Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Biology

Pumas are solitary cats, with the exception of one to six day associations during mating periods and contact between females and their young (8). Males occupy large territories that overlap those of several females; the boundaries of the territory are marked by scrapes left in prominent positions (3). Females advertise their receptivity to mating with loud scream-like calls (5). Mating occurs year-round, but is concentrated from December to March in northern latitudes (8). The female gives birth to her litter of between one and six kittens within a den; the kittens are initially blind and helpless, remaining in the den whilst their mother forages for food (3) (8). At around two months of age they are able to accompany their mother on hunting forays and remain with her until around 1.5 to 2 years old (9). Pumas are primarily nocturnal and crepuscular, being most active at dawn and dusk, and rarely emerging in the day (3). These agile yet powerful cats hunt by stalking and ambushing their prey (6). Pumas predominantly feed on ungulates, but are known to occasionally take smaller prey (10). In the northern areas of their range, they feed primarily on large ungulates, including elk and occasionally domestic cattle, whereas in tropical areas their diet seems to consist of more medium-sized prey (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Cougars avoid open habitats such as flat, shrubless deserts and farm fields, but can make a living in swamps, forests, and desert scrub habitat. They live solitary lives at low population densities, and usually avoid humans, but about four attacks are reported annually in the United States and Canada. Cougars hunt at night, either stalking their prey or waiting in ambush to pounce. They take hoofed mammals, sometimes including domestic livestock, and other prey, including rabbits, hares, porcupines, bobcats, coyotes, beavers, opossums, skunks, and even other Cougars. They rarely bed down in the same place two days in a row unless they are watching young or consuming a large kill. Some states and provinces allow Cougars to be hunted for sport

Links:
Mammal Species of the World
Visit ARKive for more images of the Florida panther  More images, video and sound of the Florida panther, a subspecies
  • Original description: Linné, Carl von, 1771.  Mantissa Plantarum altera, Generum editionis VI et Specierum ed., Supplement to Genera Plantarum and Species Plantarum.  Holmiæ: Impensis Direct. L. Salvii, 2:522.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Description

Other than man, this large, slender cat has the greatest natural distribution of any terrestrial mammal in the Western Hemisphere (5). The puma, also known as the cougar, mountain lion and panther, is powerfully built and extremely agile. These cats are characterised by a long body with unusually long hindlimbs, thought to be an adaptation to bursts of high-speed running and jumping, used to chase and ambush prey (5) (6). The cat has a long neck, a small, broad head, short, rounded ears that are black on the back, and a long, cylindrical tail with a black tip (5) (6). The coat is of uniform colour, hence the Latin name, concolor, varying from silvery-grey through tawny-yellow to light reddish brown (3) (7). The throat, chest and belly are a pale buff to whitish colour (8) and the sides of the muzzle are framed in black (5). Faint horizontal stripes may occasionally be seen on the upper forelegs, and melanism has been widely reported though not confirmed (3) (5). Young kittens are spotted, with blue eyes (3). Males rarely weigh more than 100 kilograms, and depending on sex and age, tend to be larger in the north of their range (3), and the coat is generally longer to insulate against extreme temperatures (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The geographic range of the puma is the largest of any terrestrial mammal in the Western Hemisphere (Sunquist and Sunquist 2002), from Canada through the US, Central and South America to the southern tip of Chile. While the puma is an adaptable cat, being found in every major habitat type of the Americas, including the high Andes (5,800 m in southern Peru: Sunquist and Sunquist 2002), it was eliminated from the entire eastern half of North America within 200 years following European colonization (Nowell and Jackson, 1996). A remnant Endangered subpopulation persists in Florida, and records of pumas in northeastern Canada and the eastern US are on the rise, indicating possible recolonization (M. Kelly pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Historically, mountain lions had the most extensive distribution of all American terrestrial mammals. They ranged from coast to coast in North America, and from southern Argentina and Chile to southeastern Alaska. Extermination efforts, hunting pressure, and habitat destruction have restricted their range to relatively mountainous, unpopulated areas throughout much of their range. Populations in eastern North America were entirely exterminated, except for a small population of Florida panthers (Puma concolor coryi). In recent years populations have begun to expand into areas of human habitation, especially in the western United States. Mountain lions are now fairly common in suburban areas of California and have recently been sighted as far east as urban Kansas City, Missouri, where several have been hit by cars. Mountain lion sightings in eastern North America, outside of southern Florida, are still more likely to be escaped or abandoned "pet" mountain lions or other large cats.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Historically had widest distribution of any native American mammal (other than humans); from Canada south to southern Chile and southern Argentina and from the Pacific to the Atlantic coast. In eastern North America, now definitely known to occur only in southern Florida and Upper Peninsula of Michigan (Evers 1992). Possibly a small population exists in southeastern Canada; see Stocek (1995) for a review of recent reports from the Maritime Provinces. Elsewhere in North America, currently restricted mainly to mountainous, relatively unpopulated areas. Sea level to 14,800 ft.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Canada to South America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widespread, ranging from areas in Canada, down through the United States, south to Central and South America. However, the species' range has greatly retracted, having been eliminated from the almost the entire eastern half of Northern America following European colonisation (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mountain lions are large, slender cats. The pelage has a short and coarse texture. The general coloration ranges from a yellowish brown to grayish brown on the upper parts and a paler, almost buffy, color on the belly. The throat and chest are whitish. Mountain lions have a pinkish nose with a black border that extends to the lips. The muzzle stripes, the area behind ears, and the tip of tail are black. The eyes of mature animals are grayish brown to golden. The tail is long, cylindrical, and about one-third of the animal's total length. The limbs are short and muscular. The feet are broad, with four digits on hind feet and five on forefeet. The pollex is small and set above the other digits. The retractile claws are sharp and curved. The skull is noticeably broad and short. The forehead region is high and arched. The rostrum and the nasal bones are broad. The dental formula is 3/3 1/1 3/2 1/1. The mandible is short, deep, and powerfully constructed. The carnassial teeth are massive and long. The canines are heavy and compressed. The incisors are small and straight. Mountain lions have one more small premolar on each side of the upper jaw than do bobcats and lynx.

Males are larger than females. Head and body length ranges from 1020 to 1540 mm in males and 860 to 1310 mm in females. Tail length ranges from 680 to 960 mm in males and 630 to 790 mm in females. Males weigh from 36 to 120 kg and females from 29 to 64 kg.

Range mass: 29 to 120 kg.

Range length: 860 to 1540 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 49.326 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 274 cm

Weight: 120000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are significantly heavier than females.

Length:
Average: 1,270 mm males; 1,140 mm females
Range: 1,020-1,540 mm males; 860-1,310 mm females

Weight:
Average: 62 kg males; 42 kg females
Range: 36-120 kg males; 29-64 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the jaguarundi in much larger size (maximum total length of jaguarundi is 137 cm). Differs from the lynx and bobcat in having a much longer tail (less than 25 cm in bobcat and lynx). Differs from other cats in lack of spotting in adult pelage. Young mountain lion differs from the ocelot in having the spot not arranged in rows or chainlike streaks. See Hoffmeister (1986) for cranial differences between mountain lion and jaguar.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is found in a broad range of habitats, in all forest types as well as lowland and montane desert. Several studies have shown that habitat with dense understory vegetation is preferred, however, pumas can live in very open habitats with only a minimum of vegetative cover (Nowell and Jackson 1996). Pumas co-occur with jaguars in much of their Latin American range, and may favor more open habitats than their larger competitor, although both can be found in dense forest (Sunquist and Sunquist 2002).

Pumas are capable of taking large prey, but when available small to medium-sized prey are more important in their diet (in tropical portions of the range). This is true of wild prey as well as livestock (IUCN Cats Red List workshop, 2007). In North America, deer make up 60-80% of the puma's diet, and the mean weight of prey taken is 39-48 kg. In Florida, however, where deer numbers are low, pumas take smaller prey including feral pigs, raccoons and armadilllos, and deer account for only about 1/3 of the diet (Sunquist and Sunquist 2002).

