m]) [20,46], and higher elevation stands of quaking aspen
(Populus tremuloides), Engelmann spruce (Picea engelmannii), or white
fir (Abies concolor) interspersed with subalpine meadows. Mountain
lions also inhabit deep, rocky, vertical-walled river canyons containing
riparian vegetation including Fremont cottonwood (P. fremontii) and
willows (Salix spp.) [46].

In the Idaho Primitive Area, mountain lion habitat consists of Engelmann
spruce-subalpine fir (Abies lasiocarpa) and ponderosa pine-Douglas-fir
(Pseudotsuga menziesii) associations at higher elevations. At lower
elevations mountain lions inhabit curlleaf mountain-mahogany, antelope
bitterbrush (Purshia tridentata), and big sagebrush (A.
tridentata)-bunchgrass associations [46].

In California mountain lions occur primarily between 1,980 and 5,940
feet (590-1,780 m) in mixed conifer and brush habitats. Mountain lions
are rare at higher elevations in pure stands of conifers and at lower
elevations in pure stands of chamise (Adenostoma fasciculatum) [46]. In
New Mexico mountain lions commonly occur in pinyon-juniper plant
communities [25].

Florida panthers inhabit most types of vegetation in southern Florida
including tropical hammocks, pine flatwoods, cabbage palmetto (Sabal
palmetto), mixed swamps, baldcypress (Taxodium distichum) swamps, live
oak (Q. virginiana) hammocks, sawgrass (Cladium jamaicense) marshes, and
Brazilian peppertree (Schinus terebinthifolia) thickets [4,14,28,34].
Belden and others [4] found that Florida panthers used mixed swamp
forests and hammock forests more than expected based on the availability
of these habitats within their home range. Day-use sites typically are
dense patches of saw palmetto (Serenoa repens) surrounded by swamp, pine
flatwoods, or hammocks. Open agricultural lands are common around most
publicly owned land in southern Florida and receive some use by Florida
panthers if cover nearby is adequate [14,34].

REFERENCES :
NO-ENTRY
  • 4. Belden, Robert C.; Frankenberger, William B.; McBride, Roy T.; Schwikert, Stephen T. 1988. Panther habitat use in southern Florida. Journal of Wildlife Management. 52(4): 660-663. [24564]
  • 14. Ewel, Katherine C. 1990. Swamps. In: Myers, Ronald L.; Ewel, John J., eds. Ecosystems of Florida. Orlando, FL: University of Central Florida Press: 281-322. [17392]
  • 16. Florida Panther Interagency Committee. 1987. Florida panther (Felis concolor coryi). Revised Recovery Plan. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 75 p. [24575]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 25. Howard, Volney W., Jr. 1988. Importance of pinyon-juniper woodlands to wildlife. In: Fisher, James T.; Mexal, John G.; Pieper, Rex D., tech. coords. Pinyon-juniper woodlands of New Mexico: a biological and economic appraisal. Special Report 73. Las Cruces, NM: New Mexico State University, College of Agriculture and Home Economics, Agricultural Experiment Station: 45-47. [5775]
  • 28. Kushlan, James A. 1990. Freshwater marshes. In: Myers, Ronald L.; Ewel, John J., eds. Ecosystems of Florida. Orlando, FL: University of Central Florida Press: 324-363. [17393]
  • 31. Logan, Kenneth A.; Irwin, Larry L. 1985. Mountain lion habitats in the Big Horn Mountains, Wyoming. Wildlife Society Bulletin. 13: 257-262. [4526]
  • 34. Maehr, David S. 1992. Florida panther: Felis concolor coryi. In: Humphrey, Stephen R., ed. Rare and endangered biota of Florida. Mammals: Volume 1. Naples, FL: Florida Game and Fresh Water Fish Commission: 176-189. [21069]
  • 46. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 56. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: association, forb, marsh, shrub

104 Antelope bitterbrush-bluebunch wheatgrass
105 Antelope bitterbrush-Idaho fescue
107 Western juniper/big sagebrush/bluebunch wheatgrass
108 Alpine Idaho fescue
109 Ponderosa pine shrubland
110 Ponderosa pine-grassland
201 Blue oak woodland
202 Coast live oak woodland
203 Riparian woodland
204 North coastal shrub
205 Coastal sage shrub
206 Chamise chaparral
207 Scrub oak mixed chaparral
208 Ceanothus mixed chaparral
209 Montane shrubland
210 Bitterbrush
212 Blackbush
213 Alpine grassland
216 Montane meadows
217 Wetlands
314 Big sagebrush-bluebunch wheatgrass
315 Big sagebrush-Idaho fescue
316 Big sagebrush-rough fescue
317 Bitterbrush-bluebunch wheatgrass
318 Bitterbrush-Idaho fescue
319 Bitterbrush-rough fescue
320 Black sagebrush-bluebunch wheatgrass
321 Black sagebrush-Idaho fescue
322 Curlleaf mountain-mahogany-bluebunch wheatgrass
401 Basin big sagebrush
402 Mountain big sagebrush
403 Wyoming big sagebrush
404 Threetip sagebrush
405 Black sagebrush
406 Low sagebrush
407 Stiff sagebrush
408 Other sagebrush types
409 Tall forb
411 Aspen woodland
413 Gambel oak
415 Curlleaf mountain-mahogany
416 True mountain-mahogany
417 Littleleaf mountain-mahogany
418 Bigtooth maple
419 Bittercherry
420 Snowbrush
421 Chokecherry-serviceberry-rose
422 Riparian
502 Grama-galleta
203 Riparian woodland
503 Arizona chaparral
504 Juniper-pinyon pine woodland
505 Grama-tobosa shrub
509 Transition between oak-juniper woodland and mahogany-oak association
612 Sagebrush-grass
730 Sand shinnery oak
733 Juniper-oak
735 Sideoats grama-sumac-juniper
818 Florida salt marsh
819 Freshwater marsh and ponds
822 Slough

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: shrub

K002 Cedar-hemlock-Douglas-fir forest
K003 Silver fir-Douglas-fir forest
K004 Fir-hemlock forest
K005 Mixed conifer forest
K006 Redwood forest
K008 Lodgepole pine-subalpine forest
K009 Pine-cypress forest
K010 Ponderosa shrub forest
K011 Western ponderosa forest
K012 Douglas-fir forest
K013 Cedar-hemlock-pine forest
K014 Grand fir-Douglas-fir forest
K015 Western spruce-fir forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine-Douglas-fir forest
K019 Arizona pine forest
K020 Spruce-fir-Douglas-fir forest
K021 Southwestern spruce-fir forest
K022 Great Basin pine forest
K023 Juniper-pinyon woodland
K024 Juniper steppe woodland
K025 Alder-ash forest
K026 Oregon oakwoods
K028 Mosaic of K002 and K026
K027 Mesquite bosque
K029 California mixed evergreen forest
K030 California oakwoods
K031 Oak-juniper woodlands
K032 Transition between K031 and K037
K033 Chaparral
K034 Montane chaparral
K035 Coastal sagebrush
K036 Mosaic of K030 and K035
K038 Great Basin sagebrush
K039 Blackbrush
K040 Saltbush-greasewood
K041 Creosotebush
K042 Creosotebush-bursage
K043 Paloverde-cactus shrub
K044 Creosotebush-tarbush
K049 Tule marshes
K052 Alpine meadows and barren
K055 Sagebrush steppe
K056 Wheatgrass-needlegrass shrubsteppe
K058 Grama-tobosa shrubsteppe
K059 Trans-Pecos shrub savanna
K079 Palmetto prairie
K081 Oak savanna
K092 Everglades
K071 Shinnery

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES29 Sagebrush
FRES30 Desert shrub
FRES31 Shinnery
FRES32 Texas savanna
FRES33 Southwestern shrubsteppe
FRES34 Chaparral-mountain shrub
FRES35 Pinyon-juniper
FRES37 Mountain meadows
FRES41 Wet grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

67 Mohrs (shin) oak
201 White spruce
202 White spruce-paper birch
203 Balsam poplar
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce-subalpine fir
207 Red fir
208 Whitebark pine
209 Bristlecone pine
210 Interior Douglas-fir
211 White fir
212 Western larch
213 Grand fir
215 Western white pine
216 Blue spruce
217 Aspen
218 Lodgepole pine
219 Limber pine
220 Rocky Mountain juniper
221 Red alder
222 Black cottonwood-willow
223 Sitka spruce
224 Western hemlock
225 Western hemlock-Sitka spruce
226 Coastal true fir-hemlock
227 Western redcedar-western hemlock
228 Western redcedar
229 Pacific Douglas-fir
230 Douglas-fir-western hemlock
231 Port-Orford-cedar
233 Oregon white oak
234 Douglas-fir-tanoak-Pacific madrone
235 Cottonwood-willow
236 Bur oak
237 Interior ponderosa pine
238 Western juniper
239 Pinyon-juniper
240 Arizona cypress
241 Western live oak
243 Sierra Nevada mixed conifer
244 Pacific ponderosa pine-Douglas-fir
245 Pacific ponderosa pine
246 California black oak
247 Jeffrey pine
248 Knobcone pine
249 Canyon live oak
250 Blue oak-foothills pine
251 White spruce-aspen
252 Paper birch
253 Black spruce-white spruce
254 Black spruce-paper birch
255 California coast live oak
256 California mixed subalpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mountain lions use a wide variety of habitats including montane coniferous forests, lowland tropical forests, grassland, dry brush country, swamps, and any areas with adequate cover and prey. Dense vegetation, caves, and rocky crevices provide shelter.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The puma is highly adaptable, found in a diverse range of habitats, from arid desert to tropical rainforest to cold coniferous forest, from sea level up to 5,800 metres in the Andes (3) (5). Studies have shown that habitat with dense understorey vegetation is preferred, but these cats can also live in open areas with sparse vegetative cover (3). Although terrestrial, pumas can swim and climb trees when they need to (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In Idaho, migrates between fairly distinct but usually contiguous winter-spring and summer-fall home areas (Seidensticker et al. 1973). In California, some lions migrated together, often slowly, following movements of mule deer, between winter and summer ranges; other lions migrated quickly, crossed the Sierra Nevada crest, and summered in a disjunct range with lions not sharing their winter range (Pierce et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Primary food is deer in many areas. Highly opportunistic, also eats various large and small mammals (bighorn sheep, livestock, coyote, squirrels, rabbits, mice, etc.), insects, and reptiles. In Peru and Chile, rodents and lagomorphs, respectively, were important prey (see Hansen 1992). Unused remains of prey are covered for later consumption. Stalks prey from ground. In southern California, on average, an adult killed about 48 large and 58 small mammals per year and fed for an average of 2.9 days on a single large mammal (Beier et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mountain lions are carnivores. Their main prey throughout their range are different species of deer and their relatives, including Alces alces, Cervus elaphus, Odocoileus virginianus, Odocoileus hemionus, and Rangifer tarandus in North America. They will also eat smaller creatures like Sciuridae, Ondatra zibethicus, Erethizon dorsatum, Castor canadensis, Procyon lotor, Mephitis mephitis, Canis latrans, Lynx rufus, other mountain lions, Leporidae, Didelphis virginianus, Aves, and even snails and fish. They may also prey on domestic livestock, including poultry, calves, sheep, goats, and pigs. Mountain lions have a distinctive manner of hunting larger prey. The lion quietly stalks the prey animals, then leaps at close range onto their back and breaks the animal's neck with a powerful bite below the base of the skull. Yearly food consumption is between 860 to 1,300 kg of large prey animals, about 48 deer-sized animals per lion per year. Mountain lions store large prey, dragging it up to 350 meters from the place of capture and burying it under leaves and debris. They return nightly to feed.

Animal Foods: birds; mammals; fish; mollusks

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the term: dispersion

In North America mountain lions feed primarily on large ungulate
species. Small mammals are also eaten depending on local abundance
[10,20,34,56]. Occasionally, grass and carrion are eaten [1]. The main
prey seems to be a function of abundance [10,12]. Composition of the
diet may shift seasonally, reflecting the adundance and availability of
small prey and the dispersion of large prey such as deer and elk (Cervus
elaphus) [30].

Deer dominate the diet of mountain lions in most areas [30]. In the
western United States, mule deer (Odocoileus hemionus) are the major
prey species. Other prey species include white-tailed deer, elk, moose
(Alces alces), bighorn sheep (Ovis canadensis), porcupines (Erthizon
dorsatum), American beavers (Castor canadensis), snowshoe hares (Lepus
californicus), ground squirrels (Citellus spp.), marmots (Marmota spp.),
smaller rodents (Rodentia), other carnivores, and domestic livestock
[9,30]. Porcupines are a preferred food item wherever they occur in
mountain lion range [56]. In most temperate regions, small mammals
represent a minor part of the diet and probably are taken
opportunistically.

In British Columbia moose comprised a large portion of diet of mountain
lions, as did snowshoe hares during a peak snowshoe hare population
[56]. In the Cascade Range of Oregon, black-tailed deer (Odocoileus
hemionus columbianus) were the most important prey item in the mountain
lion diet. Domestic sheep (Ovis aries), porcupines, and a variety of
small mammals were also recorded [48]. In the southwestern United
States, collared peccary (Pecari angulatus) can be an important part of
the mountain lion diet [56].