Home range sizes of pumas vary considerably across their geographic distribution, and the smallest ranges tend to occur in areas where prey densities are high and prey are not migratory (Sunquist and Sunquist 2002). In North America, home range sizes ranged from 32-1,031 km² (Lindzey et al. 1987).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Mountain lions use a wide variety of habitats including montane coniferous forests, lowland tropical forests, grassland, dry brush country, swamps, and any areas with adequate cover and prey. Dense vegetation, caves, and rocky crevices provide shelter.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Now associated generally with mountainous or remote undisturbed areas. May occupy wide variety of habitats: swamps, riparian woodlands, broken country with good cover of brush or woodland. Beier (1993) determined that habitat areas of at least 2200 sq km are needed to ensure long-term population persistence; protection of corridors for immigration is highly desirable. Young are born in secluded places among rocks or dense vegetation (e.g., see Beier et al. 1995, Bleich et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The puma is highly adaptable, found in a diverse range of habitats, from arid desert to tropical rainforest to cold coniferous forest, from sea level up to 5,800 metres in the Andes (3) (5). Studies have shown that habitat with dense understorey vegetation is preferred, but these cats can also live in open areas with sparse vegetative cover (3). Although terrestrial, pumas can swim and climb trees when they need to (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In Idaho, migrates between fairly distinct but usually contiguous winter-spring and summer-fall home areas (Seidensticker et al. 1973). In California, some lions migrated together, often slowly, following movements of mule deer, between winter and summer ranges; other lions migrated quickly, crossed the Sierra Nevada crest, and summered in a disjunct range with lions not sharing their winter range (Pierce et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mountain lions are carnivores. Their main prey throughout their range are different species of ungulates, including moose, elk, white-tailed deer, mule deer, and caribou in North America. They will also eat smaller creatures like squirrels, muskrat, porcupine, beaver, raccoon, striped skunk, coyote, bobcats, other mountain lions, rabbits, opossums, birds, and even snails and fish. They may also prey on domestic livestock, including poultry, calves, sheep, goats, and pigs. Mountain lions have a distinctive manner of hunting larger prey. The lion quietly stalks the prey animals, then leaps at close range onto their back and breaks the animal's neck with a powerful bite below the base of the skull. Yearly food consumption is between 860 to 1,300 kg of large prey animals, about 48 ungulates per lion per year. Mountain lions cache large prey, dragging it up to 350 meters from the place of capture and burying it under leaves and debris. They return nightly to feed.

Animal Foods: birds; mammals; fish; mollusks

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primary food is deer in many areas. Highly opportunistic, also eats various large and small mammals (bighorn sheep, livestock, coyote, squirrels, rabbits, mice, etc.), insects, and reptiles. In Peru and Chile, rodents and lagomorphs, respectively, were important prey (see Hansen 1992). Unused remains of prey are covered for later consumption. Stalks prey from ground. In southern California, on average, an adult killed about 48 large and 58 small mammals per year and fed for an average of 2.9 days on a single large mammal (Beier et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Mountain lions are important as top predators in the ecosystems in which they live. They are instrumental in controlling populations of large ungulates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mountain lions are top predators. They may be preyed on by other mountain lions, wolves, or bear when they are young or ill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Puma concolor is prey of:
Ursidae
Canis lupus
Puma concolor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Puma concolor preys on:
Erethizontidae
Equus caballus
Odocoileus
Actinopterygii
Mollusca
Aves
Mammalia
Ursus americanus
Nasua nasua
Vulpes vulpes
Cervus elaphus
Odocoileus virginianus
Puma concolor
Mazama gouazoupira
Myrmecophaga tridactyla

Based on studies in:
USA: Arizona (Forest, Montane)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total U.S. population was stated as 15,000 by Nowak (1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Primarily solitary in some areas, extensive overlap of home ranges in other areas (see Pierce et al. 1999). In Idaho, mutual avoidance maintains density of breeding adults below level set by food supply.

Annual home range varies greatly in different areas (13-1454 sq km); home range of male (generally 200 to several hundred sq km) averages larger than that of female (Kitchener 1991; Pierce et al. 1999; see also Hansen 1992 for interstate comparisons of home range size). See Beier et al. (1995) for information on movements in the Santa Ana Mountains, southern California. See Laing and Lindzey (1993, J. Mamm. 74:1056-1058) for information on replacement of individuals on vacated home ranges in Utah.

Density usually not greater than 3-4 adults per 100 sq km (8-10 per 100 sq mi) (Kitchener 1991).

Annual mortality rate in an unhunted population in Utah was 26%, over 50% in resident adults in a hunted population in Montana (see Hansen 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Mountain lions rely mainly on vision, smell, and hearing. They use low-pitched hisses, growls, purrs, yowls, and screams in different circumstances. Loud, chirping whistles by young serves to call the mother. Touch is important in social bonding between mother and young. Scent marking is important in advertising territory boundaries and reproductive state.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year. Active any time, day or night, but most hunting occurs dawn or dusk (Jones et al. 1983). Peak activity within 2 hours of sunset and sunrise in absence of human disturbance; near human presence, activity peaks after sunset.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Mountain lions may live up to 18 to 20 years in the wild. They can live slightly longer in captivity.

Typical lifespan

Status: wild:
18 to 20 years.

Average lifespan

Status: captivity:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.8 years (captivity) Observations: In the wild, these animals have been estimated to live up to 18 years (Bernhard Grzimek 1990). One captive specimen was still alive at 23.8 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males maintain territories that overlap with those of several females. They attempt to dominate matings with those females.

A mountain lion in the wild will not mate until it has established a home territory. When the female is in estrous, she vocalizes freely and frequently rubs against nearby objects. The male responds with similar yowls and sniffs the female's genital area. The highest frequency of copulation was nine times in one hour. A single copulatory act lasts less than one minute. There is a 67% chance of conception per mated estrous

Mating System: polygynous

Courtship and mating occurs throughout the year, but is concentrated from December to March in northern latitudes. Gestation periods last from 82 to 96 days. A female mountain lion can come into estrus any time of the year. Estrus lasts about nine days. Females usually give birth every other year. After six cycles without mating, the female has a lull for two months before coming into estrous again. Males remain reproductively active to at least an age of 20 years, and females to at least an age of 12 years. Litters vary in size from 1 to 6 cubs with an average of 3 or 4. Birth weight is between 226 to 453 grams. The cubs open their eyes 10 days after birth. At the same time their ear pinnae unfolds, their first teeth erupt, and they begin play. The cubs are fully weaned at about 40 days of age. Mother and cubs remain together for as long as 26 months, though the average is 15 months. Male young disperse from 23 to 274 km, while females disperse from 9 to 140 km. Males reach sexual maturity at about 3 years of age and females at 2 1/2 years.

Breeding interval: Individual female mountain lions usually give birth every two years.

Breeding season: Mating throughout the year, in northern parts of their range mating is more concentrated from December to March.

Range number of offspring: 1 to 6.

Average number of offspring: 2.9.

Range gestation period: 84 to 106 days.

Average gestation period: 92.3 days.

Range weaning age: 28 (low) days.

Average weaning age: 40 days.

Range time to independence: 12 (high) months.

Average age at sexual or reproductive maturity (female): 2.5 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average birth mass: 400 g.

Average number of offspring: 2.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Mother mountain lions care for and nurse their young until they are about a year old. The young are born helpless and are protected by the mother in a sheltered area until they are big enough to roam and begin to learn and practice hunting skills.