In Florida, Florida panthers commonly prey on feral pigs (Sus scrofa),
raccoons (Procyon lotor), and nine-banded armadillos (Dasypus
novemcinctus) in addition to white-tailed deer [16,32,34]. In
southwestern Florida from 1977 through 1989, 270 scat samples indicated
that feral pigs were the most common prey species followed by
white-tailed deer, raccoons, and armadillos [32]. The most important
food items, based on contents of six Florida panther stomachs, were
armadillos and white-tailed deer. All of the stomachs also contained 3
to 8 grams of grass. Another study in southern Florida found
white-tailed deer in 46 percent of Florida panther scat, rabbits
(Sylvilagus spp.) in 31 percent, cotton rats (Sigmodon hispidus) in 20
percent, feral pigs in 15 percent, raccoons in 11 percent, armadillos in
7 percent, and birds (Aves) in 3 percent [5].
  • 1. Anderson, Allen E. 1983. A critical review of literature on puma (Felis concolor). Special Report No. 54. Project No.: CO W-126-4; Co W-144-R. Fort Collins, CO: Colorado Division of Wildlife. 91 p. [24576]
  • 5. Belden, Robert C. 1986. Florida panther recovery plan implementation--a 1983 progress report. In: Miller, S. Douglas; Everett, Daniel D., eds. Cats of the world: biology, conservation and management. [Place of publication unknown]
  • 9. Boyd, Diane; O'Gara, Bart. 1985. Cougar predation on coyotes. Murrelet. 66: 17-19. [24563]
  • 10. Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; [and others]
  • 12. Currier, Mary Jean P. 1983. Felis concolor. Mammalian Species No. 200: 1-7. [24559]
  • 16. Florida Panther Interagency Committee. 1987. Florida panther (Felis concolor coryi). Revised Recovery Plan. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 75 p. [24575]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 30. Lindzey, Frederick. 1987. Mountain lion. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 656-668. [24560]
  • 32. Maehr, D. S. 1990. Florida panther research: Florida panther recovery plan implementation: Florida panther movements, social organization and habitat utilization. Final performance report. Tallahassee, FL: Florida Game and Fresh Water Fish Commission. 165 p. [24574]
  • 34. Maehr, David S. 1992. Florida panther: Felis concolor coryi. In: Humphrey, Stephen R., ed. Rare and endangered biota of Florida. Mammals: Volume 1. Naples, FL: Florida Game and Fresh Water Fish Commission: 176-189. [21069]
  • 48. Toweill, Dale E.; Maser, Chris. 1985. Food of cougars in the Cascade Range of Oregon. Great Basin Naturalist. 45(1): 77-80. [24562]
  • 56. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mountain lions are carnivores. Their main prey throughout their range are different species of ungulates, including moose, elk, white-tailed deer, mule deer, and caribou in North America. They will also eat smaller creatures like squirrels, muskrat, porcupine, beaver, raccoon, striped skunk, coyote, bobcats, other mountain lions, rabbits, opossums, birds, and even snails and fish. They may also prey on domestic livestock, including poultry, calves, sheep, goats, and pigs. Mountain lions have a distinctive manner of hunting larger prey. The lion quietly stalks the prey animals, then leaps at close range onto their back and breaks the animal's neck with a powerful bite below the base of the skull. Yearly food consumption is between 860 to 1,300 kg of large prey animals, about 48 ungulates per lion per year. Mountain lions cache large prey, dragging it up to 350 meters from the place of capture and burying it under leaves and debris. They return nightly to feed.

Animal Foods: birds; mammals; fish; mollusks

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Mountain lions are important as top predators in the ecosystems in which they live. They are instrumental in controlling populations of large ungulates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mountain lions are top predators. They may be preyed on by other mountain lions, wolves, or bear when they are young or ill.

Known Predators:

  • mountain lions (Puma_concolor)
  • gray wolves (Canis_lupus)
  • bears (Ursidae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Biologists working near the North Fork of the Flathead River, Montana,
have reported gray wolves (Canis lupus) killing mountain lions as well
as driving them from prey [37]. Adult male mountain lions are known to
kill mountain lion kittens and sometimes eat them [12,30,56]. Adult
female mountain lions are occasionally killed by other mountain lions
[30].
  • 12. Currier, Mary Jean P. 1983. Felis concolor. Mammalian Species No. 200: 1-7. [24559]
  • 30. Lindzey, Frederick. 1987. Mountain lion. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 656-668. [24560]
  • 37. McCarthy, John; Williams, Jim. 1995. Cougar. Montana Outdoors. 26(2): 24-28. [24573]
  • 56. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Mountain lions are important as top predators in the ecosystems in which they live. They are instrumental in controlling populations of large ungulates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mountain lions are top predators. They may be preyed on by other mountain lions, wolves, or bear when they are young or ill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Puma concolor is prey of:
Ursidae
Canis lupus
Puma concolor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Puma concolor preys on:
Erethizontidae
Equus caballus
Odocoileus
Actinopterygii
Mollusca
Aves
Mammalia
Ursus americanus
Nasua nasua
Vulpes vulpes
Cervus elaphus
Odocoileus virginianus
Puma concolor
Mazama gouazoupira
Myrmecophaga tridactyla

Based on studies in:
USA: Arizona (Forest, Montane)

This list may not be complete but is based on published studies.
  • D. I. Rasmussen, Biotic communities of Kaibab Plateau, Arizona, Ecol. Monogr. 11(3):228-275, from p. 261 (1941).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total U.S. population was stated as 15,000 by Nowak (1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Primarily solitary in some areas, extensive overlap of home ranges in other areas (see Pierce et al. 1999). In Idaho, mutual avoidance maintains density of breeding adults below level set by food supply.

Annual home range varies greatly in different areas (13-1454 sq km); home range of male (generally 200 to several hundred sq km) averages larger than that of female (Kitchener 1991; Pierce et al. 1999; see also Hansen 1992 for interstate comparisons of home range size). See Beier et al. (1995) for information on movements in the Santa Ana Mountains, southern California. See Laing and Lindzey (1993, J. Mamm. 74:1056-1058) for information on replacement of individuals on vacated home ranges in Utah.

Density usually not greater than 3-4 adults per 100 sq km (8-10 per 100 sq mi) (Kitchener 1991).

Annual mortality rate in an unhunted population in Utah was 26%, over 50% in resident adults in a hunted population in Montana (see Hansen 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

Mountain lion habitat can be enhanced or expanded by fires that improve
habitat for prey species [42,54]. Preferred forage for deer is
generally more productive and easily accessible following fire.
Frequent fire over large areas maintains many stands in a successional
stage favorable to deer. Deer populations commonly increase
dramatically following forest fire, provided 40 percent or more escape
cover remains after the burn [54]. Mountain lion numbers increased
after fire in a western redcedar (Thuja plicata)-western hemlock (Tsuga
heteropylla) forest in British Columbia. This increase may have been
related to an increase in mule deer populations. Mountain lions became
so common that one hunter killed 18 during one season where a few years
previous it was unusual to even see mountain lion tracks [13]. In
California chaparral communities, mountain lions are attracted to the
edges of recent burns where deer tend to congregate [29].

During the late 1940's and early 1950's, logging and wildfires in the
pines and cypress of Florida provided ideal habitat for white-tailed
deer, and their numbers increased until the forest canopy began closing
over in the mid-1960's. Florida panther populations also increased
during this period [20].

Mountain lions may change their home range in response to fire. The
activities of eight radio-tagged mountain lions were monitored during
and after the 1988 fire season in Yellowstone National Park. After the
fire season, two adult mountain lions and two kittens showed pronounced
changes in their home ranges. A comparison of home ranges of three
adult mountain lions from winter 1987 through 1989 showed that each
individual is presently using a different area. The changes may have
been due to fire; however, differences in snow accumulations,
temperature, drought, and distribution of prey animals could also
account for the new patterns. Eleven percent of the radio-locations of
the eight radio-tagged mountion lions have occurred in burned habitat.
Eleven percent of the mountain lion prey has been captured in burned
areas [38].

For more information concerning fire effects on species of mountain lion
prey (i.e., mule deer, elk, white-tailed deer, and moose) refer to
write-ups on these species in the Fire Effects Information System.
  • 13. Edwards, R. Y. 1954. Fire and the decline of a mountain caribou herd. Journal of Wildlife Management. 18(4): 521-526. [8394]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 29. Quinn, Ronald D. 1990. Habitat preferences and distribution of mammals in California chaparral. Res. Pap. PSW-202. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station. 11 p. [15761]
  • 38. Mills, Susan M., editor. 1989. The Greater Yellowstone postfire assessment. [Denver, CO]
  • 42. Schortemeyer, James L.; Maehr, David S.; McCown, J. Walter; [and others]
  • 54. Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States and southern Canada. New York: John Wiley & Sons. 501 p. [2620]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: litter, polygamous

Breeding season - Mountain lions are polygamous. They are capable of
breeding throughout the year, and successful litters can be produced any
month of the year [56]. However, there is generally a peak in litter
production during the summer [1,56]. The estrous cycle lasts
approximately 23 days, with estrus usually lasting 8 days. However,
periods of estrus lasting up to 11 days have been reported [56].
Mountain lions are generally solitary except during the breeding season
and when the female is raising young [10].

The breeding season of Florida panthers starts in October and continues
through April, with the majority of conceptions occurring from November
to March. Over half of the births occurring during the period form
April through August [3].

Age at sexual maturity - Mountain lions first breed when they are 2 to 3
years old [10,56,51]. Females born during the summer generally first
breed during the winter following their second birthday [20,56].
Females usually do not breed until they have established a home range
[20]. The earliest published instance of first reproduction in the
Florida panther was an 18- to 19-month-old female that raised four
kittens in her mother's home range. Male Florida panthers appear to
reach sexual maturity after 3 years of age [3].

Gestation and litter size - Following a gestation period of 82 to 98
days (90-98 days for Florida panthers), a litter of one to six young is
produced, with a mean of 2.67 [1,3,10,20,30]. Florida panther litter
sizes range from one to four kittens [3]. Female mountain lions may
produce only one kitten in their first litter [30]. A litter may be
produced every year under "optimal conditions" [56], but usually one
litter is produced every other year or at 3-year intervals [3,56]. If
the female loses her kittens to predators or other circumstances, she
may breed again soon after the loss [20].

Growth of young - Kittens begin nursing within minutes after birth and
gain weight rapidly. Males usually grow faster than females. At 2
weeks of age, eyes and ears are open, and kittens are able to walk. In
10 to 20 days kittens may weigh over 2 pounds. The female leads kittens
to kills when they are 7 to 8 weeks old [20]. The kittens are weaned
when they are 2 to 3 months old. Kittens can survive on their own at 6
months of age, but they typically remain with their mother until they
are 1 to 2 years old [1,20,30,56]. Siblings sometimes disperse as a
group and may remain together for 3 months or longer [37].

Longevity - The maximum longevity of wild mountain lions is unknown.
Once established on home ranges, mountain lions may live 12 to 13 years
[12,37]. There is evidence of a 15- to 18-year life span in the wild
for Florida panthers, but 8 to 12 years is considered old [3]. Three
captive male mountain lions lived at least 12, 15, and 18 years, and one
female lived at least 10 years. A 9-year average and a 20-year maximum
lifespan have been reported for captive mountain lions [1,12].
  • 1. Anderson, Allen E. 1983. A critical review of literature on puma (Felis concolor). Special Report No. 54. Project No.: CO W-126-4; Co W-144-R. Fort Collins, CO: Colorado Division of Wildlife. 91 p. [24576]
  • 3. Belden, Robert C. 1988. The Florida panther. In: Audubon Wildlife Report: 515-532. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24557]
  • 10. Clark, Tim W.; Harvey, Ann H.; Dorn, Robert D.; [and others]
  • 12. Currier, Mary Jean P. 1983. Felis concolor. Mammalian Species No. 200: 1-7. [24559]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 30. Lindzey, Frederick. 1987. Mountain lion. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 656-668. [24560]
  • 37. McCarthy, John; Williams, Jim. 1995. Cougar. Montana Outdoors. 26(2): 24-28. [24573]
  • 51. Van Gelden, Richard George. 1982. Mammals of the National Parks. Baltimore, MD: Johns Hopkins University Press. 310 p. [20893]
  • 56. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Mountain lions rely mainly on vision, smell, and hearing. They use low-pitched hisses, growls, purrs, yowls, and screams in different circumstances. Loud, chirping whistles by young serves to call the mother. Touch is important in social bonding between mother and young. Scent marking is important in advertising territory boundaries and willingness to mate.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Mountain lions rely mainly on vision, smell, and hearing. They use low-pitched hisses, growls, purrs, yowls, and screams in different circumstances. Loud, chirping whistles by young serves to call the mother. Touch is important in social bonding between mother and young. Scent marking is important in advertising territory boundaries and reproductive state.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year. Active any time, day or night, but most hunting occurs dawn or dusk (Jones et al. 1983). Peak activity within 2 hours of sunset and sunrise in absence of human disturbance; near human presence, activity peaks after sunset.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Mountain lions may live up to 18 to 20 years in the wild. They can live slightly longer in captivity.

Typical lifespan

Status: wild:
18 to 20 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Mountain lions may live up to 18 to 20 years in the wild. They can live slightly longer in captivity.

Typical lifespan

Status: wild:
18 to 20 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.8 years (captivity) Observations: In the wild, these animals have been estimated to live up to 18 years (Bernhard Grzimek 1990). One captive specimen was still alive at 23.8 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Gestation lasts about 82-100 days. In the Northern Hemisphere most births occur in April-September, may occur throughout the year in Arizona. Litter size is 1-6 (usually 2-3). Young are weaned after 2-3 months. First reproduction usually occurs at 2-3 years. Young remain with mother for 1-2 years. Usually 2 years between litters (sometimes 1 year if litter does not survive). In the wild, probably few live beyond 10 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males maintain territories that overlap with those of several females. They attempt to dominate matings with those females.

Mountain lions begin mating when they have established their own territory. Females make sounds and rub themselves against objects to advertise to local males that they are ready to mate.

Mating System: polygynous

Mating occurs throughout the year, but is concentrated from December to March in northern parts of their range. Females are pregnant for 82 to 96 days and give birth to 1 to 6 kittens, with an average of 3. Kittens weigh 226 to 453 grams at birth, their eyes and ears are closed and they have no teeth. At 10 days old they open their eyes, their ears unfold, their first teeth erupt, and they begin to play with their litter mates. They nurse for about 40 days. Mother and cubs remain together for as long as 26 months, though the average is 15 months. Males generally move farther, once they've left their mother, than do females. Males are ready to breed at about 3 years of age and females at 2 1/2 years.

Breeding interval: Individual female mountain lions usually give birth every two years.

Breeding season: Mating throughout the year, in northern parts of their range mating is more concentrated from December to March.

Range number of offspring: 1 to 6.

Average number of offspring: 2.9.

Range gestation period: 84 to 106 days.

Average gestation period: 92.3 days.

Range weaning age: 28 (low) days.

Average weaning age: 40 days.

Range time to independence: 12 (high) months.

Average age at sexual or reproductive maturity (female): 2.5 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 400 g.

Average number of offspring: 2.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Mother mountain lions care for and nurse their young until they are about a year old. The young are born helpless and are protected by the mother in a sheltered area until they are big enough to roam and begin to learn and practice hunting skills.

Parental Investment: altricial ; female parental care ; post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males maintain territories that overlap with those of several females. They attempt to dominate matings with those females.

A mountain lion in the wild will not mate until it has established a home territory. When the female is in estrous, she vocalizes freely and frequently rubs against nearby objects. The male responds with similar yowls and sniffs the female's genital area. The highest frequency of copulation was nine times in one hour. A single copulatory act lasts less than one minute. There is a 67% chance of conception per mated estrous

Mating System: polygynous

Courtship and mating occurs throughout the year, but is concentrated from December to March in northern latitudes. Gestation periods last from 82 to 96 days. A female mountain lion can come into estrus any time of the year. Estrus lasts about nine days. Females usually give birth every other year. After six cycles without mating, the female has a lull for two months before coming into estrous again. Males remain reproductively active to at least an age of 20 years, and females to at least an age of 12 years. Litters vary in size from 1 to 6 cubs with an average of 3 or 4. Birth weight is between 226 to 453 grams. The cubs open their eyes 10 days after birth. At the same time their ear pinnae unfolds, their first teeth erupt, and they begin play. The cubs are fully weaned at about 40 days of age. Mother and cubs remain together for as long as 26 months, though the average is 15 months. Male young disperse from 23 to 274 km, while females disperse from 9 to 140 km. Males reach sexual maturity at about 3 years of age and females at 2 1/2 years.

Breeding interval: Individual female mountain lions usually give birth every two years.

Breeding season: Mating throughout the year, in northern parts of their range mating is more concentrated from December to March.

Range number of offspring: 1 to 6.

Average number of offspring: 2.9.

Range gestation period: 84 to 106 days.

Average gestation period: 92.3 days.

Range weaning age: 28 (low) days.

Average weaning age: 40 days.

Range time to independence: 12 (high) months.

Average age at sexual or reproductive maturity (female): 2.5 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 400 g.

Average number of offspring: 2.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Mother mountain lions care for and nurse their young until they are about a year old. The young are born helpless and are protected by the mother in a sheltered area until they are big enough to roam and begin to learn and practice hunting skills.

Parental Investment: altricial ; female parental care ; post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Puma concolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAATCGCTGACTGTTTTCAACTAATCATAAAGATATTGGCACTCTTTACCTTCTATTTGGTGCCTGAGCCGGTATGGTAGGAACTGCTCTTAGTCTCCTAATCCGGGCCGAACTAGGTCAACCTGGCACACTACTAGGAGATGATCAAATTTATAATGTGGTCGTTACTGCCCATGCTTTTGTGATGATTTTCTTCATAGTAATACCTATTATGATTGGAGGGTTTGGTAACTGATTGGTCCCATTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATGAATAACATGAGCTTCTGACTTCTTCCTCCATCTTTTTTACTTCTACTTGCTTCATCTATGGTGGAGGCCGGAGCAGGGACTGGATGAACAGTATATCCACCCTTAGCCGGTAATCTGGCTCATGCGGGAGCATCCGTAGATCTAACCATTTTCTCACTCCACCTAGCAGGTGTCTCTTCGATCTTGGGTGCTATTAATTTTATCACCACTATTATTAATATAAAACCTCCTGCCATATCTCAATACCAAACACCCCTTTTTGTATGATCAGTTTTAATCACTGCAGTCCTATTACTCCTATCACTCCCAGTCCTAGCAGCAGGAATTACTATGCTATTAACAGATCGAAACCTAAATACCACATTCTTTGATCCTGCCGGAGGAGGAGATCCTATCTTATACCAACACTTATTCTGATTTTTTGGTCACCCGGAGGTCTATATTTTAATTCTACCCGGCTTCGGAATAATCTCACATATTGTTACCTATTACTCAGGTAAAAAGGAACCATTTGGCTACATGGGAATAGTTTGAGCCATAATATCAATTGGCTTTCTGGGCTTTATCGTATGGGCCCATCACATGTTTACCGTGGGAATAGATGTAGATACACGAGCATACTTTACATCAGCTACCATAATTATCGCCATTCCTACTGGGGTAAAAGTATTTAGCTGACTGGCTACTCTTCACGGAGGTAATATTAAGTGGTCCCCCGCCATACTATGAGCTTTAGGTTTTATCTTCCTATTTACCGTAGGAGGTTTGACAGGGATTGTACTAGCGAACTCCTCACTAGATATCGTTCTTCACGATACATACTACGTAGTAGCCCATTTCCACTATGTATTATCAATAGGAGCAGTATTCGCTATTATAGGGGGTTTCGTCCATTGATTCCCTTTATTCTCAGGGTACACTCTTGATAATACTTGGGCAAAAATTCACTTCACAATTATATTTGTGGGAGTTAACATAACGTTTTTCCCTCAGCACTTCCTAGGGCTATCTGGAATGCCGCGACGTTATTCTGACTACCCAGACGCATATACGACTTGAAACACAATTTCCTCAATAGGCTCTTTCATCTCACTAACGGCAGTTATACTAATAATTTTCATAGTGTGAGAAGCTTTTGCATCCAAGCGAGAAGTGGCTATAGTAGAATTGACCACAACTAATCTCGAATGACTACATGGATGTCCCCCTCCCTACCACACATTTGAAGAGCCAACTTATGTACTATTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Puma concolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widely distributed from Canada to South America; habitat has been reduced to primarily the most remote and inaccessible areas, but the species remains relatively common (for a top predator) in several regions of the western U.S. (game species in some states) and probably elsewhere to the south of the U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Caso, A., Lopez-Gonzalez, C., Payan, E., Eizirik, E., de Oliveira, T., Leite-Pitman, R., Kelly, M., Valderrama, C. & Lucherini, M.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern as it is a widespread species. However, it is considered to be declining, and as a large predator its conservation presents numerous challenges. It has been extirpated from large areas of its historic range in North America (Nowell and Jackson 1996).

History
  • 2002
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Similarity of Appearance (Threatened)
Date Listed: 08/14/1991
Lead Region:   Northeast Region (Region 5) 
Where Listed: U.S.A. (FL)


Population detail:

Population location: U.S.A. (FL)
Listing status: SAT

For most current information and documents related to the conservation status and management of Puma concolor, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some populations of mountain lions are considered extinct, including the populations of the midwest and eastern United States. Florida panthers and the mountain lions of Costa Rica, Panama, and Nicaragua are considered endangered. Most populations in western North America are stable, except in areas where human populations are rapidly growing.

IUCN Red List of Threatened Species: least concern

US Federal List: endangered

CITES: appendix i; appendix ii

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

More info for the term: natural

The Arizona Game and Fish Department lists Yuma pumas
on the 1988 list of threatened Native Wildlife
in Arizona. Yuma pumas are recognized as a species of special concern
by the California Department of Fish and Game [20].

Florida panther - Florida panthers are listed as endangered in the International Union for
the Conservation of Nature and Natural Resources (IUCN) Mammal Red Data
Book. Florida panthers are classified as an Appendix I animal in the
Conservation on International Trade in Endangered Species of Wild Flora
and Fauna (CITES) [20]. The state of Florida lists Florida panthers as
endangered [59]. According to The Network of Natural Heritage Programs
and Conservation Data Centers and The Nature Conservancy, Florida
panthers are critically imperiled in Florida, Arkansas, Louisiana, and
South Carolina [55]. However, several researchers assert that Florida
panthers no longer occur in the latter three states [16,34,53].

Eastern cougar - Eastern cougars are listed as endangered
in the IUCN Mammal Red Data Book. Eastern cougars are classified as an
Appendix I animal in CITES, which provides protection from international
trade. According to The Network of Natural Heritage Programs and
Conservation Data Centers and The Nature Conservancy, eastern cougars
are critically imperiled in South Carolina [55]. In Canada, they are
listed as endangered in New Brunswick, Nova Scotia, Ontario, and Quebec
[62].

Mountain lions are listed as a state threatened species in South Dakota
[60].
  • 16. Florida Panther Interagency Committee. 1987. Florida panther (Felis concolor coryi). Revised Recovery Plan. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 75 p. [24575]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 34. Maehr, David S. 1992. Florida panther: Felis concolor coryi. In: Humphrey, Stephen R., ed. Rare and endangered biota of Florida. Mammals: Volume 1. Naples, FL: Florida Game and Fresh Water Fish Commission: 176-189. [21069]
  • 53. Lowe, David W.; Matthews, John R.; Moseley, Charles J. 1990. The official World Wildlife Fund guide to endangered species of North America. Volume 1. Plants: Mammals. Washington, DC: Beacham Publishing, Inc. 556 p. [+ appendices]
  • 55. The Network of Natural Heritage Programs and Conservation Data Centers and The Nature Conservancy. 1994. Element distribution - North America, vertebrates. Arlington, VA: The Nature Conservancy, Central Conservation Databases. 31 p. [23374]
  • 59. Wood, Don A., compiler. 1994. Official lists of endangered & potentially endangered fauna and flora in Florida. Tallahassee, FL: Florida Game and Fresh Water Fish Commission. 22 p. [24196]
  • 60. South Dakota Department of Game, Fish and Parks. 1994. Fragile legacy: Endangered, threatened and rare animals of South Dakota. Pierre, SD: South Dakota Department of Game, Fish, and Parks, Wildlife Division. 55 p. [24341]
  • 62. Committee on the Status of Endangered Wildlife in Canada. 1992. Canadian species at risk. Ottawa, ON. 10 p. [26183]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

Florida panthers and eastern pumas are listed as Endangered [61].
  • 61. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some subspecies are listed in CITES Appendix I; all others are Appendix II. Some populations are listed as Endangered under the Endangered Species Act. Two populations listed as endangered under the Endangered Species Act are considered extinct (Puma concolor schorgeri and Puma concolor couguar). Puma concolor coryi, Florida panthers, and Puma concolor costaricensis are considered endangered and extant.

US Federal List: endangered

CITES: appendix i; appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), and listed on Appendix II of CITES (3). Subspecies: Puma concolor coryi (Florida puma), P. c. couguar (Eastern puma)and P. c. costaricensis are listed on Appendix I of CITES (4). A number of other subspecies exist, but are not classified separately on the IUCN Red List.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Two subspecies P. concolor coryi, the Florida Panther, and P. concolor cougar, the Eastern Cougar, are Critically Endangered; the parent species is Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The Canadian population was rougly estimated at 3,500-5,000 and the western US population at 10,000 in the early 1990s (Nowell and Jackson, 1996). The population of Central and South America is likely much higher, although it is unclear how abundant pumas are in the dense rainforest of the Amazon basin (Nowell and Jackson, 1996). The Florida subpopulation, numbering 70-80, is isolated, and has been supplemented by a reintroduction of pumas from Texas (Sunquist and Sunquist 2002). In Brazil it is considered Near Threatened but subspecies outside the Amazon basic are considered VU (Machado et al. 2005). It is also considered Near Threatened in Peru (Inrena 2006), Argentina (Diaz and Ojeda 2000) and Colombia (Rodriguez-Mahecha et al., 2006), and Data Deficient (inadequately known) in Chile (CONAMA 2005).

Density estimates include:

Utah, US: 0.3-0.5/100 km² (Hemker et al. 1984)

Idaho, US: 0.77-1.04/100 km² (Laundre and Clark 2003)

Peru: 2.4/100 km² (Janson and Emmons 1990)

Patagonia: 6/100 km² (Franklin et al. 1999)

Pantanal 4.4/100 km² (Crawshaw and Quigley unpubl. in Nowell and Jackson 1996)

Belize 2-5/100 km², in Argentina 0.5-0.8/100 km², Bolivia 5-8/100 km² (Kelly et al. in press)

W Mexico 3-5/100 km² (Nunez et al. 1998)

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Decline in range and abundance was due in part to federal predator control efforts augmented by state bounty programs. Loss of remote, undisturbed habitat is a problem in some areas. Excessive killing by humans may be a problem in some areas south of the U.S. Depleted ungulate populations are a potential threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Pumas are threatened by habitat loss and fragmentation, and poaching of their wild prey base. They are persecuted across their range by retaliatory hunting due to livestock depredation, and due to fear that they pose a threat to human life (IUCN Cats Red List workshop, 2007). Pumas have killed a number of people in western Canada and the US in recent years. Pumas are legally hunted in many western US states, although hunting was banned by popular referendum in California in 1990. Road kills are the principal cause of mortality in the endangered Florida panther subpopulation, and heavily travelled roads are a major barrier to puma movements and dispersal (Sunquist and Sunquist 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Across their range, pumas have been considered a threat to livestock and persecuted because of this (1). Indeed, the U.S. Fish and Wildlife Service estimate that a minimum of 66,665 pumas were killed between 1907 and 1978. Additionally, pumas are one of the few large predators in Northern America that it is legal to hunt for sport and chase with dogs (5). This species is particularly vulnerable because it takes to trees when hunted, effectively becoming trapped (3). Pumas are also considered a potential danger to humans, especially children (8), although pumas almost never attack people (5). With people settling in more remote areas and with legal protection of the cat, the potential for conflict between humans and pumas arises, and there is a concern that pumas will lose their fear of being close to humans. In California and Florida, many animals are killed by vehicles as heavily travelled roads divide populations and even the home ranges of individual pumas. Loss and fragmentation of habitat also poses significant threats to the puma's future survival; in particular the Florida puma, which faces the serious problem of reduced genetic diversity associated with inbreeding, which in turn reduces resistance to disease or environmental change, and adversely affects fertility (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Protection and maintenance of migratory corridors may be important in some areas (Pierce et al. 1999).

Management Requirements: See Moorhead and Hofstra (1994) on the management of lion-human encounters in national parks (persons encountering a lion should stand their ground, not run, be assertive, keep their eyes on the animal, not play dead, and fight back, if necessary).

See Ross and Jalkotzy (1995) for information on the fate of relocated individuals in Alberta.

Biological Research Needs: Determine minimum habitat needs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Several populations are protected through management as a game species in various western states.

Needs: Protect remote areas supporting viable populations. Repeal bounty laws (if any).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Included in CITES Appendix II (eastern and Central American subspecies (P. c. coryi, costaricensis and cougar) Appendix I). The species is protected across much of its range, with hunting prohibited in most of Argentina, and all of Brazil, Bolivia, Chile, Colombia, Costa Rica, French Guiana, Guatemala, Honduras, Nicaragua, Panama, Paraguay, Suriname, Venezuela and Uruguay, and hunting regulations in place in Canada, Mexico, Peru and the United States (Nowell and Jackson 1996).

There is a need for the implementation of programs to mitigate conflict resolution for livestock depredation and to study the real effect of puma vs. jaguar depredation on livestock (IUCN Cats Red List workshop, 2007). Puma occasionally kill humans - especially in North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the term: fuel

Prescribed burning programs designed to improve habitat for large
ungulates such as deer and elk also benefit mountain lions. Prescribed
fires to improve winter range for mule and white-tailed deer have been
conducted in the Southern East Kootenay Strategic Plan Area, British
Columbia, in recent years [47].