Parental Investment: altricial ; female parental care ; post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation lasts about 82-100 days. In the Northern Hemisphere most births occur in April-September, may occur throughout the year in Arizona. Litter size is 1-6 (usually 2-3). Young are weaned after 2-3 months. First reproduction usually occurs at 2-3 years. Young remain with mother for 1-2 years. Usually 2 years between litters (sometimes 1 year if litter does not survive). In the wild, probably few live beyond 10 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Puma concolor

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0287-06|AY598484|Puma concolor| AATCGCTGACTGTTTTCAACTAATCATAAAGATATTGGCACTCTTTACCTTCTATTTGGTGCCTGAGCCGGTATGGTAGGAACTGCTCTT---AGTCTCCTAATCCGGGCCGAACTAGGTCAACCTGGCACACTACTAGGAGAT---GATCAAATTTATAATGTGGTCGTTACTGCCCATGCTTTTGTGATGATTTTCTTCATAGTAATACCTATTATGATTGGAGGGTTTGGTAACTGATTGGTCCCATTAATA---ATTGGAGCCCCTGACATAGCATTCCCCCGAATGAATAACATGAGCTTCTGACTTCTTCCTCCATCTTTTTTACTTCTACTTGCTTCATCTATGGTGGAGGCCGGAGCAGGGACTGGATTAACAATATATCCACCCTTAGCCGGTAATCTGGCTCATGCGGGAGCATCCGTAGATCTA---ACCATTTTCTCACTCCACCTAGCAGGTGTCTCTTCGATCTTGGGTGCTATTAATTTTATCACCACTATTATTAATATAAAACCTCCTGCCATATCTCAATACCAAACACCCCTTTTTGTATGATCAGTTTTAATCACTGCAGTCCTATTACTCCTATCACTCCCAGTCCTAGCAGCA---GGAATTACTATGCTATTAACAGATCGAAACCTAAATACCACATTCTTTGATCCTGCCGGAGGAGGAGATCCTATCTTATACCAACACTTATTCTGATTTTTTGGTCACCCGGAGGTCTATATTTTAATTCTACCCGGCTTCGGAATAATCTCACATATTGTTACCTATTACTCAGGTAAAAAG---GAACCATTTGGCTACATGGGAATAGTTTGAGCCATAATATCAATTGGCTTTCTGGGCTTTATCGTATGGGCCCATCACATGTTTACCGTGGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Puma concolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Caso, A., Lopez-Gonzalez, C., Payan, E., Eizirik, E., de Oliveira, T., Leite-Pitman, R., Kelly, M., Valderrama, C. & Lucherini, M.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern as it is a widespread species. However, it is considered to be declining, and as a large predator its conservation presents numerous challenges. It has been extirpated from large areas of its historic range in North America (Nowell and Jackson 1996).

History
  • 2002
    Near Threatened
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Some subspecies are listed in CITES Appendix I; all others are Appendix II. Some populations are listed as Endangered under the Endangered Species Act. Two populations listed as endangered under the Endangered Species Act are considered extinct (Puma concolor schorgeri and Puma concolor couguar). Puma concolor coryi, Florida panthers, and Puma concolor costaricensis are considered endangered and extant.

US Federal List: endangered

CITES: appendix i; appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widely distributed from Canada to South America; habitat has been reduced to primarily the most remote and inaccessible areas, but the species remains relatively common (for a top predator) in several regions of the western U.S. (game species in some states) and probably elsewhere to the south of the U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Similarity of Appearance (Threatened)
Date Listed: 08/14/1991
Lead Region:   Northeast Region (Region 5) 
Where Listed: U.S.A. (FL)


Population detail:

Population location: U.S.A. (FL)
Listing status: SAT

For most current information and documents related to the conservation status and management of Puma concolor, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), and listed on Appendix II of CITES (3). Subspecies: Puma concolor coryi (Florida puma), P. c. couguar (Eastern puma)and P. c. costaricensis are listed on Appendix I of CITES (4). A number of other subspecies exist, but are not classified separately on the IUCN Red List.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Two subspecies P. concolor coryi, the Florida Panther, and P. concolor cougar, the Eastern Cougar, are Critically Endangered; the parent species is Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Canadian population was rougly estimated at 3,500-5,000 and the western US population at 10,000 in the early 1990s (Nowell and Jackson, 1996). The population of Central and South America is likely much higher, although it is unclear how abundant pumas are in the dense rainforest of the Amazon basin (Nowell and Jackson, 1996). The Florida subpopulation, numbering 70-80, is isolated, and has been supplemented by a reintroduction of pumas from Texas (Sunquist and Sunquist 2002). In Brazil it is considered Near Threatened but subspecies outside the Amazon basic are considered VU (Machado et al. 2005). It is also considered Near Threatened in Peru (Inrena 2006), Argentina (Diaz and Ojeda 2000) and Colombia (Rodriguez-Mahecha et al., 2006), and Data Deficient (inadequately known) in Chile (CONAMA 2005).

Density estimates include:

Utah, US: 0.3-0.5/100 km² (Hemker et al. 1984)

Idaho, US: 0.77-1.04/100 km² (Laundre and Clark 2003)

Peru: 2.4/100 km² (Janson and Emmons 1990)

Patagonia: 6/100 km² (Franklin et al. 1999)

Pantanal 4.4/100 km² (Crawshaw and Quigley unpubl. in Nowell and Jackson 1996)

Belize 2-5/100 km², in Argentina 0.5-0.8/100 km², Bolivia 5-8/100 km² (Kelly et al. in press)

W Mexico 3-5/100 km² (Nunez et al. 1998)

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Pumas are threatened by habitat loss and fragmentation, and poaching of their wild prey base. They are persecuted across their range by retaliatory hunting due to livestock depredation, and due to fear that they pose a threat to human life (IUCN Cats Red List workshop, 2007). Pumas have killed a number of people in western Canada and the US in recent years. Pumas are legally hunted in many western US states, although hunting was banned by popular referendum in California in 1990. Road kills are the principal cause of mortality in the endangered Florida panther subpopulation, and heavily travelled roads are a major barrier to puma movements and dispersal (Sunquist and Sunquist 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Decline in range and abundance was due in part to federal predator control efforts augmented by state bounty programs. Loss of remote, undisturbed habitat is a problem in some areas. Excessive killing by humans may be a problem in some areas south of the U.S. Depleted ungulate populations are a potential threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Across their range, pumas have been considered a threat to livestock and persecuted because of this (1). Indeed, the U.S. Fish and Wildlife Service estimate that a minimum of 66,665 pumas were killed between 1907 and 1978. Additionally, pumas are one of the few large predators in Northern America that it is legal to hunt for sport and chase with dogs (5). This species is particularly vulnerable because it takes to trees when hunted, effectively becoming trapped (3). Pumas are also considered a potential danger to humans, especially children (8), although pumas almost never attack people (5). With people settling in more remote areas and with legal protection of the cat, the potential for conflict between humans and pumas arises, and there is a concern that pumas will lose their fear of being close to humans. In California and Florida, many animals are killed by vehicles as heavily travelled roads divide populations and even the home ranges of individual pumas. Loss and fragmentation of habitat also poses significant threats to the puma's future survival; in particular the Florida puma, which faces the serious problem of reduced genetic diversity associated with inbreeding, which in turn reduces resistance to disease or environmental change, and adversely affects fertility (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Included in CITES Appendix II (eastern and Central American subspecies (P. c. coryi, costaricensis and cougar) Appendix I). The species is protected across much of its range, with hunting prohibited in most of Argentina, and all of Brazil, Bolivia, Chile, Colombia, Costa Rica, French Guiana, Guatemala, Honduras, Nicaragua, Panama, Paraguay, Suriname, Venezuela and Uruguay, and hunting regulations in place in Canada, Mexico, Peru and the United States (Nowell and Jackson 1996).

There is a need for the implementation of programs to mitigate conflict resolution for livestock depredation and to study the real effect of puma vs. jaguar depredation on livestock (IUCN Cats Red List workshop, 2007). Puma occasionally kill humans - especially in North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preserve Selection and Design Considerations: Protection and maintenance of migratory corridors may be important in some areas (Pierce et al. 1999).

Management Requirements: See Moorhead and Hofstra (1994) on the management of lion-human encounters in national parks (persons encountering a lion should stand their ground, not run, be assertive, keep their eyes on the animal, not play dead, and fight back, if necessary).

See Ross and Jalkotzy (1995) for information on the fate of relocated individuals in Alberta.

Biological Research Needs: Determine minimum habitat needs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Several populations are protected through management as a game species in various western states.

Needs: Protect remote areas supporting viable populations. Repeal bounty laws (if any).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The puma is protected over much of its range. Hunting is prohibited in Argentina, Brazil, Bolivia, Chile, Colombia, Costa Rica, French Guiana, Guatemala, Honduras, Nicaragua, Panama, Paraguay, Suriname, Venezuela and Uruguay, and hunting regulations exist in Canada, Mexico, Peru and the United States (1). However, there still remains no legal protection in Ecuador, El Salvador, and Guyana. Due to its critically low numbers, the Florida puma has been the focus of a particularly concerted and multi-faceted conservation programme, but this has been a complex and expensive task (3) with the aim of achieving three viable self-sustaining wild populations within the puma's former range. Remaining viable tracts of habitat are being conserved and connected by corridors, and the impact of a major highway has been lessened by the construction of underpasses for the safe travel of pumas in the area (9). In 1995, wildlife managers controversially introduced several female pumas from Texas into Florida in an effort to increase genetic diversity. This is thought by many to have alleviated a number of problems associated with inbreeding amongst Florida pumas (6). The levels of prey species are being monitored, wild pumas have been vaccinated against diseases and a captive breeding programme has been established (1). Fortunately, despite conflict with ranchers and concern over the dangers pumas may pose to humans, there appears to be strong overall public support for the cat in North America. The fact that there is a genuine desire by many people to find ways to coexist with the puma is an encouraging step towards promoting positive conservation actions and protecting this beautiful cat (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although mountain lions are secretive and generally avoid humans, they sometimes attack humans. Attacks are usually on small adults and children traveling alone during dawn, dusk, or at night. It is thought that mountain lions mistake these humans for their ungulate prey. Mountain lions are also considered threats to domestic stock. These threats are sometimes exaggerated. It is helpful to learn more about mountain lion behavior in order to avoid encounters.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mountain lions have considerable trophy value and are hunted for sport. They are also captured to be put in zoos. Mountain lions are important to humans in their role as top predators, helping to control populations of ungulates.

Positive Impacts: body parts are source of valuable material; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: In 1989-1990, the sport harvest was 2176 in the western U.S. and western Canada (Hansen 1992). Sometimes preys on domestic livestock.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cougar

The cougar (Puma concolor), also known as puma, mountain lion, mountain cat, catamount or panther, depending on the region, is a mammal of the family Felidae, native to the Americas. This large, solitary cat has the greatest range of any large wild terrestrial mammal in the Western Hemisphere,[3] extending from Yukon in Canada to the southern Andes of South America. An adaptable, generalist species, the cougar is found in every major American habitat type. It is the second heaviest cat in the Western Hemisphere, after the jaguar. Although large, the cougar is most closely related to smaller felines and is closer genetically to the domestic cat than to true lions. Like the smaller felines, the cougar is nocturnal.[4]

A capable stalk-and-ambush predator, the cougar pursues a wide variety of prey. Primary food sources include ungulates such as deer, elk, moose, and bighorn sheep, as well as domestic cattle, horses and sheep, particularly in the northern part of its range. It will also hunt species as small as insects and rodents. This cat prefers habitats with dense underbrush and rocky areas for stalking, but it can also live in open areas. The cougar is territorial and persists at low population densities. Individual territory sizes depend on terrain, vegetation, and abundance of prey. While it is a large predator, it is not always the dominant species in its range, as when it competes for prey with other predators such as the jaguar, grey wolf, American Black Bear, and the grizzly bear. It is a reclusive cat and usually avoids people. Attacks on humans remain fairly rare, despite a recent increase in frequency.[5]

Because of excessive hunting following the European colonization of the Americas and the continuing human development of cougar habitat, populations have dropped in most parts of its historical range. In particular, the cougar was extirpated in eastern North America in the beginning of the 20th century, except for an isolated sub-population in Florida. However, in recent decades, breeding populations have moved east into the far western parts of the Dakotas, Nebraska, and Oklahoma. Transient males have been verified in Minnesota (where one was shot and killed)[6], Wisconsin[7], Iowa[8][9], the Upper Peninsula of Michigan, and Illinois, where a cougar was shot in the city limits of Chicago[10][11][12] and, in at least one instance, observed as far east as Connecticut.[13][14]

Contents

Naming and etymology

With its vast range, the cougar has dozens of names and various references in the mythology of the indigenous Americans and in contemporary culture. The cougar has numerous names in English, of which puma and mountain lion are popular. Other names include catamount, panther, mountain screamer and painter. Lexicographers regard painter as a primarily upper-Southern U.S. regional variant on "panther",[15] but a folk etymology, fancying a resemblance between the typically dark tip of its tail and a paintbrush dipped in dark paint, has some currency.

The cougar holds the Guinness record for the animal with the highest number of names, presumably due to its wide distribution across North and South America. It has over 40 names in English alone.[16]

"Cougar" may be borrowed from the archaic Portuguese çuçuarana, via French; the term was originally derived from the Tupi language. A current form in Brazil is suçuarana. It may also be borrowed from the Guaraní language term guaçu ara or guazu ara. "Puma" comes, via Spanish, from the Quechua language.[17][18][19]

Taxonomy and evolution

Although large, the cougar is more closely related to smaller felines.
Close-up of face.

The cougar is the largest of the small cats. It is placed in the subfamily Felinae, although its bulk characteristics are similar to those of the big cats in the subfamily Pantherinae.[1] The family Felidae is believed to have originated in Asia approximately 11 million years ago. Taxonomic research on felids remains partial and much of what is known about their evolutionary history is based on mitochondrial DNA analysis,[20] as cats are poorly represented in the fossil record,[21] and there are significant confidence intervals with suggested dates. In the latest genomic study of Felidae, the common ancestor of today's Leopardus, Lynx, Puma, Prionailurus, and Felis lineages migrated across the Bering land bridge into the Americas approximately 8 to 8.5 million years (Mya) ago. The lineages subsequently diverged in that order.[21] North American felids then invaded South America 3 Ma ago as part of the Great American Interchange, following formation of the Isthmus of Panama. The cougar was originally thought to belong in Felis (Felis concolor), the genus which includes the domestic cat. As of 1993, it is now placed in Puma along with the jaguarundi, a cat just a little more than a tenth its weight.

Studies have indicated that the cougar and jaguarundi are most closely related to the modern cheetah of Africa and western Asia,[21][22] but the relationship is unresolved. It has been suggested that the cheetah lineage diverged from the Puma lineage in the Americas (see American cheetah) and migrated back to Asia and Africa,[21][22] while other research suggests the cheetah diverged in the Old World itself.[23] The outline of small feline migration to the Americas is thus unclear.

Recent studies have demonstrated a high level of genetic similarity among the North American cougar populations, suggesting that they are all fairly recent descendants of a small ancestral group. Culver et al. suggest that the original North American population of Puma concolor was extirpated during the Pleistocene extinctions some 10,000 years ago, when other large mammals such as Smilodon also disappeared. North America was then repopulated by a group of South American cougars.[22]

Subspecies

Until the late 1980s, as many as 32 subspecies were recorded; however, a recent genetic study of mitochondrial DNA[22] found that many of these are too similar to be recognized as distinct at a molecular level. Following the research, the canonical Mammal Species of the World (3rd edition) recognizes six subspecies, five of which are solely found in Latin America:[1]

Argentine puma (Puma concolor cabrerae) 
includes the previous subspecies and synonyms hudsonii and puma (Marcelli, 1922);
Costa Rican cougar (Puma concolor costaricensis)
Eastern South American cougar (Puma concolor capricornensis) 
includes the previous subspecies and synonyms acrocodia, borbensis, capricornensis, concolor (Pelzeln, 1883), greeni and nigra;
North American Cougar (Puma concolor couguar) 
includes the previous subspecies and synonyms arundivaga, aztecus, browni, californica, coryi, floridana, hippolestes, improcera, kaibabensis, mayensis, missoulensis, olympus, oregonensis, schorgeri, stanleyana, vancouverensis and youngi;
Northern South American cougar (Puma concolor concolor) 
includes the previous subspecies and synonyms bangsi, incarum, osgoodi, soasoaranna, sussuarana, soderstromii, suçuaçuara and wavula;
Southern South American puma (Puma concolor puma) 
includes the previous subspecies and synonyms araucanus, concolor (Gay, 1847), patagonica, pearsoni and puma (Trouessart, 1904)