Prescribed fire is currently being used in Florida panther habitat for
fuel reductions to prevent catastrophic wildfires. To provide maximum
benefits for deer and other important Florida panther prey species,
prescribed fires should be conducted on a 2- to 5-year rotation,
depending upon fuel type and site conditions. Burn areas should be less
than 6,177 acres (2,500 ha); annual partial fires or fires every 2 to 5
years should be used when possible to increase habitat heterogeneity
[42].
  • 42. Schortemeyer, James L.; Maehr, David S.; McCown, J. Walter; [and others]
  • 47. Tipper, Gary K. 1988. Prescribed burning for wildlife in the southern East Kootenay. In: Feller, M. C.; Thomson, S. M., eds. Wildlife and range prescribed burning workshop proceedings; 1987 October 27-28; Richmond, BC. Vancouver, BC: The University of British Columbia, Faculty of Forestry: 61-69. [3100]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: cover, presence

Hunting - One of the largest causes of mountain lion mortality is
hunting [56]. Currently almost all states and provinces that support
viable mountain lion populations provide sport hunting opportunities.
Season lengths range from 1 month to year-round and often vary within a
jurisdiction [30]. Most states allow hunters to kill only one mountain
lion per season, with the exception of Texas, which places no limit on
the number of mountain lions a hunter can take [20]. In California
mountain lion hunting has been banned since 1990 [37].

Accidents - Road-killed mountain lions comprise the largest number of
accidental deaths [12,20,56]. Collisions with motor vehicles are the
primary cause of death of Florida panthers. From 1979 to 1991, almost
50 percent of the documented mortalities of Florida panthers were
road-kills [20]. Drownings in drainage canals in California have been
reported [12,56].

Habitat loss - Loss of habitat is probably the greatest threat to
mountain lion populations. Not only are large tracts of habitat
necessary to maintain individual populations of mountain lions, but
corridors that connect these tracts are required for dispersal of
mountain lions between populations. Any permanent loss of habitat,
especially deer and elk winter range in the West and white-tailed deer
and feral pig habitat in Florida, may cause a reduction in the mountain
lion population [20,34,56]. Habitat acquisition, enhancement,
restoration, and protection are fundamental to survival of all mountain
lion subspecies [20]. Specific recommendations for managing mountain
lion habitat in North America have been described by Hansen [20].

The long-term survival of mountain lions depends in part on the
availability of large tracts of roadless habitats [21]. Roads increase
human access to mountain lion habitat, thus increasing mountain lion
vulnerability to hunters. Mountain lions tend to avoid roaded areas.
In Arizona mountain lions crossed hard-surfaced roads and maintained
dirt roads less frequently than smaller dirt roads, suggesting that they
may select against areas with maintained roads [50].

Areas that are disturbed by habitat alteration associated with human
activities or by permanent human presence appear to be less acceptable
to mountain lions than undisturbed areas. Mountain lion reactions to
logging and other human activities were studied in northern Arizona from
1976 to 1980 and in south-central Utah from 1979 to 1982. Resident
males on both study areas generally inhabited areas that were relatively
free of human disturbance. They were rarely found in or near (within 1
km) sites that had been logged within the past 6 years [50].
Development related to oil exploration has been extensive in occupied
Florida panther habitat. The construction of roads, pads, and
associated petroleum production activities has changed some areas, but
the effects on Florida panthers are difficult to measure [34].

Florida panthers are found only in one small part of its original
range. Its decline has resulted primarily from habitat lost to
expanding urbanization and agriculture. Continued habitat loss and
fragmentation may cause extinction of this subspecies. However, where
pasture or vegetable crops exist in a mosaic of forest cover, Florida
panthers may persist. Interspersion of forested and early successional
habitats seems to benefit Florida panther prey [34].

Intensive efforts to protect Florida panther habitat on private lands
are essential for its survival. About half of the presently known
Florida panther range in southern Florida occurs on private lands where
agricultural and urban development are increasing rapidly [33]. Acreage
devoted to citrus production in prime Florida panther habitat has
increased by approximately 400 percent in Collier and Hendry counties
during the last 20 years. The human population in Collier County was
the fastest growing in the nation in 1992 [34].

Another threat to the survival of Florida panthers is low genetic
diversity which has resulted in reproductive disorders within the
population. Abnormal sperm comprised over 94 percent of the total sperm
count in the semen analysis of six Florida panthers [22]. Genetic
studies are continuing to address specific questions regarding the
long-term reproductive viabiltiy of remaining populations and the
feasibility for enhancement of their survivability through selective
introduciton of genetic material from Texas panthers [6].

A progam to reintroduce Florida panthers into "suitable" habitat in
Florida is underway. A captive male Florida panther and three female
Texas panthers are being breed in initial breeding trials. Any
offspring produced between these two subspecies will be sterilized and
released into suitable unoccupied habitat in Florida as "surrogates" to
determine the survivability of captive-bred mountain lions [6,22].
After a 1-year evaluation of the surrogate groups' response to their
habitat as well as the public's response to their presence, these
mountain lions will be removed from the wild. Pure Florida panthers
will then be released into these areas if, based upon the results of the
surrogates study, it appears feasible [22].

Depredations by mountain lions - Mountain lions sometimes kill livestock
and are hunted to prevent further depredations [30,56]. Cattle losses
are most common in southwestern states. Sheep losses may occur in any
area occupied by mountain lions [30]. Evidence suggests that predation
on livestock is opportunistic rather than habitual. None of the
mountain lions captured and released following depredations in
California were involved in further incidents of depredation [56].

REFERENCES :
NO-ENTRY
  • 6. Belden, Robert C.; Hines, Thomas C.; Logan, Thomas H. 1987. Florida panther re-establishment: A discussion of the issues. Wildlife rehabilitation: Proceedings of the National Wildlife Rehabilitation Association 1987 symposium. 6: 115-123. [24566]
  • 12. Currier, Mary Jean P. 1983. Felis concolor. Mammalian Species No. 200: 1-7. [24559]
  • 20. Hansen, Kevin. 1992. Cougar: the American lion. Flagstaff, AZ: Northland Publishing. 129 p. [24577]
  • 21. Harris, Charles E. 1992. Species management plan 1991-1995: Mountain lion. Idaho Wildlife. 12(2): 17-20. [20010]
  • 22. Hines, Tommy C.; Belden, Robert C.; Roelke, Melody E. 1987. An overview of panther research and management in Florida. In: Proceedings, 3rd southeastern nongame and endangered wildlife symposium; 1987 August 8-10; Athens, GA. [Place of publication unknown]
  • 30. Lindzey, Frederick. 1987. Mountain lion. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 656-668. [24560]
  • 33. Maehr, David S. 1990. The Florida panther and private lands. Conservation Biology. 4(2): 167-170. [24570]
  • 34. Maehr, David S. 1992. Florida panther: Felis concolor coryi. In: Humphrey, Stephen R., ed. Rare and endangered biota of Florida. Mammals: Volume 1. Naples, FL: Florida Game and Fresh Water Fish Commission: 176-189. [21069]
  • 37. McCarthy, John; Williams, Jim. 1995. Cougar. Montana Outdoors. 26(2): 24-28. [24573]
  • 50. Van Dyke, Fred G.; Brocke, Rainer H.; Shaw, Harley G.; [and others]
  • 56. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The puma is protected over much of its range. Hunting is prohibited in Argentina, Brazil, Bolivia, Chile, Colombia, Costa Rica, French Guiana, Guatemala, Honduras, Nicaragua, Panama, Paraguay, Suriname, Venezuela and Uruguay, and hunting regulations exist in Canada, Mexico, Peru and the United States (1). However, there still remains no legal protection in Ecuador, El Salvador, and Guyana. Due to its critically low numbers, the Florida puma has been the focus of a particularly concerted and multi-faceted conservation programme, but this has been a complex and expensive task (3) with the aim of achieving three viable self-sustaining wild populations within the puma's former range. Remaining viable tracts of habitat are being conserved and connected by corridors, and the impact of a major highway has been lessened by the construction of underpasses for the safe travel of pumas in the area (9). In 1995, wildlife managers controversially introduced several female pumas from Texas into Florida in an effort to increase genetic diversity. This is thought by many to have alleviated a number of problems associated with inbreeding amongst Florida pumas (6). The levels of prey species are being monitored, wild pumas have been vaccinated against diseases and a captive breeding programme has been established (1). Fortunately, despite conflict with ranchers and concern over the dangers pumas may pose to humans, there appears to be strong overall public support for the cat in North America. The fact that there is a genuine desire by many people to find ways to coexist with the puma is an encouraging step towards promoting positive conservation actions and protecting this beautiful cat (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: In 1989-1990, the sport harvest was 2176 in the western U.S. and western Canada (Hansen 1992). Sometimes preys on domestic livestock.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Although mountain lions are secretive and generally avoid humans, they sometimes attack humans. Attacks are usually on small adults and children traveling alone during dawn, dusk, or at night. It is thought that mountain lions mistake these humans for their ungulate prey. Mountain lions are also considered threats to domestic stock. These threats are sometimes exaggerated. It is helpful to learn more about mountain lion behavior in order to avoid encounters.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mountain lions have considerable trophy value and are hunted for sport. They are also captured to be put in zoos. Mountain lions are important to humans in their role as top predators, helping to control populations of deer and their relatives.

Positive Impacts: body parts are source of valuable material; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Although mountain lions are secretive and generally avoid humans, they sometimes attack humans. Attacks are usually on small adults and children traveling alone during dawn, dusk, or at night. It is thought that mountain lions mistake these humans for their ungulate prey. Mountain lions are also considered threats to domestic stock. These threats are sometimes exaggerated. It is helpful to learn more about mountain lion behavior in order to avoid encounters.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mountain lions have considerable trophy value and are hunted for sport. They are also captured to be put in zoos. Mountain lions are important to humans in their role as top predators, helping to control populations of ungulates.

Positive Impacts: body parts are source of valuable material; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cougar

The cougar (Puma concolor), also known as the mountain lion, puma, panther, painter, mountain cat,[3] or catamount, is a large cat of the family Felidae native to the Americas. Its range, from the Canadian Yukon to the southern Andes of South America, is the greatest of any large wild terrestrial mammal in the Western Hemisphere.[4] An adaptable, generalist species, the cougar is found in most American habitat types. It is the second heaviest cat in the New World, after the jaguar. Secretive and largely solitary by nature, the cougar is properly considered both nocturnal and crepuscular, although sightings during daylight hours do occur.[5][6][7][8] The cougar is more closely related to smaller felines, including the domestic cat (subfamily Felinae), than to any subspecies of lion (subfamily Pantherinae).[9][10][11]

An excellent stalk-and-ambush predator, the cougar pursues a wide variety of prey. Primary food sources include ungulates such as deer, elk, moose, and bighorn sheep, as well as domestic cattle, horses and sheep, particularly in the northern part of its range. It will also hunt species as small as insects and rodents. This cat prefers habitats with dense underbrush and rocky areas for stalking, but can also live in open areas. The cougar is territorial and survives at low population densities. Individual territory sizes depend on terrain, vegetation, and abundance of prey. While large, it is not always the apex predator in its range, yielding to the jaguar, gray wolf, American black bear, and grizzly bear. It is reclusive and mostly avoids people. Fatal attacks on humans are rare, but have been trending upward in recent years as more people enter their territory.[12]

Excessive hunting following European colonization of the Americas and the ongoing human development of cougar habitat has caused populations to drop in most parts of its historical range. In particular, the cougar was extirpated in eastern North America in the beginning of the 20th century, except for an isolated subpopulation in Florida. However, in recent decades, breeding populations have moved east into the far western parts of the Dakotas, Nebraska, and Oklahoma. Transient males have been verified in Minnesota,[13] Missouri,[14] Wisconsin,[15] Iowa,[16][17] the Upper Peninsula of Michigan, and Illinois, where a cougar was shot in the city limits of Chicago[18][19][20] and, in at least one instance, observed as far east as Connecticut.[21][22] Today, reports of eastern cougars (Puma concolor cougar) still surface, but the last verified one was killed in 2011.[23]

Naming and etymology[edit]

With its vast range across the length of the Americas, Puma concolor has dozens of names and various references in the mythology of the indigenous Americans and in contemporary culture. The cat has many names in English, of which cougar, puma and mountain lion are popular. "Mountain lion" was a term first used in writing in 1858 from the diary of George A. Jackson of Colorado.[24] However, mountain lion is technically incorrect, as its range is not limited to mountain regions, nor can it roar like a true lion, the latter being of the genus Panthera. Other names include "catamount" (probably a contraction from "cat of the mountain"), "panther", "mountain screamer" and "painter". Lexicographers regard "painter" as a primarily upper-Southern US regional variant on "panther".[25] The word panther, while technically referring to all members of the genus Panthera, is commonly used to specifically designate the black panther, a melanistic jaguar or leopard, and the Florida panther, a subspecies of cougar (Puma concolor coryi).

Puma concolor holds the Guinness record for the animal with the highest number of names, presumably due to its wide distribution across North and South America. It has over 40 names in English alone.[26]

"Cougar" may be borrowed from the archaic Portuguese çuçuarana; the term was originally derived from the Tupi language. A current form in Brazil is suçuarana. It may also be borrowed from the Guaraní language term guaçu ara or guazu ara. Less common Portuguese terms are onça-parda (lit. brown onça, in distinction of the black-spotted [yellow] one, onça-pintada, the jaguar) or leão-baio (lit. chestnut lion), or unusually non-native puma or leão-da-montanha, more common names for the animal when native to a region other than South America (especially for those who do not know that suçuaranas are found elsewhere but with a different name). People in rural regions often refer to both the cougar and to the jaguar as simply gata (lit. she-cat), and outside of the Amazon, both are colloquially referred to as simply onça by many people (that is also a name for the leopard in Angola).