The status of the Florida panther, here collapsed into the North American cougar, remains uncertain. It is still regularly listed as subspecies Puma concolor coryi in research works, including those directly concerned with its conservation.[24] Culver et al. themselves noted low microsatellite variation in the Florida panther, possibly due to inbreeding;[22] responding to the research, one conservation team suggests "the degree to which the scientific community has accepted the results of Culver et al. and the proposed change in taxonomy is not resolved at this time."[25]

Biology and behavior

Physical characteristics

Cougar skull and jawbone

Cougars are slender and agile members of the cat family. They are the fourth largest cats[26] and adults stand about 60 to 90 cm (24 to 35 in) tall at the shoulders.[27] Adult males are around 2.4 m (7.9 ft) long nose to tail and females average 2.05 m (6.7 ft), with overall ranges between 1.5 to 2.75 m (4.9 to 9.0 ft) nose to tail suggested for the species in general.[28][29] Of this length, 63 to 95 cm (25 to 37 in) is comprised by the tail.[30] Males typically weigh 53 to 100 kilograms (115 to 220 pounds), averaging 62 kg (137 lb). Females typically weigh between 29 and 64 kg (64 and 141 lb), averaging 42 kg (93 lb).[31][32][33] Cougar size is smallest close to the equator, and larger towards the poles.[3] The largest recorded cougar was shot in Arizona and weighed 125.5 kilograms (276 pounds) after its intestines were removed, indicating that in life it could have weighed nearly 136.2 kilograms (300 pounds).[34] Several male cougars in British Columbia weighed between 86.4 and 95.5 kilograms (190 to 210 pounds).[35]

Although cougars resemble the domestic cat, they are about the same size as an adult human.

The head of the cat is round and the ears erect. Its powerful forequarters, neck, and jaw serve to grasp and hold large prey. It has five retractable claws on its forepaws (one a dewclaw) and four on its hind paws. The larger front feet and claws are adaptations to clutching prey.[36]

Cougars can be almost as large as jaguars, but are less muscular and not as powerfully built; where their ranges overlap, the cougar tends to be smaller than average. Besides the jaguar, the cougar is on average larger than all felids outside of the Old World lion and tigers. Despite its size, it is not typically classified among the "big cats", as it cannot roar, lacking the specialized larynx and hyoid apparatus of Panthera.[37] Compared to "big cats", cougars are often silent with minimal communication through vocalizations outside of the mother-offspring relationship.[38] Cougars sometimes voice low-pitched hisses, growls, and purrs, as well as chirps and whistles, many of which are comparable to those of domestic cats. They are well known for their screams, as referenced in some of their common names, although these screams are often misinterpreted to be the calls of other animals.[39]

Rear paw of a cougar

Cougar coloring is plain (hence the Latin concolor) but can vary greatly between individuals and even between siblings. The coat is typically tawny, but ranges to silvery-grey or reddish, with lighter patches on the under body including the jaws, chin, and throat. Infants are spotted and born with blue eyes and rings on their tails;[31] juveniles are pale, and dark spots remain on their flanks.[29] Despite anecdotes to the contrary, all-black coloring (melanism) has never been documented in cougars.[40] The term "black panther" is used colloquially to refer to melanistic individuals of other species, particularly jaguars and leopards.[41]

Cougars have large paws and proportionally the largest hind legs in the cat family.[31] This physique allows it great leaping and short-sprint ability. An exceptional vertical leap of 5.4 m (18 ft) is reported for the cougar.[42] Horizontal jumping capability from standing position is suggested anywhere from 6 to 12 m (20 to 40 ft). The cougar can run as fast as 55 to 72 km/h (35 to 45 mi/h),[43] but is best adapted for short, powerful sprints rather than long chases. It is adept at climbing, which allows it to evade canine competitors. Although it is not strongly associated with water, it can swim.[44]

Hunting and diet

A successful generalist predator, the cougar will eat any animal it can catch, from insects to large ungulates (over 500 kg). Like all cats, it is an obligate carnivore meaning it needs to feed exclusively on meat to survive. The mean weight of vertebrate prey (MWVP) was positively correlated (r=0.875) with puma body weight and inversely correlated (r=-0.836) with food niche breadth in all America. In general, MWVP was lower in areas closer to the Equator.[3] Its most important prey species are various deer species, particularly in North America; mule deer, white-tailed deer, elk, and even large moose are taken by the cat. Other species such as Bighorn Sheep, wild horses of Arizona, domestic horses, and domestic livestock such as cattle and sheep are also primary food bases in many areas.[45] A survey of North America research found 68% of prey items were ungulates, especially deer. Only the Florida Panther showed variation, often preferring feral hogs and armadillos.[3]

Shown eating. Cougars are ambush predators, feeding mostly on deer and other mammals.

Investigation in Yellowstone National Park showed that elk, followed by mule deer, were the cougar's primary targets; the prey base is shared with the park's gray wolves, with whom the cougar competes for resources.[46] Another study on winter kills (November–April) in Alberta showed that ungulates accounted for greater than 99% of the cougar diet. Learned, individual prey recognition was observed, as some cougars rarely killed bighorn sheep, while others relied heavily on the species.[47]

In the Central and South American cougar range, the ratio of deer in the diet declines. Small to mid-size mammals are preferred, including large rodents such as the capybara. Ungulates accounted for only 35% of prey items in one survey, approximately half that of North America. Competition with the larger jaguar has been suggested for the decline in the size of prey items.[3] Other listed prey species of the cougar include mice, porcupine, and hares. Birds and small reptiles are sometimes preyed upon in the south, but this is rarely recorded in North America.[3] Not all of their prey is listed here due to their large range.

Though capable of sprinting, the cougar is typically an ambush predator. It stalks through brush and trees, across ledges, or other covered spots, before delivering a powerful leap onto the back of its prey and a suffocating neck bite. The cougar is capable of breaking the neck of some of its smaller prey with a strong bite and momentum bearing the animal to the ground.[36]

Kills are generally estimated at around one large ungulate every two weeks. The period shrinks for females raising young, and may be as short as one kill every three days when cubs are nearly mature at around 15 months.[31] The cat drags a kill to a preferred spot, covers it with brush, and returns to feed over a period of days. It is generally reported that the cougar is a non-scavenger and will rarely consume prey it has not killed; but deer carcasses left exposed for study were scavenged by cougars in California, suggesting more opportunistic behavior.[48]

Reproduction and life cycle

Females reach sexual maturity between one-and-a-half to three years of age. They typically average one litter every two to three years throughout their reproductive life,[49] though the period can be as short as one year.[31] Females are in estrus for approximately 8 days of a 23-day cycle; the gestation period is approximately 91 days.[31] Females are sometimes reported as monogamous,[43] but this is uncertain and polygyny may be more common.[50] Copulation is brief but frequent. Research has also found that chronic stress can result in low reproductive rates when in captivity in addition to in the field.[51]

Cougar cubs

Only females are involved in parenting. Female cougars are fiercely protective of their cubs, and have been seen to successfully fight off animals as large as grizzly bears in their defense. Litter size is between one and six cubs; typically two or three. Caves and other alcoves that offer protection are used as litter dens. Born blind, cubs are completely dependent on their mother at first, and begin to be weaned at around three months of age. As they grow, they begin to go out on forays with their mother, first visiting kill sites, and after six months beginning to hunt small prey on their own.[49] Kitten survival rates are just over one per litter.[31] When cougars are born, they have spots, but they lose them as they grow, and by the age of 2 1/2 years, they will completely be gone[52]

Young adults leave their mother to attempt to establish their own territory at around two years of age and sometimes earlier; males tend to leave sooner. One study has shown high mortality amongst cougars that travel farthest from the maternal range, often due to conflicts with other cougars (intraspecific competition).[49] Research in New Mexico has shown that "males dispersed significantly farther than females, were more likely to traverse large expanses of non-cougar habitat, and were probably most responsible for nuclear gene flow between habitat patches."[53]

Life expectancy in the wild is reported at between 8 to 13 years, and probably averages 8 to 10; a female of at least 18 years was reported killed by hunters on Vancouver Island.[31] Cougars may live as long as 20 years in captivity. One male North American cougar, named Scratch, was two months short of his 30th birthday when he died in 2007.[54] Causes of death in the wild include disability and disease, competition with other cougars, starvation, accidents, and, where allowed, human hunting. Feline immunodeficiency virus, an endemic HIV-like virus in cats, is well-adapted to the cougar.[55]

Social structure and home range

Like almost all cats, the cougar is a solitary animal. Only mothers and kittens live in groups, with adults meeting only to mate. It is secretive and crepuscular, being most active around dawn and dusk.

Estimates of territory sizes vary greatly. Canadian Geographic reports large male territories of 150 to 1000 square kilometers (58 to 386 sq mi) with female ranges half the size.[43] Other research suggests a much smaller lower limit of 25 km2 (10 sq mi) but an even greater upper limit of 1300 km2 (500 sq mi) for males.[49] In the United States, very large ranges have been reported in Texas and the Black Hills of the northern Great Plains, in excess of 775 km2 (300 sq mi).[56] Male ranges may include or overlap with those of females but, at least where studied, not with those of other males, which serves to reduce conflict between cougars. Ranges of females may overlap slightly with each other. Scrape marks, urine, and feces are used to mark territory and attract mates. Males may scrape together a small pile of leaves and grasses and then urinate on it as a way of marking territory.[44]

Home range sizes and overall cougar abundance depend on terrain, vegetation, and prey abundance.[49] One female adjacent to the San Andres Mountains, for instance, was found with a large range of 215 km2 (83 sq mi), necessitated by poor prey abundance.[53] Research has shown cougar abundances from 0.5 animals to as much as 7 (in one study in South America) per 100 km2 (38 sq mi).[31]

Because males disperse farther than females and compete more directly for mates and territory, they are most likely to be involved in conflict. Where a sub-adult fails to leave his maternal range, for example, he may be killed by his father.[56] When males encounter each other, they hiss, spit, and may engage in violent conflict if neither backs down.[50] Hunting or relocation of the cougar may increase aggressive encounters by disrupting territories and bringing young, transient animals into conflict with established individuals.[57]

Ecology

Distribution and habitat

Cougar on Animal Reserve Guaycolec, Formosa, Argentina

The cougar has the largest range of any wild land animal in the Americas. Its range spans 110 degrees of latitude, from northern Yukon in Canada to the southern Andes. It is one of only three cat species, along with the bobcat and Canadian lynx, native to Canada.[36] Its wide distribution stems from its adaptability to virtually every habitat type: it is found in all forest types as well as in lowland and mountainous deserts. Studies show that the cougar prefers regions with dense underbrush, but can live with little vegetation in open areas.[2] Its preferred habitats include precipitous canyons, escarpments, rim rocks, and dense brush.[44]

Cougar, photographed in the Arizona-Sonora Desert Museum, Tucson, Arizona

The cougar was extirpated across much of its eastern North American range (with the exception of Florida) in the two centuries after European colonization, and faced grave threats in the remainder of its territory. Currently, it ranges across most western American states, the Canadian provinces of Alberta, Saskatchewan and British Columbia, and the Canadian Yukon Territory. There have been widely debated reports of possible recolonization of eastern North America.[58] DNA evidence has suggested its presence in eastern North America,[59] while a consolidated map of cougar sightings shows numerous reports, from the mid-western Great Plains through to eastern Canada.[60] The Quebec wildlife services (known locally as MRNF) also considers cougar to be present in the province as a threatened species after multiple DNA tests confirmed cougar hair in lynx mating sites.[61] The only unequivocally known eastern population is the Florida panther, which is critically endangered. There have been unconfirmed sightings in Elliotsville Plantation, Maine (north of Monson); and in New Hampshire, there have been unconfirmed sightings as early as 1997.[62] In 2009, the Michigan Department of Natural Resources confirmed a cougar sighting in Michigan's Upper Peninsula.[63] Typically, extreme-range sightings of cougars involve young males, who can travel great distances to establish ranges away from established males; all four confirmed cougar kills in Iowa since 2000 involved males.[64]

On April 14, 2008, police shot and killed a cougar on the north side of Chicago, Illinois. DNA tests were consistent with cougars from the Black Hills of South Dakota. Less than one year later, on March 5, 2009, a cougar was photographed and unsuccessfully tranquilized by state wildlife biologists in a tree near Spooner, Wisconsin, in the northwestern part of the state.[65]

The Indiana Department of Natural Resources used motion-sensitive cameras to confirm the presence of a cougar in Greene County in southern Indiana on May 7, 2010. Another sighting in late 2009 in Clay County in west-central Indiana was confirmed by the DNR.[66]

On June 10, 2011, a cougar was observed roaming near Greenwich, Connecticut. State officials at the time said they believed it was a released pet.[67] On June 11, 2011, a cougar, believed to be the same animal as the one observed in Greenwich, was killed by a car on the Wilbur Cross Parkway in Milford, Connecticut.[68] When wildlife officials examined the cougar's DNA, they concluded that it was a wild cougar from the Black Hills of South Dakota, which had wandered at least 1,500 miles east over an indeterminate time period.[69]

South of the Rio Grande, the International Union for the Conservation of Nature and Natural Resources (IUCN) lists the cat in every Central and South American country.[2] While specific state and provincial statistics are often available in North America, much less is known about the cat in its southern range.[70]

The cougar's total breeding population is estimated at less than 50,000 by the IUCN, with a declining trend.[2] U.S. state-level statistics are often more optimistic, suggesting cougar populations have rebounded. In Oregon, a healthy population of 5,000 was reported in 2006, exceeding a target of 3,000.[71] California has actively sought to protect the cat and a similar number of cougars has been suggested, between 4,000 and 6,000.[72]

Ecological role

Paw of a puma
Front paw print of a cougar. An adult paw print is approximately 10 cm (4 inches) long.[73]

Aside from humans, no species preys upon mature cougars in the wild, although conflicts with other predators or scavengers occur. The Yellowstone National Park ecosystem provides a fruitful microcosm to study inter-predator interaction in North America. Of the three large predators, the massive brown bear appears dominant, often although not always able to drive both the gray wolf pack and the cougar off their kills. One study found that brown or American black bears visited 24% of cougar kills in Yellowstone and Glacier National Parks, usurping 10% of carcasses. Bears gained up to 113%, and cougars lost up to 26%, of their respective daily energy requirements from these encounters.[74]

The gray wolf and the cougar compete more directly for prey, especially in winter. While individually more powerful than the gray wolf, a solitary cougar may be dominated by the pack structure of the canines. Wolves can steal kills and occasionally kill the cat. One report describes a large pack of fourteen wolves killing a female cougar and her kittens. Conversely, lone wolves are at a disadvantage, and have been reported killed by cougars.[75] Wolves more broadly affect cougar population dynamics and distribution by dominating territory and prey opportunities, and disrupting the feline's behavior. Preliminary research in Yellowstone, for instance, has shown displacement of the cougar by wolves.[76] One researcher in Oregon notes: "When there is a pack around, cougars are not comfortable around their kills or raising kittens ... A lot of times a big cougar will kill a wolf, but the pack phenomenon changes the table."[77] Both species, meanwhile, are capable of killing mid-sized predators such as bobcats and coyotes and tend to suppress their numbers.[46]

In the southern portion of its range, the cougar and jaguar share overlapping territory.[78] The jaguar tends to take larger prey and the cougar smaller where they overlap, reducing the cougar's size and also further reducing the likelihood of direct competition.[3] Of the two felines, the cougar appears best able to exploit a broader prey niche and smaller prey.[79]

As with any predator at or near the top of its food chain, the cougar impacts the population of prey species. Predation by cougars has been linked to changes in the species mix of deer in a region. For example, a study in British Columbia observed that the population of mule deer, a favored cougar prey, was declining while the population of the less frequently preyed-upon white-tailed deer was increasing.[80] The Vancouver Island marmot, an endangered species endemic to one region of dense cougar population, has seen decreased numbers due to cougar and gray wolf predation.[81] Nevertheless, there is a measurable effect on the quality of deer populations by puma predation.[82][83]

In the southern part of South America the puma is a top level predator that has controlled the population of Guanaco and other species since prehistoric times.