In the 17th century, German naturalist Georg Marcgrave named the cat the cuguacu ara. Marcgrave's rendering was reproduced by his associate, Dutch naturalist Willem Piso, in 1648. Cuguacu ara was then adopted by English naturalist John Ray in 1693.[27] The French naturalist Georges-Louis Leclerc, Comte de Buffon in 1774 (probably influenced by the word "jaguar") converted the cuguacu ara to cuguar, from when it was later modified to "cougar" in English.[28][29][30]

The first English record of "puma" was in 1777, where it had come from the Spanish, who in turn borrowed it from the Peruvian Quechua language in the 16th century, where it means "powerful".[31] Puma is also the most common name cross-linguistically.[citation needed]

Taxonomy and evolution[edit]

Cougar in the wild.
Although large, the cougar is more closely related to smaller felines.
Close-up of face

The cougar is the largest of the small cats. It is placed in the subfamily Felinae, although its bulk characteristics are similar to those of the big cats in the subfamily Pantherinae.[1] The family Felidae is believed to have originated in Asia about 11 million years ago. Taxonomic research on felids remains partial, and much of what is known about their evolutionary history is based on mitochondrial DNA analysis,[32] as cats are poorly represented in the fossil record,[33] and there are significant confidence intervals with suggested dates. In the latest genomic study of Felidae, the common ancestor of today's Leopardus, Lynx, Puma, Prionailurus, and Felis lineages migrated across the Bering land bridge into the Americas 8.0 to 8.5 million years ago (Mya). The lineages subsequently diverged in that order.[33] North American felids then invaded South America 3 Mya as part of the Great American Interchange, following formation of the Isthmus of Panama. The cougar was originally thought to belong in Felis (Felis concolor), the genus which includes the domestic cat. As of 1993, it is now placed in Puma along with the jaguarundi, a cat just a little more than a tenth its weight.

Studies have indicated the cougar and jaguarundi are most closely related to the modern cheetah of Africa and western Asia,[33][34] but the relationship is unresolved. The cheetah lineage is suggested to have diverged from the Puma lineage in the Americas (see American cheetah) and migrated back to Asia and Africa,[33][34] while other research suggests the cheetah diverged in the Old World itself.[35] The outline of small feline migration to the Americas is thus unclear.

Recent studies have demonstrated a high level of genetic similarity among the North American cougar populations, suggesting they are all fairly recent descendants of a small ancestral group. Culver et al. suggest the original North American population of Puma concolor was extirpated during the Pleistocene extinctions some 10,000 years ago, when other large mammals, such as Smilodon, also disappeared. North America was then repopulated by a group of South American cougars.[34]

Subspecies[edit]

Until the late 1980s, as many as 32 subspecies were recorded; however, a recent genetic study of mitochondrial DNA[34] found many of these are too similar to be recognized as distinct at a molecular level. Following the research, the canonical Mammal Species of the World (3rd ed.) recognizes six subspecies, five of which are solely found in Latin America:[1]

  • Argentine puma (Puma concolor cabrerae) Pocock, 1940:
    includes the previous subspecies and synonyms hudsonii and puma
  • Costa Rican cougar (P. c. costaricensis) Merriam, 1901
  • eastern South American cougar (P. c. anthonyi) Nelson and Goldman, 1931:
    includes the previous subspecies and synonyms acrocodia, borbensis, capricornensis, concolor, greeni, and nigra
  • North American cougar (P. c. couguar) Kerr, 1792:
    includes the previous subspecies and synonyms arundivaga, aztecus, browni, californica, floridana, hippolestes, improcera, kaibabensis, mayensis, missoulensis, olympus, oregonensis, schorgeri, stanleyana, vancouverensis, and youngi
  • northern South American cougar (P. c. concolor) Linnaeus, 1771:
    includes the previous subspecies and synonyms bangsi, incarum, osgoodi, soasoaranna, sussuarana, soderstromii, suçuaçuara, and wavula
  • southern South American puma (P. c. puma) Molina, 1782:
    includes the previous subspecies and synonyms araucanus, concolor, patagonica, pearsoni, and puma

Incerta sedis

The status of the Florida panther remains uncertain. It is still regularly listed as subspecies P. c. coryi in research works, including those directly concerned with its conservation.[36] Culver et al. noted low microsatellite variation in the Florida panther, possibly due to inbreeding;[34] responding to the research, one conservation team suggests, "the degree to which the scientific community has accepted the results of Culver et al. and the proposed change in taxonomy is not resolved at this time."[37]

Biology and behavior[edit]

Physical characteristics[edit]

Cougar skull and jawbone

Cougars are slender and agile members of the cat family. They are the fourth-largest cat;[38] adults stand about 60 to 90 cm (24 to 35 in) tall at the shoulders.[39] Adult males are around 2.4 m (7.9 ft) long nose-to-tail and females average 2.05 m (6.7 ft), with overall ranges between 1.5 to 2.75 m (4.9 to 9.0 ft) nose to tail suggested for the species in general.[40][41] Of this length, 63 to 95 cm (25 to 37 in) is comprised by the tail.[42] Males typically weigh 53 to 100 kg (115 to 220 lb), averaging 62 kg (137 lb). Females typically weigh between 29 and 64 kg (64 and 141 lb), averaging 42 kg (93 lb).[42][43][44] Cougar size is smallest close to the equator, and larger towards the poles.[4] The largest recorded cougar, shot in Arizona, weighed 125.5 kg (276 lb) after its intestines were removed, indicating in life it could have weighed nearly 136.2 kg (300 lb).[45] Several male cougars in British Columbia weighed between 86.4 and 95.5 kg (190 to 210 lb).[46]

Although cougars resemble the domestic cat, they are about the same size as an adult human.

The head of the cat is round and the ears are erect. Its powerful forequarters, neck, and jaw serve to grasp and hold large prey. It has five retractable claws on its forepaws (one a dewclaw) and four on its hind paws. The larger front feet and claws are adaptations to clutching prey.[47]

Cougars can be almost as large as jaguars, but are less muscular and not as powerfully built; where their ranges overlap, the cougar tends to be smaller than average. Besides the jaguar, the cougar is on average larger than all felids apart from lions and tigers. Despite its size, it is not typically classified among the "big cats", as it cannot roar, lacking the specialized larynx and hyoid apparatus of Panthera.[48] Compared to "big cats", cougars are often silent with minimal communication through vocalizations outside of the mother-offspring relationship.[49] Cougars sometimes voice low-pitched hisses, growls, and purrs, as well as chirps and whistles, many of which are comparable to those of domestic cats. They are well known for their screams, as referenced in some of their common names, although these screams are often misinterpreted to be the calls of other animals.[50]

Rear paw of a cougar

Cougar coloring is plain (hence the Latin concolor) but can vary greatly between individuals and even between siblings. The coat is typically tawny, but ranges to silvery-grey or reddish, with lighter patches on the underbody, including the jaws, chin, and throat. Infants are spotted and born with blue eyes and rings on their tails;[43] juveniles are pale, and dark spots remain on their flanks.[41] Despite anecdotes to the contrary, all-black coloring (melanism) has never been documented in cougars.[51] The term "black panther" is used colloquially to refer to melanistic individuals of other species, particularly jaguars and leopards.[52]

Cougars have large paws and proportionally the largest hind legs in the cat family.[43] This physique allows it great leaping and short-sprint ability. The cougar is able to leap as high as 5.5 m (18 ft) in one bound, and as far as 40 to 45 ft (12 to 13.5 m) horizontally.[53][54][55][56] The cougar's top running speed ranges between 64 and 80 km/h (40 and 50 mph),[57][58] but is best adapted for short, powerful sprints rather than long chases. It is adept at climbing, which allows it to evade canine competitors. Although it is not strongly associated with water, it can swim.[59]

Hunting and diet[edit]

A successful generalist predator, the cougar will eat any animal it can catch, from insects to large ungulates (over 500 kg). Like all cats, it is an obligate carnivore, meaning it needs to feed exclusively on meat to survive. The mean weight of vertebrate prey (MWVP) was positively correlated (r=0.875) with puma body weight and inversely correlated (r=–0.836) with food niche breadth all across the Americas. In general, MWVP was lower in areas closer to the Equator.[4] Its most important prey species are various deer species, particularly in North America; mule deer, white-tailed deer, and even bull elk are taken. Other species such as bighorn sheep, wild horses of Arizona, domestic horses, and domestic livestock such as cattle and sheep are also primary food bases in many areas.[60] A survey of North America research found 68% of prey items were ungulates, especially deer. Only the Florida Panther showed variation, often preferring feral hogs and armadillos.[4]

Cougars are ambush predators, feeding mostly on deer and other mammals.

Investigation in Yellowstone National Park showed that elk, followed by mule deer, were the cougar's primary targets; the prey base is shared with the park's gray wolves, with whom the cougar competes for resources.[61] Another study on winter kills (November–April) in Alberta showed that ungulates accounted for greater than 99% of the cougar diet. Learned, individual prey recognition was observed, as some cougars rarely killed bighorn sheep, while others relied heavily on the species.[62]

In the Central and South American cougar range, the ratio of deer in the diet declines. Small to mid-size mammals are preferred, including large rodents such as the capybara. Ungulates accounted for only 35% of prey items in one survey, approximately half that of North America. Competition with the larger jaguar has been suggested for the decline in the size of prey items.[4] Other listed prey species of the cougar include mice, porcupines, beavers, raccoons, hares.[63] Birds and small reptiles are sometimes preyed upon in the south, but this is rarely recorded in North America.[4] Not all of their prey is listed here due to their large range.

Though capable of sprinting, the cougar is typically an ambush predator. It stalks through brush and trees, across ledges, or other covered spots, before delivering a powerful leap onto the back of its prey and a suffocating neck bite. The cougar is capable of breaking the neck of some of its smaller prey with a strong bite and momentum bearing the animal to the ground.[47]

Kills are generally estimated at around one large ungulate every two weeks. The period shrinks for females raising young, and may be as short as one kill every three days when cubs are nearly mature at around 15 months.[43] The cat drags a kill to a preferred spot, covers it with brush, and returns to feed over a period of days. It is generally reported that the cougar is not a scavenger, and will rarely consume prey it has not killed; but deer carcasses left exposed for study were scavenged by cougars in California, suggesting more opportunistic behavior.[64]

Reproduction and life cycle[edit]

Females reach sexual maturity between one-and-a-half to three years of age. They typically average one litter every two to three years throughout their reproductive lives,[65] though the period can be as short as one year.[43] Females are in estrus for about 8 days of a 23-day cycle; the gestation period is approximately 91 days.[43] Females are sometimes reported as monogamous,[66] but this is uncertain and polygyny may be more common.[67] Copulation is brief but frequent. Chronic stress can result in low reproductive rates when in captivity as well as in the field.[68]

Cougar cubs
Puma cub in Santa Monica Mountains near Malibu Springs

Only females are involved in parenting. Female cougars are fiercely protective of their cubs, and have been seen to successfully fight off animals as large as American black bears in their defense. Litter size is between one and six cubs; typically two. Caves and other alcoves that offer protection are used as litter dens. Born blind, cubs are completely dependent on their mother at first, and begin to be weaned at around three months of age. As they grow, they begin to go out on forays with their mother, first visiting kill sites, and after six months beginning to hunt small prey on their own.[65] Kitten survival rates are just over one per litter.[43] When cougars are born, they have spots, but they lose them as they grow, and by the age of 2 1/2 years, they will completely be gone[69]

Young adults leave their mother to attempt to establish their own territory at around two years of age and sometimes earlier; males tend to leave sooner. One study has shown high mortality amongst cougars that travel farthest from the maternal range, often due to conflicts with other cougars (intraspecific competition).[65] Research in New Mexico has shown that "males dispersed significantly farther than females, were more likely to traverse large expanses of non-cougar habitat, and were probably most responsible for nuclear gene flow between habitat patches."[70]

Life expectancy in the wild is reported at eight to 13 years, and probably averages eight to 10; a female of at least 18 years was reported killed by hunters on Vancouver Island.[43] Cougars may live as long as 20 years in captivity. One male North American cougar (P. c. couguar), named Scratch, was two months short of his 30th birthday when he died in 2007.[71] Causes of death in the wild include disability and disease, competition with other cougars, starvation, accidents, and, where allowed, human hunting. Feline immunodeficiency virus, an endemic HIV-like virus in cats, is well-adapted to the cougar.[72]

Social structure and home range[edit]

Like almost all cats, the cougar is a solitary animal. Only mothers and kittens live in groups, with adults meeting only to mate. It is secretive and crepuscular, being most active around dawn and dusk.

Estimates of territory sizes vary greatly. Canadian Geographic reports large male territories of 150 to 1000 km2 (58 to 386 sq mi) with female ranges half the size.[66] Other research suggests a much smaller lower limit of 25 km2 (10 sq mi), but an even greater upper limit of 1300 km2 (500 sq mi) for males.[65] In the United States, very large ranges have been reported in Texas and the Black Hills of the northern Great Plains, in excess of 775 km2 (300 sq mi).[73] Male ranges may include or overlap with those of females but, at least where studied, not with those of other males, which serves to reduce conflict between cougars. Ranges of females may overlap slightly with each other. Scrape marks, urine, and feces are used to mark territory and attract mates. Males may scrape together a small pile of leaves and grasses and then urinate on it as a way of marking territory.[59]

Home range sizes and overall cougar abundance depend on terrain, vegetation, and prey abundance.[65] One female adjacent to the San Andres Mountains, for instance, was found with a large range of 215 km2 (83 sq mi), necessitated by poor prey abundance.[70] Research has shown cougar abundances from 0.5 animals to as much as 7 (in one study in South America) per 100 km2 (38 sq mi).[43]

Because males disperse farther than females and compete more directly for mates and territory, they are most likely to be involved in conflict. Where a subadult fails to leave his maternal range, for example, he may be killed by his father.[73] When males encounter each other, they hiss, spit, and may engage in violent conflict if neither backs down.[67] Hunting or relocation of the cougar may increase aggressive encounters by disrupting territories and bringing young, transient animals into conflict with established individuals.[74]

Ecology[edit]

Distribution and habitat[edit]

Cougar on Animal Reserve Guaycolec, Formosa, Argentina

The cougar has the largest range of any wild land animal in the Americas. Its range spans 110 degrees of latitude, from northern Yukon in Canada to the southern Andes. It is one of only three cat species, along with the bobcat and Canada lynx, native to Canada.[47] Its wide distribution stems from its adaptability to virtually every habitat type: it is found in all forest types, as well as in lowland and mountainous deserts. The cougar prefers regions with dense underbrush, but can live with little vegetation in open areas.[2] Its preferred habitats include precipitous canyons, escarpments, rim rocks, and dense brush.[59]