Hybrids

Pumapard, photographed in 1904

A pumapard is a hybrid animal resulting from a union between a cougar and a leopard. Three sets of these hybrids were bred in the late 1890s and early 1900s by Carl Hagenbeck at his animal park in Hamburg, Germany. Most did not reach adulthood. One of these was purchased in 1898 by Berlin Zoo. A similar hybrid in Berlin Zoo purchased from Hagenbeck was a cross between a male leopard and a female puma. Hamburg Zoo's specimen was the reverse pairing, the one in the black-and-white photo, fathered by a puma bred to an Indian leopardess.

Whether born to a female puma mated to a male leopard, or to a male puma mated to a female leopard, pumapards inherit a form of dwarfism. Those reported grew to only half the size of the parents. They have a puma-like long body (proportional to the limbs, but nevertheless shorter than either parent), but short legs. The coat is variously described as sandy, tawny or greyish with brown, chestnut or "faded" rosettes.[84]

Conservation status

The World Conservation Union (IUCN) currently lists the cougar as a "least concern" species. The cougar is regulated under Appendix I of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES),[85] rendering illegal international trade in specimens or parts.

Cougar conservation depends on preservation of their habitat.

In the United States east of the Mississippi River, the only unequivocally known cougar population is the Florida panther. Until 2011, the United States Fish and Wildlife Service (USFWS) recognized both an Eastern cougar (claimed to be a subspecies by some, denied by others)[86][87] and the Florida panther, affording protection under the Endangered Species Act.[88][89] Certain taxonomic authorities have collapsed both designations into the North American cougar, with Eastern or Florida subspecies not recognized,[1] while a subspecies designation remains recognized by some conservation scientists.[24] The most recent documented count for the Florida sub-population is 87 individuals, reported by recovery agencies in 2003.[90] In March, 2011, the USFWS declared the Eastern cougar extinct. However, with the taxonomic uncertainty about its existence as a subspecies as well as the possibility of eastward migration of cougars from the western range, the subject remains open.[91]

This uncertainty has been recognized by Canadian authorities. The Canadian federal agency called Committee on the Status of Endangered Wildlife in Canada rates its current data as "insufficient" to draw conclusions regarding the eastern cougar's survival, and says on its Web site "Despite many sightings in the past two decades from eastern Canada, there are insufficient data to evaluate the taxonomy or assign a status to this cougar." Notwithstanding numerous reported sightings in Ontario, Quebec, New Brunswick and Nova Scotia, it has been said that the evidence is inconclusive: ". . . there may not be a distinct 'eastern' subspecies, and some sightings may be of escaped pets."[92][93]

The cougar is also protected across much of the rest of its range. As of 1996, cougar hunting was prohibited in Argentina, Brazil, Bolivia, Chile, Colombia, Costa Rica, French Guiana, Guatemala, Honduras, Nicaragua, Panama, Paraguay, Suriname, Venezuela, and Uruguay. The cat had no reported legal protection in Ecuador, El Salvador, and Guyana.[31] Regulated cougar hunting is still common in the United States and Canada, although they are protected from all hunting in the Yukon; it is permitted in every U.S. state from the Rocky Mountains to the Pacific Ocean, with the exception of California. Texas is the only state in the United States with a viable population of cougars that does not protect, in some way, its cougar population. In Texas, cougars are listed as nuisance wildlife and any person holding a hunting or a trapping permit can kill a cougar regardless of the season, number killed, sex or age of the animal.[94] Killed animals are not required to be reported to Texas Parks and Wildlife Department. Conservation work in Texas is the effort of a non profit organization, Balanced Ecology Inc (BEI), as part of their Texas Mountain Lion Conservation Project. Cougars are generally hunted with packs of dogs, until the animal is 'treed'. When the hunter arrives on the scene, he shoots the cat from the tree at close range. The cougar cannot be legally killed in California except under very specific circumstances, such as when an individual is declared a public safety threat.[72] However statistics from the Department of Fish and Game indicate that cougar killings in California have been on the rise since 1970s with an average of over 112 cats killed per year from 2000 to 2006 compared to six per year in the 1970s. The Bay Area Puma Project aims to obtain information on cougar populations in the San Francisco Bay area and the animals' interactions with habitat, prey, humans, and residential communities.[95]

Conservation threats to the species include persecution as a pest animal, environmental degradation and habitat fragmentation, and depletion of their prey base. Wildlife corridors and sufficient range areas are critical to the sustainability of cougar populations. Research simulations have shown that the animal faces a low extinction risk in areas of 2200 km2 (850 sq mi) or more. As few as one to four new animals entering a population per decade markedly increases persistence, foregrounding the importance of habitat corridors.[96]

On March 2, 2011, the United States Fish and Wildlife Service declared the Eastern cougar (Puma concolor couguar) officially extinct.[97]

Relationships with humans

In mythology

The grace and power of the cougar have been widely admired in the cultures of the indigenous peoples of the Americas. The Inca city of Cusco is reported to have been designed in the shape of a cougar, and the animal also gave its name to both Inca regions and people. The Moche people represented the puma often in their ceramics.[98] The sky and thunder god of the Inca, Viracocha, has been associated with the animal.[99]

In North America, mythological descriptions of the cougar have appeared in the stories of the Hocąk language ("Ho-Chunk" or "Winnebago") of Wisconsin and Illinois[100] and the Cheyenne, amongst others. To the Apache and Walapai of Arizona, the wail of the cougar was a harbinger of death.[101]

Livestock predation

During the early years of ranching, cougars were considered on par with wolves in destructiveness. According to figures in Texas in 1990, 86 calves (0.0006% of a total of 13.4 million cattle & calves in Texas), 253 Mohair goats, 302 Mohair kids, 445 sheep (0.02% of a total of 2.0 million sheep & lambs in Texas) and 562 lambs (0.04% of 1.2 million lambs in Texas) were confirmed to have been killed by cougars that year.[102][103] In Nevada in 1992, cougars were confirmed to have killed 9 calves, 1 horse, 4 colts, 5 goats, 318 sheep and 400 lambs. In both cases, sheep were the most frequently attacked. Some instances of surplus killing have resulted in the deaths of 20 sheep in one attack.[104] A cougar's killing bite is typically applied to the back of the neck or head, differing greatly from the throat bite used by coyotes and indiscriminate mutilation by feral dogs. The size of the tooth puncture marks also helps distinguish kills made by cougars from those made by smaller predators.[105]

Attacks on humans

Mountain Lion warning sign.