The cougar was extirpated across much of its eastern North American range (with the exception of Florida) in the two centuries after European colonization, and faced grave threats in the remainder of its territory. Currently, it ranges across most western American states, the Canadian provinces of Alberta, Saskatchewan and British Columbia, and the Canadian territory of Yukon. There have been widely debated reports of possible recolonization of eastern North America.[75] DNA evidence has suggested its presence in eastern North America,[76] while a consolidated map of cougar sightings shows numerous reports, from the mid-western Great Plains through to eastern Canada.[77] The Quebec wildlife services (known locally as MRNF) also considers cougar to be present in the province as a threatened species after multiple DNA tests confirmed cougar hair in lynx mating sites.[78] The only unequivocally known eastern population is the Florida panther, which is critically endangered. There have been unconfirmed sightings in Elliotsville Plantation, Maine (north of Monson); and in New Hampshire, there have been unconfirmed sightings as early as 1997.[79] In 2009, the Michigan Department of Natural Resources confirmed a cougar sighting in Michigan's Upper Peninsula.[80] Typically, extreme-range sightings of cougars involve young males, which can travel great distances to establish ranges away from established males; all four confirmed cougar kills in Iowa since 2000 involved males.[81]

On April 14, 2008, police shot and killed a cougar on the north side of Chicago, Illinois. DNA tests were consistent with cougars from the Black Hills of South Dakota. Less than a year later, on March 5, 2009, a cougar was photographed and unsuccessfully tranquilized by state wildlife biologists in a tree near Spooner, Wisconsin, in the northwestern part of the state.[82]

The Indiana Department of Natural Resources used motion-sensitive cameras to confirm the presence of a cougar in Greene County in southern Indiana on May 7, 2010. Another sighting in late 2009 in Clay County in west-central Indiana was confirmed by the DNR.[83]

On June 10, 2011, a cougar was observed roaming near Greenwich, Connecticut. State officials at the time said they believed it was a released pet.[84] On June 11, 2011, a cougar, believed to be the same animal as the one observed in Greenwich, was killed by a car on the Wilbur Cross Parkway in Milford, Connecticut.[85] When wildlife officials examined the cougar's DNA, they concluded it was a wild cougar from the Black Hills of South Dakota, which had wandered at least 1,500 miles east over an indeterminate time period.[86]

In October 2012, a trail camera in Morgan County, Illinois snapped a photograph of a cougar,[87] and on November 6, 2012 a trail camera in Pike County captured a photo also believed to be of a cougar.[88]

On November 21, 2013, A cougar was shot and killed near Morrison, Illinois in rural Whiteside County by the Illinois Department of Natural Resources.[89]

South of the Rio Grande, the International Union for the Conservation of Nature and Natural Resources (IUCN) lists the cat in every Central and South American country.[2] While specific state and provincial statistics are often available in North America, much less is known about the cat in its southern range.[90]

The cougar's total breeding population is estimated at less than 50,000 by the IUCN, with a declining trend.[2] US state-level statistics are often more optimistic, suggesting cougar populations have rebounded. In Oregon, a healthy population of 5,000 was reported in 2006, exceeding a target of 3,000.[91] California has actively sought to protect the cat and a similar number of cougars has been suggested, between 4,000 and 6,000.[92]

In 2012 research in Río Los Cipreses National Reserve, Chile, based in 18 motion-sensitive cameras counted a population of two males and two females, one of them with at least two cubs, in an area of 600 km2, that is 0.63 cougars every 100 km2.[93]

Ecological role[edit]

Paw of a puma
Front paw print of a cougar. An adult paw print is approximately 10 cm (4 inches) long.[94]

Aside from humans, no species preys upon mature cougars in the wild, although conflicts with other predators or scavengers occur. The Yellowstone National Park ecosystem provides a fruitful microcosm to study inter-predator interaction in North America. Of the three large predators, the massive grizzly bear appears dominant, often although not always able to drive both the gray wolf pack and the cougar off their kills. One study found that American black bears visited 24% of cougar kills in Yellowstone and Glacier National Parks, usurping 10% of carcasses. Bears gained up to 113%, and cougars lost up to 26%, of their respective daily energy requirements from these encounters.[95] Accounts of cougars and black bears killing each other in fights to the death have been documented from the 19th century.[96][97] In spite of the size and power of the cougar, there have also been accounts of both brown and black bears killing cougars, either in disputes or in self-defense.[98][99]

The gray wolf and the cougar compete more directly for prey, especially in winter. Wolves can steal kills and occasionally kill the cat. One report describes a large pack of 7 to 11 wolves killing a female cougar and her kittens.[100] Conversely, lone female or young wolves are vulnerable to predation, and have been reported ambushed and killed by cougars.[101] Various accounts of cougars killing lone wolves, including a six-year old female, have also been documented.[102][103][104] Wolves more broadly affect cougar population dynamics and distribution by dominating territory and prey opportunities, and disrupting the feline's behavior. Preliminary research in Yellowstone, for instance, has shown displacement of the cougar by wolves.[105] In nearby Sun Valley, Idaho, a recent cougar/wolf encounter that resulted in the death of the cougar was documented.[106] One researcher in Oregon noted: "When there is a pack around, cougars are not comfortable around their kills or raising kittens ... A lot of times a big cougar will kill a wolf, but the pack phenomenon changes the table."[107]

Both species, meanwhile, are capable of killing mid-sized predators, such as bobcats and coyotes, and tend to suppress their numbers.[61] Although cougars can kill coyotes, the latter have been documented attempting to prey on cougar cubs.[108]

In the southern portion of its range, the cougar and jaguar share overlapping territory.[109] The jaguar tends to take larger prey and the cougar smaller where they overlap, reducing the cougar's size and also further reducing the likelihood of direct competition.[4] Of the two felines, the cougar appears best able to exploit a broader prey niche and smaller prey.[110]

As with any predator at or near the top of its food chain, the cougar impacts the population of prey species. Predation by cougars has been linked to changes in the species mix of deer in a region. For example, a study in British Columbia observed that the population of mule deer, a favored cougar prey, was declining while the population of the less frequently preyed-upon white-tailed deer was increasing.[111] The Vancouver Island marmot, an endangered species endemic to one region of dense cougar population, has seen decreased numbers due to cougar and gray wolf predation.[112] Nevertheless, there is a measurable effect on the quality of deer populations by puma predation.[113][114]

In the southern part of South America, the puma is a top level predator that has controlled the population of guanaco and other species since prehistoric times.[115]

Hybrids[edit]

Pumapard, photographed in 1904

A pumapard is a hybrid animal resulting from a union between a cougar and a leopard. Three sets of these hybrids were bred in the late 1890s and early 1900s by Carl Hagenbeck at his animal park in Hamburg, Germany. Most did not reach adulthood. One of these was purchased in 1898 by Berlin Zoo. A similar hybrid in Berlin Zoo purchased from Hagenbeck was a cross between a male leopard and a female puma. Hamburg Zoo's specimen was the reverse pairing, the one in the black-and-white photo, fathered by a puma bred to an Indian leopardess.

Whether born to a female puma mated to a male leopard, or to a male puma mated to a female leopard, pumapards inherit a form of dwarfism. Those reported grew to only half the size of the parents. They have a puma-like long body (proportional to the limbs, but nevertheless shorter than either parent), but short legs. The coat is variously described as sandy, tawny or greyish with brown, chestnut or "faded" rosettes.[116]

Conservation status[edit]

The World Conservation Union (IUCN) currently lists the cougar as a "least concern" species. The cougar is regulated under Appendix I of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES),[117] rendering illegal international trade in specimens or parts.

Cougar conservation depends on preservation of their habitat.

In the United States east of the Mississippi River, the only unequivocally known cougar population is the Florida panther. Until 2011, the United States Fish and Wildlife Service (USFWS) recognized both an Eastern cougar (claimed to be a subspecies by some, denied by others)[118][119] and the Florida panther, affording protection under the Endangered Species Act.[120][121] Certain taxonomic authorities have collapsed both designations into the North American cougar, with Eastern or Florida subspecies not recognized,[1] while a subspecies designation remains recognized by some conservation scientists.[36] The most recent documented count for the Florida sub-population is 87 individuals, reported by recovery agencies in 2003.[122] In March 2011, the USFWS declared the Eastern cougar extinct. However, with the taxonomic uncertainty about its existence as a subspecies as well as the possibility of eastward migration of cougars from the western range, the subject remains open.[123]

This uncertainty has been recognized by Canadian authorities. The Canadian federal agency called Committee on the Status of Endangered Wildlife in Canada rates its current data as "insufficient" to draw conclusions regarding the eastern cougar's survival, and says on its Web site "Despite many sightings in the past two decades from eastern Canada, there are insufficient data to evaluate the taxonomy or assign a status to this cougar." Notwithstanding numerous reported sightings in Ontario, Quebec, New Brunswick and Nova Scotia, it has been said that the evidence is inconclusive: ". . . there may not be a distinct 'eastern' subspecies, and some sightings may be of escaped pets."[124][125]

The cougar is also protected across much of the rest of its range. As of 1996, cougar hunting was prohibited in Argentina, Brazil, Bolivia, Chile, Colombia, Costa Rica, French Guiana, Guatemala, Honduras, Nicaragua, Panama, Paraguay, Suriname, Venezuela, and Uruguay. The cat had no reported legal protection in Ecuador, El Salvador, and Guyana.[43] Regulated cougar hunting is still common in the United States and Canada, although they are protected from all hunting in the Yukon; it is permitted in every U.S. state from the Rocky Mountains to the Pacific Ocean, with the exception of California. Texas is the only state in the United States with a viable population of cougars that does not protect that population in some way. In Texas, cougars are listed as nuisance wildlife and any person holding a hunting or a trapping permit can kill a cougar regardless of the season, number killed, sex or age of the animal.[126] Killed animals are not required to be reported to Texas Parks and Wildlife Department. Conservation work in Texas is the effort of a non-profit organization, Balanced Ecology Inc (BEI), as part of their Texas Mountain Lion Conservation Project. Cougars are generally hunted with packs of dogs, until the animal is 'treed'. When the hunter arrives on the scene, he shoots the cat from the tree at close range. The cougar cannot be legally killed without a permit in California except under very specific circumstances, such as when a cougar is in act of pursuing livestock or domestic animals, or is declared a threat to public safety.[92] Permits are issued when owners can prove property damage on their livestock or pets. For example, multiple dogs have been attacked and killed, sometimes while with the owner. Many attribute this to the protection cougars have from being hunted and are now becoming desensitized to humans; most are removed from the population after the attacks have already occurred. Statistics from the Department of Fish and Game indicate that cougar killings in California have been on the rise since the 1970s with an average of over 112 cats killed per year from 2000 to 2006 compared to six per year in the 1970s. They also state on their website that there is a healthy number of cougars in California. The Bay Area Puma Project aims to obtain information on cougar populations in the San Francisco Bay area and the animals' interactions with habitat, prey, humans, and residential communities.[127]

Conservation threats to the species include persecution as a pest animal, environmental degradation and habitat fragmentation, and depletion of their prey base. Wildlife corridors and sufficient range areas are critical to the sustainability of cougar populations. Research simulations have shown that the animal faces a low extinction risk in areas of 2200 km2 (850 sq mi) or more. As few as one to four new animals entering a population per decade markedly increases persistence, foregrounding the importance of habitat corridors.[128]

On March 2, 2011, the United States Fish and Wildlife Service declared the Eastern cougar (Puma concolor couguar) officially extinct.[129]

Relationships with humans[edit]

In mythology[edit]

The grace and power of the cougar have been widely admired in the cultures of the indigenous peoples of the Americas. The Inca city of Cusco is reported to have been designed in the shape of a cougar, and the animal also gave its name to both Inca regions and people. The Moche people represented the puma often in their ceramics.[130] The sky and thunder god of the Inca, Viracocha, has been associated with the animal.[131]

In North America, mythological descriptions of the cougar have appeared in the stories of the Hocąk language ("Ho-Chunk" or "Winnebago") of Wisconsin and Illinois[132] and the Cheyenne, amongst others. To the Apache and Walapai of Arizona, the wail of the cougar was a harbinger of death.[133] The Algonquins and Ojibwe believe that the cougar lived in the underworld and was wicked, whereas it was a sacred animal among the Cherokee.[134]

Livestock predation[edit]

During the early years of ranching, cougars were considered on par with wolves in destructiveness. According to figures in Texas in 1990, 86 calves (0.0006% of a total of 13.4 million cattle & calves in Texas), 253 Mohair goats, 302 Mohair kids, 445 sheep (0.02% of a total of 2.0 million sheep & lambs in Texas) and 562 lambs (0.04% of 1.2 million lambs in Texas) were confirmed to have been killed by cougars that year.[135][136] In Nevada in 1992, cougars were confirmed to have killed 9 calves, 1 horse, 4 foals, 5 goats, 318 sheep and 400 lambs. In both cases, sheep were the most frequently attacked. Some instances of surplus killing have resulted in the deaths of 20 sheep in one attack.[137] A cougar's killing bite is applied to the back of the neck, head, or throat and inflict puncture marks with their claws usually seen on the sides and underside of the prey, sometimes also shredding the prey as they hold on. Coyotes also typically bite the throat region but do not inflict the claw marks and farmers will normally see the signature zig-zag pattern that coyotes create as they feed on the prey whereas cougars typically drag in a straight line. The work of a cougar is generally clean, differing greatly from the indiscriminate mutilation by coyotes and feral dogs. The size of the tooth puncture marks also helps distinguish kills made by cougars from those made by smaller predators.[138]

Remedial hunting appears to have the paradoxical effect of increased livestock predation and complaints of human-puma conflicts. In a 2013 study the most important predictor of puma problems were remedial hunting of puma the previous year. Each additional puma on the landscape increased predation and human-puma complaints by 5% but each additional animal killed on the landscape the previous year increased complaints by 50%, an order of magnitude higher. The effect had a dose-response relationship with very heavy (100% removal of adult puma) remedial hunting leading to a 150% - 340% increase in livestock and human conflicts.[139] This effect is attributed to the fact that inexperienced younger male pumas are most likely to approach human developments, whereas remedial hunting removes older pumas who have learned to avoid people in their established territories. Remedial hunting enables younger males to enter the former territories of the older animals.[140][141]

Attacks on humans[edit]

Mountain Lion warning sign.

Due to the expanding human population, cougar ranges increasingly overlap with areas inhabited by humans. Attacks on humans are very rare, as cougar prey recognition is a learned behavior and they do not generally recognize humans as prey.[12] Attacks on people, livestock, and pets may occur when a puma habituates to humans or is in a condition of severe starvation. Attacks are most frequent during late spring and summer, when juvenile cougars leave their mothers and search for new territory.[94]

Between 1890 and 1990, in North America there were 53 reported, confirmed attacks on humans, resulting in 48 nonfatal injuries and 10 deaths of humans (the total is greater than 53 because some attacks had more than one victim).[142] By 2004, the count had climbed to 88 attacks and 20 deaths.[143]

Within North America, the distribution of attacks is not uniform. The heavily populated state of California has seen a dozen attacks since 1986 (after just three from 1890 to 1985), including three fatalities.[92] Lightly populated New Mexico reported an attack in 2008, the first there since 1974.[144]

As with many predators, a cougar may attack if cornered, if a fleeing human stimulates their instinct to chase, or if a person "plays dead". Standing still however may cause the cougar to consider a person easy prey.[145] Exaggerating the threat to the animal through intense eye contact, loud but calm shouting, and any other action to appear larger and more menacing, may make the animal retreat. Fighting back with sticks and rocks, or even bare hands, is often effective in persuading an attacking cougar to disengage.[12][94]

When cougars do attack, they usually employ their characteristic neck bite, attempting to position their teeth between the vertebrae and into the spinal cord. Neck, head, and spinal injuries are common and sometimes fatal.[12] Children are at greatest risk of attack, and least likely to survive an encounter. Detailed research into attacks prior to 1991 showed that 64% of all victims – and almost all fatalities – were children. The same study showed the highest proportion of attacks to have occurred in British Columbia, particularly on Vancouver Island where cougar populations are especially dense.[142] Preceding attacks on humans, cougars display aberrant behavior, such as activity during daylight hours, a lack of fear of humans, and stalking humans. There have sometimes been incidents of pet cougars mauling people.[146][147]

See also[edit]

References[edit]

  1. ^ a b c d Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 544–45. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d Caso, A., Lopez-Gonzalez, C., Payan, E., Eizirik, E., de Oliveira, T., Leite-Pitman, R., Kelly, M., Valderrama, C. & Lucherini, M. (2008). Puma concolor. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved March 22, 2009. Database entry includes justification for why this species is least concern
  3. ^ Guerrero, J. H. M.; ., M. E. P. S.; Ramos, J. J. Z.; Alferez, F. R.; Herrera Ca, H. (2010). "Report of Physaloptera praeputialis (Von Linstow 1889, Nematoda) in Mountain Lion (Puma concolor, Linneaus 1771)". Journal of Animal and Veterinary Advances 9 (3): 601. doi:10.3923/javaa.2010.601.603.  edit
  4. ^ a b c d e f g Iriarte, J. Agustin; Franklin, William L.; Johnson, Warren E. and Redford, Kent H. (1990). "Biogeographic variation of food habits and body size of the America puma". Oecologia 85 (2): 185. doi:10.1007/BF00319400. 
  5. ^ Cougars. US National Park Service.
  6. ^ Hansen, Kevin. (1992) Cougar: The American Lion. Northland. Flagstaff, AZ, ch. 4, ISBN 0873585445.
  7. ^ http://www.wildlife.state.nm.us/conservation/cougar/CougarEducationBooklet_1-31-11.pdf
  8. ^ http://sagehen.ucnrs.org/Documents/visitors/wildlife/lion.pdf
  9. ^ The Domestication of the Cat
  10. ^ Small Wild Cat Species
  11. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 544–46. ISBN 978-0-8018-8221-0. OCLC 62265494
  12. ^ a b c d McKee, Denise (2003). "Cougar Attacks on Humans: A Case Report". Wilderness and Environmental Medicine (Wilderness Medical Society) 14 (3): 169–73. doi:10.1580/1080-6032(2003)14[169:CAOHAC]2.0.CO;2. PMID 14518628. 
  13. ^ Shot fells elusive cougar chased out of a culvert. StarTribune.com (December 1, 2011). Retrieved on April 29, 2013.
  14. ^ [1] Missouri Department of Conversation, mdc.mo.gov (20 Mar 2014)
  15. ^ "Extinct? Cougar sightings on the rise in eastern United States". Daily Mail (London). January 22, 2012. 
  16. ^ Mountain Lion Shot Early Friday Morning in Monona County. Iowa Department of Natural Resources, iowadnr.gov (December 23, 2011)
  17. ^ Mountain lion shot by police in Monona County – KWWL.com – News & Weather for Waterloo, Dubuque, Cedar Rapids & Iowa City, Iowa |. KWWL.com. Retrieved on April 29, 2013.
  18. ^ "The Cougar Network – Using Science to Understand Cougar Ecology". Cougarnet.org. Retrieved February 16, 2011. 
  19. ^ "Trail cam photo of cougar in the eastern Upper Peninsula". Twitpic.com. November 5, 2009. Retrieved February 16, 2011. 
  20. ^ "Indiana confirms mountain lion in Green County". Poorboysoutdoors.com. May 10, 2010. Archived from the original on 2010-07-11. Retrieved February 16, 2011. 
  21. ^ "Mountain lion killed in Conn. had walked from S. Dakota". USA Today. July 26, 2011. Retrieved October 27, 2012. 
  22. ^ "Connecticut Mountain Lion Likely Came From The Black Hills". NPR News. Retrieved July 28, 2011. 
  23. ^ Barringer, Felicity (March 2, 2011). "Eastern Cougar Is Declared Extinct". The New York Times. Retrieved March 2, 2011. 
  24. ^ George A. Jackson (1935). "George A. Jackson's Diary of 1858–1859". In Roy LeHafen. Colorado Magazine 6. pp. 201–214. 
  25. ^ "painter". transcription of the American Heritage Dictionary, Bartleby.com. Archived from the original on 2001-03-13. Retrieved March 8, 2009. 
  26. ^ The Guinness Book of World Records. 2004. p. 49. 
  27. ^ "Words to the Wise". Take Our Word for it (205): 2. Retrieved July 31, 2012. 
  28. ^ Harper, Douglas. "jaguar". Online Etymology Dictionary. 
  29. ^ "cougar". Merriam-Webster Dictionary Online. 
  30. ^ "cougar". Oxford Dictionaries Online, Oxford University Press. 1989. 
  31. ^ "The Puma". Projeto Puma. Archived from the original on 2007-07-06. Retrieved July 31, 2012. 
  32. ^ Wade, Nicholas (January 6, 2006). "DNA Offers New Insight Concerning Cat Evolution". New York Times. Retrieved June 3, 2007. 
  33. ^ a b c d Johnson, W.E., Eizirik, E., Pecon-Slattery, J., Murphy, W.J., Antunes, A., Teeling, E. & O'Brien, S.J. (January 6, 2006). "The Late Miocene radiation of modern Felidae: A genetic assessment". Science 311 (5757): 73–77. doi:10.1126/science.1122277. PMID 16400146. Retrieved June 4, 2007. 
  34. ^ a b c d e Culver, M.; Johnson, W.E., Pecon-Slattery, J., O'Brien, S.J. (2000). "Genomic Ancestry of the American Puma". Journal of Heredity 91 (3): 186–97. doi:10.1093/jhered/91.3.186. PMID 10833043. 
  35. ^ Barnett, Ross; Ian Barnes, Matthew J. Phillips, Larry D. Martin, C. Richard Harington, Jennifer A. Leonard, and Alan Cooper (August 9, 2005). "Evolution of the extinct Sabretooths and the American cheetah-like cat". Current Biology 15 (15): R589–R590. doi:10.1016/j.cub.2005.07.052. PMID 16085477. Retrieved June 4, 2007. 
  36. ^ a b Conroy, Michael J.; Beier, Paul; Quigley, Howard and Vaughan, Michael R. (2006). "Improving The Use Of Science In Conservation: Lessons From The Florida Panther". Journal of Wildlife Management 70 (1): 1–7. doi:10.2193/0022-541X(2006)70[1:ITUOSI]2.0.CO;2. 
  37. ^ The Florida Panther Recovery Team (January 31, 2006). "Florida Panther Recovery Program (Draft)" (PDF). U.S. Fish and Wildlife Service. Archived from the original on June 16, 2007. Retrieved June 11, 2007. 
  38. ^ Expanding Cougar Population The Cougar Net.org
  39. ^ Florida Panther Facts. Florida Panther Refuge
  40. ^ "Mountain Lion (Puma concolor)". Texas Parks and Wildlife. Retrieved March 30, 2007. 
  41. ^ a b "Eastern Cougar Fact Sheet". New York State Department of Environmental Conservat ion. Retrieved March 30, 2007. 
  42. ^ a b Shivaraju, A. (2003) Puma concolor. Animal Diversity Web, University of Michigan Museum of Zoology. Retrieved on September 15, 2011.
  43. ^ a b c d e f g h i j Nowell, K. and Jackson, P (2006). Wild Cats. Status Survey and Conservation Action Plan (PDF). IUCN/SSC Cat Specialist Group. IUCN, Gland, Switzerland. Retrieved July 27, 2007. 
  44. ^ "Puma concolor – Mountain Lion – Discover Life". Pick4.pick.uga.edu. Retrieved February 16, 2011. 
  45. ^ Brakefield, Tom (1993). Big Cats: Kingdom of Might. Voyageur Press. ISBN 0-89658-329-5. 
  46. ^ Spalding, D. J. "Cougar in British Columbia". British Columbia Fish and Wildlife Branch. 
  47. ^ a b c "Cougar". Hinterland Who's Who. Canadian Wildlife Service and Canadian Wildlife Federation. Archived from the original on 2007-05-18. Retrieved May 22, 2007. 
  48. ^ Weissengruber, GE; G Forstenpointner, G Peters, A Kübber-Heiss, and WT Fitch (2002). "Hyoid apparatus and pharynx in the lion (Panthera leo), jaguar (Panthera onca), tiger (Panthera tigris), cheetah (Acinonyx jubatus) and domestic cat (Felis silvestris f. catus)". Journal of Anatomy (Anatomical Society of Great Britain and Ireland) 201 (3): 195–209. doi:10.1046/j.1469-7580.2002.00088.x. PMC 1570911. PMID 12363272. 
  49. ^ Hornocker, Maurice G. and Negri, Sharon (December 15, 2009). Cougar: ecology and conservation. University of Chicago Press. pp. 114–. ISBN 978-0-226-35344-9. Retrieved September 15, 2011. 
  50. ^ "About Eastern Cougars". Eastern Cougar Foundation. Retrieved June 3, 2007. 
  51. ^ "Black cougar more talk than fact". Tahlequah Daily Press. February 1, 2006. Retrieved May 20, 2007. "Game Warden: Never in the history of the United States has there ever been, in captivity or in the wild, a documented black mountain lion" 
  52. ^ "Mutant Pumas". messybeast.com. 
  53. ^ "Mountain Lion (Puma, Cougar)". San Diego Zoo.org. Zoological Society of San Diego. Retrieved April 2, 2007. 
  54. ^ Cougar: Puma concolor: A Saskatchewan Species at Risk. Saskatoon Zoo Society, Canada.
  55. ^ Cougar. bluelion.org.
  56. ^ Hansen, Kevin (1990). "Ch. 4 – An Almost Perfect Predator". Cougar: The American Lion. Mountain Lion Foundation. 
  57. ^ "Cougar". Zoological Wildlife Foundation. Retrieved October 31, 2012. 
  58. ^ Mountain Lion FAQ and Facts. Mountainlion.org. Retrieved on April 29, 2013.
  59. ^ a b c "Mountain Lion, Felis concolor". Sierra Club. Retrieved May 20, 2007. 
  60. ^ Turner, John W.; Morrison, Michael L. (2008). "Influence of Predation by Mountain Lions on Numbers and Survivorship of a Feral Horse Population". The Southwestern Naturalist 46 (2): 183–190. doi:10.2307/3672527. JSTOR 3672527. 
  61. ^ a b "Wildlife: Wolves". Yellowstone National Park. Retrieved April 8, 2007. 
    * Holly Akenson, James Akenson, Howard Quigley. "Winter Predation and Interactions of Wolves and Cougars on Panther Creek in Central Idaho". 
    * John K. Oakleaf, Curt Mack, Dennis L. Murray. "Winter Predation and Interactions of Cougars and Wolves in the Central Idaho Wilderness". 
  62. ^ Ross, R.; Jalkotzy, MG., Festa-Bianchet, M. (1993). "Cougar predation on bighorn sheep in southwestern Alberta during winter". Canadian Journal of Zoology 75 (5): 771–75. doi:10.1139/z97-098. 
  63. ^ Whitaker, John O. The Audubon Society Field Guide to North American Mammals. Chanticleer Press, New York, 1980, pg. 598. ISBN 0-394-50762-2.
  64. ^ Bauer, Jim W.; Kenneth A. Logan, Linda L. Sweanor, Walter M. Boyce (December 2005). "Scavenging behavior in Puma". In Jones, Cheri A. The Southwestern Naturalist 50 (4): 466–471. doi:10.1894/0038-4909(2005)050[0466:SBIP]2.0.CO;2. 
  65. ^ a b c d e Cougar Discussion Group (January 27, 1999). "Utah Cougar Management Plan (Draft)" (PDF). Utah Division of Wildlife Resources. Retrieved May 2, 2007. 
  66. ^ a b "Cougars in Canada (Just the Facts)". Canadian Geographic Magazine. Retrieved April 2, 2007. 
  67. ^ a b Hamilton, Matthew; Hundt, Peter and Piorkowski, Ryan. "Mountain Lions". University of Wisconsin, Stevens Point. Retrieved May 10, 2007. 
  68. ^ Bonier, F., H. Quigley, S. Austad (2004). "A technique for non-invasively detecting stress response in cougars". Wildlife Society Bulletin 32 (3): 711–717. doi:10.2193/0091-7648(2004)032[0711:ATFNDS]2.0.CO;2. 
  69. ^ "Staying safe in cougar country". Wildlife.utah.gov. Retrieved October 6, 2011. 
  70. ^ a b Sweanor, Linda; Kenneth A. Logan, Maurice G. Hornocker (2000). "Cougar Dispersal Patterns, Metapopulation Dynamics, and Conservation". Conservation Biology 14 (3): 798–808. doi:10.1046/j.1523-1739.2000.99079.x. 
  71. ^ "Scratch". bigcatrescue.org. Archived from the original on November 19, 2008. Retrieved August 21, 2009. 
  72. ^ Biek, Roman; Allen G. Rodrigo, David Holley, Alexei Drummond, Charles R. Anderson Jr., Howard A. Ross, and Mary Poss (September 2003). "Epidemiology, Genetic Diversity, and Evolution of Endemic Feline Immunodeficiency Virus in a Population of Wild Cougars". Journal of Virology 77 (17): 9578–89. doi:10.1128/JVI.77.17.9578-9589.2003. PMC 187433. PMID 12915571. Retrieved May 22, 2007. 
  73. ^ a b Mahaffy, James (December 2004). "Behavior of cougar in Iowa and the Midwest". Dordt College. Retrieved May 11, 2007. 
  74. ^ "Mountain Lion (Felis concolor) study on Boulder Open Space" (PDF). Letter to the Parks and Open Space Advisory Committee, Boulder, Colorado. Sinapu. March 22, 2007. Archived from the original on 2007-06-16. Retrieved May 11, 2007. 
  75. ^ Marschall, Laurence A. (March 2005). "Bookshelf". Natural Selections. Natural History Magazine. Retrieved May 6, 2007. 
  76. ^ Belanger, Joe (May 25, 2007). "DNA tests reveal cougars roam region". London Free Press. Retrieved June 5, 2007. 
  77. ^ Board of Directors (2004). "The "Big" Picture". The Cougar Network. Retrieved May 20, 2007.  The Cougar Network methodology is recognized by the U.S. Fish and Wildlife Service.
  78. ^ "Your part in helping endangered species". Ministry of Wildlife and Natural Resources, Quebec, Canada. 2010. Retrieved January 7, 2010. 
  79. ^ Davidson, Rick (2009). "NH Sightings Catamount" (PDF). Beech River Books. Retrieved March 20, 2009. 
  80. ^ Skinner, Victor (November 15, 2009). "Photo shows cougar presence in Michigan". The Grand Rapids Press. Retrieved February 16, 2011. 
  81. ^ "Cedar Rapids man shoots mountain lion in Iowa County". Cedar Rapids Gazette. December 15, 2009. Retrieved December 16, 2009. 
  82. ^ Carlson, James A. (April 22, 2009). "Sightings show cougars expanding into central US". Seattle Times. Retrieved April 22, 2009. 
  83. ^ "DNR confirms Indiana mountain lion sighting". WISHTV8.com. May 7, 2010. 
  84. ^ "Mountain lion reportedly spotted roaming Connecticut town". Fox News. June 10, 2011. Retrieved June 12, 2011. 
  85. ^ "Mountain Lion killed by car on Connnecticut highway". CNN. June 11, 2011. 
  86. ^ David Baron The Cougar Behind Your Trash Can. New York Times. July 29, 2011
  87. ^ "Cougar photographed in Morgan County". The State Journal-Register. October 29, 2012. Archived from the original on 2013-11-02. Retrieved October 31, 2012. 
  88. ^ "Jury's still out, but Pike County cougar sighting could be state's third in two months". The State Journal-Register. November 11, 2012. Retrieved November 13, 2012. 
  89. ^ "Timeline Photos". Facebook. November 21, 2013. Retrieved November 21, 2013. 
  90. ^ "Cougar facts" (PDF). National Wildlife Federation. Archived from the original on 2007-02-21. Retrieved May 20, 2007. 
  91. ^ "Cougar Management Plan". Wildlife Division: Wildlife Management Plans. Oregon Department of Fish and Wildlife. 2006. Retrieved May 20, 2007. 
  92. ^ a b c "Mountain Lions in California". California Department of Fish and Game. 2004. Archived from the original on April 30, 2007. Retrieved May 20, 2007. 
  93. ^ Research of Nicolás Guarda, supported by Conaf, Pontifical Catholic University of Chile, and a private Enterprise. See article in Chilean newspaper La Tercera, Investigación midió por primera vez población de pumas en zona central, retrieved on January 28, 2013, in Spanish Language.
  94. ^ a b c "Safety Guide to Cougars". Environmental Stewardship Division. Government of British Columbia, Ministry of Environment. 1991. Retrieved May 28, 2007. 
  95. ^ COSEWIC. Canadian Wildlife Service (2002). Assessment and Update Status Report on the Grizzly Bear (Ursus arctos) (PDF). Environment Canada. Retrieved April 8, 2007. 
  96. ^ "S. C. Turnbo: A Fight to a Finish Between a Bear and Panther". thelibrary.org. 
  97. ^ "S. C. Turnbo: Finding a Panther Guarding a Dead Bear". thelibrary.org. 
  98. ^ "Cougar vs Bears Accounts". Everything about the Cougar/Mountain Lion. Retrieved 2013-06-15. 
  99. ^ Hornocker, M., and S. Negri (Eds.). (2009). Cougar: ecology and conservation. University of Chicago Press. Chicago, IL, ISBN 0226353443.
  100. ^ "Park wolf pack kills mother cougar". forwolves.org. Retrieved 12 April 2013. 
  101. ^ Gugliotta, Guy (May 19, 2003). "In Yellowstone, it's Carnivore Competition". Washington Post. Retrieved April 9, 2007. 
  102. ^ "Wolf B4 Killed by Mountain Lion?". forwolves.org. Retrieved 3/25/96. 
  103. ^ "Autopsy Indicates Cougar Killed Wolf". igorilla.com. Retrieved April 2000. 
  104. ^ "Mountain lions kill collared wolves in Bitteroot". missoulian.com. Retrieved 29 May 2012. 
  105. ^ "Overview: Gray Wolves". Greater Yellowstone Learning Center. Archived from the original on September 29, 2007. Retrieved April 9, 2007. 
  106. ^ "Predators clash above Elkhorn". Idaho Mountain Express. Retrieved August 21, 2013. 
  107. ^ Cockle, Richard (October 29, 2006). "Turf wars in Idaho's wilderness". The Oregonian. Retrieved April 9, 2007. 
  108. ^ "Cougars vs. coyotes photos draw Internet crowd". missoulian.com. Retrieved 8 April 2013. 
  109. ^ Hamdig, Paul. "Sympatric Jaguar and Puma". Ecology Online Sweden. Archived from the original on July 16, 2006. Retrieved August 30, 2006. 
  110. ^ Rodrigo Nuanaez, Brian Miller, and Fred Lindzey (2000). "Food habits of jaguars and pumas in Jalisco, Mexico". Journal of Zoology 252 (3): 373. doi:10.1111/j.1469-7998.2000.tb00632.x. 
  111. ^ Robinson, Hugh S.; Robert B. Wielgus, and John C. Gwilliam (2002). "Cougar predation and population growth of sympatric mule deer and white-tailed deer". Canadian Journal of Zoology 80 (3): 556–68. doi:10.1139/z02-025. 
  112. ^ Bryant, Andrew A.; Page, Rick E. (May 2005). "Cougar predation and population growth of sympatric mule deer and white-tailed deer". Canadian Journal of Zoology 83 (5): 674–82. doi:10.1139/z05-055. 
  113. ^ Fountain, Henry (November 16, 2009) "Observatory: When Mountain Lions Hunt, They Prey on the Weak". New York Times.
  114. ^ Weaver, John L.; Paquet, Paul C.; Ruggiero, Leonard F. (1996). "Resilience and Conservation of Large Carnivores in the Rocky Mountains". Conservation Biology 10 (4): 964. doi:10.1046/j.1523-1739.1996.10040964.x. 
  115. ^ Busch, Robert H. The Cougar Almanac. New York, 2000, pg 94. ISBN 1592282954.
  116. ^ "Geocites – Liger & Tigon Info". Archived from the original on October 15, 2007. Retrieved June 9, 2008. 
  117. ^ "Appendices I, II and III". Convention on International Trade in Endangered Species of Wild Fauna and Flora. Retrieved May 24, 2007. 
  118. ^ Bolgiano, Chris (August 1995). Mountain Lion:An Unnatural History of Pumas and People (Hardcover ed.). Mechanicsburg, PA: Stackpole Books. ISBN 978-0-8117-1044-2. 
  119. ^ Eberhart, George M. (2002). Mysterious Creatures: A Guide to Cryptozoology. Volume 2. Santa Barbara, CA: ABC-CLIO. pp. 153–161. ISBN 1-57607-283-5. 
  120. ^ "Eastern Cougar". Endangered and Threatened Species of the Southeastern United States (The Red Book). U.S. Fish and Wildlife Service. 1991. Archived from the original on April 3, 2007. Retrieved May 20, 2007. 
  121. ^ "Florida Panther". Endangered and Threatened Species of the Southeastern United States (The Red Book). United States Fish and Wildlife Service. 1993. Archived from the original on June 4, 2007. Retrieved June 7, 2007. 
  122. ^ "Florida Fish and Wildlife Conservation Commission. 2002–2003 Panther Genetfic Restoration Annual Report" (PDF). Archived from the original on June 16, 2007. Retrieved June 5, 2007. 
  123. ^ Barringer, Felicity (March 2, 2011). "U.S. Declares Eastern Cougar Extinct, With an Asterisk". The New York Times. Retrieved March 2, 2011. 
  124. ^ Committee on Status of Endangered Wildlife in Canada. Cosewic.gc.ca. Retrieved on September 15, 2011.
  125. ^ Eastern Cougar, Nature Canada. Naturecanada.ca. Retrieved on September 15, 2011.
  126. ^ TPWD: Mountain Lions. Tpwd.state.tx.us (July 16, 2007). Retrieved on September 15, 2011.
  127. ^ "Bay Area Puma Project (BAPP)". Felidae Conservation Fund. Archived from the original on 2010-03-23. Retrieved March 8, 2009. 
  128. ^ Beier, Paul (March 1993). "Determining Minimum Habitat Areas and Habitat Corridors for Cougars". Conservation Biology 7 (1): 94–108. doi:10.1046/j.1523-1739.1993.07010094.x. JSTOR 2386646. 
  129. ^ Northeast Region, U.S. Fish and Wildlife Service. Fws.gov. Retrieved on September 15, 2011.
  130. ^ Berrin, Katherine & Larco Museum. The Spirit of Ancient Peru:Treasures from the Museo Arqueológico Rafael Larco Herrera. New York: Thames and Hudson, 1997.
  131. ^ Tarmo, Kulmar; Kait Realo (translator). "On the role of Creation and Origin Myths in the Development of Inca State and Religion". Electronic Journal of Folklore. Estonian Folklore Institute. Retrieved May 22, 2007. 
  132. ^ Cougars, The Encyclopedia of Hočąk (Winnebago) Mythology. Retrieved: 2009/12/08.
  133. ^ "Living with Wildlife: Cougars" (PDF). USDA Wildlife Services. Retrieved April 11, 2009. 
  134. ^ Matthews, John and Matthews, Caitlín (2005). The Element Encyclopedia of Magical Creatures. HarperElement. p. 364. ISBN 978-1-4351-1086-1. 
  135. ^ "Cattle report 1990". National Agricultural Statistics Service. Retrieved September 11, 2009. 
  136. ^ "Sheep and Goats report 1990". National Agricultural Statistics Service. Retrieved September 11, 2009. 
  137. ^ "Mountain Lion Fact Sheet". Abundant Wildlife Society of North America. Retrieved July 10, 2008. 
  138. ^ "Cougar Predation – Description". Procedures for Evaluating Predation on Livestock and Wildlife. Retrieved August 3, 2008. 
  139. ^ Kaylie A. Peebles, Robert B. Wielgus, Benjamin T. Maletzke, Mark E. Swanson (2013-11). "Effects of Remedial Sport Hunting on Cougar Complaints and Livestock Depredations". PLOS One 8 (11). Retrieved 2013-12-28. 
  140. ^ Paul Beier (1991). "Cougar attacks on humans in the United States and Canada". Wildlife Society Bulletin 19: 403–412. Retrieved 2013-12-28. 
  141. ^ Torres SG, Mansfield TM, Foley JE, Lupo T, Brinkhaus A (1996). "Mountain lion and human activity in California: testing speculations". Wildlife Society Bulletin 24 (3): 451–460. Retrieved 2013-12-28. 
  142. ^ a b Beier, Paul (1991). "Cougar attacks on humans in United States and Canada". Wildlife Society Bulletin. Northern Arizon University. Retrieved May 20, 2007. 
  143. ^ "Confirmed mountain lion attacks in the United States and Canada 1890 – present". Arizona Game and Fish Department. Retrieved May 20, 2007. 
  144. ^ New Mexico Department of Game and Fish: Search continues for mountain lion that killed Pinos Altos man, June 23, 2008; Wounded mountain lion captured, killed near Pinos Altos, June 25, 2008; Second mountain lion captured near Pinos Altos, July 1, 2008
  145. ^ Subramanian, Sushma (April 14, 2009). "Should You Run or Freeze When You See a Mountain Lion?". Scientific American. Retrieved March 10, 2012. 
  146. ^ "Neighbor saves Miami teen from cougar". MSNBC. Associated Press. November 16, 2008. Retrieved February 11, 2012. 
  147. ^ "2-Year-Old Boy Hurt In Pet Cougar Attack". New York Times. June 4, 1995. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Felis. Placed in the genus Puma by Wozencraft (in Wilson and Reeder 1993, 2005) and Jones et al. (1997).

Mitochondrial DNA analysis by Culver et al. (2000) revealed genetic uniformity across all regions of North America, relative to Central and South American populations, Culver et al. (2000) postulate that cougars were extirpated from North America during the Pleistocene extinctions of many large mammals, and only recently (circa 10,000 years ago) reinvaded North America; they suggest only one subspecies should be recognized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

mountain lion
cougar
puma
panther
Yuma puma
Florida panther
eastern cougar
Wisconsin puma
Texas panther

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name for the mountain lion is Puma
concolor Linnaeus [63]. It is in the family Felidae and subfamily Felinae.
Thirty subspecies are generally recognized worldwide. Thirteen of these
occur in North America north of Mexico [12,19]:

P. concolor azteca Merriam
P. concolor browni Merriam (Yuma puma)
P. concolor californica May
P. concolor coryi Bangs (Florida panther)
P. concolor couguar Kerr (eastern cougar)
P. concolor hippolestes Merriam
P. concolor kaibabensis Nelson and Goldman
P. concolor missoulensis Goldman
P. concolor olympus Merriam
P. concolor oregonensis (Rafinesque)
P. concolor shorgeri Jackson (Wisconsin puma)
P. concolor stanleyana Goldman (Texas panther)
P. concolor vancouverensis Nelson and Goldman
  • 12. Currier, Mary Jean P. 1983. Felis concolor. Mammalian Species No. 200: 1-7. [24559]
  • 19. Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons. 1271 p. [14765]
  • 63. Baker, Robert J.; Bradley, Lisa C.; Bradley, Robert D.; Dragoo, Jerry W.; Engstrom, Mark D.; Hoffmann, Robert S.; Jones, Cheri A.; Reid, Fiona; Rice, Dale W.; Jones, Clyde. 2003. Revised checklist of North American mammals north of Mexico, 2003. Occasional Papers No. 229. Lubbock, TX: Museum of Texas Tech University. 23 p. [50946]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!