Due to the expanding human population, cougar ranges increasingly overlap with areas inhabited by humans. Attacks on humans are rare, as cougar prey recognition is a learned behavior and they do not generally recognize humans as prey.[5] Attacks on people, livestock, and pets may occur when the cat habituates to humans or is in a condition of severe starvation. Attacks are most frequent during late spring and summer, when juvenile cougars leave their mothers and search for new territory.[73]

Between 1890 and 1990, in North America there were 53 reported, confirmed attacks on humans, resulting in 48 nonfatal injuries and 10 deaths of humans (the total is greater than 53 because some attacks had more than one victim).[106] By 2004, the count had climbed to 88 attacks and 20 deaths.[107]

Within North America, the distribution of attacks is not uniform. The heavily populated state of California has seen a dozen attacks since 1986 (after just three from 1890 to 1985), including three fatalities.[72] Lightly populated New Mexico reported an attack in 2008, the first there since 1974.[108]

As with many predators, a cougar may attack if cornered, if a fleeing human stimulates their instinct to chase, or if a person "plays dead". Standing still however may cause the cougar to consider a person easy prey.[109] Exaggerating the threat to the animal through intense eye contact, loud but calm shouting, and any other action to appear larger and more menacing, may make the animal retreat. Fighting back with sticks and rocks, or even bare hands, is often effective in persuading an attacking cougar to disengage.[5][73]

When cougars do attack, they usually employ their characteristic neck bite, attempting to position their teeth between the vertebrae and into the spinal cord. Neck, head, and spinal injuries are common and sometimes fatal.[5] Children are at greatest risk of attack, and least likely to survive an encounter. Detailed research into attacks prior to 1991 showed that 64% of all victims–and almost all fatalities–were children. The same study showed the highest proportion of attacks to have occurred in British Columbia, particularly on Vancouver Island where cougar populations are especially dense.[106] Preceding attacks on humans, cougars display aberrant behavior, such as activity during daylight hours, a lack of fear of humans, and stalking humans.[110] There have sometimes been incidents of pet cougars mauling people.[111][112]

See also


References

  1. ^ a b c d Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 544–45. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14000204. 
  2. ^ a b c d Caso, A., Lopez-Gonzalez, C., Payan, E., Eizirik, E., de Oliveira, T., Leite-Pitman, R., Kelly, M., Valderrama, C. & Lucherini, M. (2008). Puma concolor. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on March 22, 2009. Database entry includes justification for why this species is least concern
  3. ^ a b c d e f g J. Agustin Iriarte, William L. Franklin, Warren E. Johnson, and Kent H. Redford (1990). "Biogeographic variation of food habits and body size of the America puma". Oecologia 85 (2): 185. doi:10.1007/BF00319400. http://www.springerlink.com/content/nvk62r701822qq17/. Retrieved April 4, 2007. 
  4. ^ National Park Service
  5. ^ a b c d McKee, Denise (2003). "Cougar Attacks on Humans: A Case Report". Wilderness and Environmental Medicine (Wilderness Medical Society) 14 (3): 169–73. doi:10.1580/1080-6032(2003)14[169:CAOHAC]2.0.CO;2. PMID 14518628. http://www.wemjournal.org/wmsonline/?request=get-document&issn=1080-6032&volume=014&issue=03&page=0169. Retrieved May 20, 2007. 
  6. ^ http://www.startribune.com/local/134835873.html
  7. ^ "Extinct? Cougar sightings on the rise in eastern United States". Daily Mail (London). http://www.dailymail.co.uk/news/article-2090026/Extinct-Sightings-cougars-rise-eastern-states.html. 
  8. ^ http://www.iowadnr.gov/home/ctl/detail/mid/2822/itemid/581
  9. ^ http://www.kwwl.com/story/16385438/mountain-lion-shot-by-police-in-monona-county
  10. ^ "The Cougar Network – Using Science to Understand Cougar Ecology". Cougarnet.org. http://www.cougarnet.org/centralmidwest.html. Retrieved February 16, 2011. 
  11. ^ "Trail cam photo of cougar in the eastern Upper Peninsula. Loc... on Twitpic". Twitpic.com. November 5, 2009. http://twitpic.com/od2y4. Retrieved February 16, 2011. 
  12. ^ "Indiana confirms mountain lion in Green County". Poorboysoutdoors.com. May 10, 2010. http://www.poorboysoutdoors.com/2010/05/indiana-confirms-green-county-mountain-lion/. Retrieved February 16, 2011. 
  13. ^ "Mountain lion run over in Conn. had traveled 1,500 miles". MSNBC. July 26, 2011. http://www.msnbc.msn.com/id/43900945/ns/us_news-environment/t/mountain-lion-run-over-conn-had-traveled-miles/from/toolbar. Retrieved July 26, 2011. 
  14. ^ NPR News. "Connecticut Mountain Lion Likely Came From The Black Hills". NPR. http://www.npr.org/blogs/thetwo-way/2011/07/27/138748682/connecticut-mountain-lion-likely-came-from-the-black-hills. Retrieved July 28, 2011. 
  15. ^ "transcription of ''American Heritage Dictionary''". Bartleby.com. http://www.bartleby.com/61/61/P0016100.html. Retrieved March 8, 2009. [dead link]
  16. ^ The Guinness Book of World Records. 2004. p. 49. 
  17. ^ Cougar, Puma and "Jaguar at the Online Etymology Dictionary". Douglas Harper. 2001. http://www.etymonline.com/index.php?term=jaguar. Retrieved August 6, 2006. 
  18. ^ ""cougar," Webster's Third New International Dictionary, Unabridged". Merriam-Webster. 2002. http://unabridged.m-w.com/cgi-bin/unabridged?va=cougar. Retrieved May 21, 2009. 
  19. ^ ""cougar," Oxford English dictionary". Oxford University Press. 1989. http://dictionary.oed.com/cgi/entry/50051540?single=1&query_type=word&queryword=cougar. Retrieved May 21, 2009. 
  20. ^ Wade, Nicholas (January 6, 2006). "DNA Offers New Insight Concerning Cat Evolution". New York Times. http://www.nytimes.com/2006/01/06/science/06cats.html?ex=1294203600&en=4b75c4da1cdc2167&ei=5090. Retrieved June 3, 2007. 
  21. ^ a b c d Johnson, W.E., Eizirik, E., Pecon-Slattery, J., Murphy, W.J., Antunes, A., Teeling, E. & O'Brien, S.J. (January 6, 2006). "The Late Miocene radiation of modern Felidae: A genetic assessment". Science 311 (5757): 73–77. doi:10.1126/science.1122277. PMID 16400146. http://www.sciencemag.org/cgi/content/abstract/311/5757/73. Retrieved June 4, 2007. 
  22. ^ a b c d e Culver, M.; Johnson, W.E., Pecon-Slattery, J., O'Brien, S.J. (2000). "Genomic Ancestry of the American Puma". Journal of Heredity 91 (3): 186–97. doi:10.1093/jhered/91.3.186. PMID 10833043. http://jhered.oxfordjournals.org/content/91/3/186. 
  23. ^ Barnett, Ross; Ian Barnes, Matthew J. Phillips, Larry D. Martin, C. Richard Harington, Jennifer A. Leonard, and Alan Cooper (August 9, 2005). "Evolution of the extinct Sabretooths and the American cheetah-like cat". Current Biology 15 (15): R589–R590. doi:10.1016/j.cub.2005.07.052. PMID 16085477. http://linkinghub.elsevier.com/retrieve/pii/S0960982205008365. Retrieved June 4, 2007. 
  24. ^ a b Conroy, Michael J.; Paul Beier; Howard Quigley; Michael R. Vaughan (January 2006). Morrison. ed. "Improving The Use Of Science In Conservation: Lessons From The Florida Panther". Journal of Wildlife Management 70 (1): 1–7. doi:10.2193/0022-541X(2006)70[1:ITUOSI]2.0.CO;2. http://www.bioone.org/doi/abs/10.2193/0022-541X%282006%2970%5B1%3AITUOSI%5D2.0.CO%3B2. Retrieved June 11, 2007. 
  25. ^ The Florida Panther Recovery Team (January 31, 2006). "Florida Panther Recovery Program (Draft)" (PDF). U.S. Fish and Wildlife Service. Archived from the original on June 16, 2007. http://web.archive.org/web/20070616200443/http://www.fws.gov/verobeach/Florida+panther+files/Panther+Recovery+Plan+2006_01_31+-+no+figures.pdf. Retrieved June 11, 2007. 
  26. ^ Expanding Cougar Population The Cougar Net.org
  27. ^ Florida Panther Facts. Florida Panther Refuge
  28. ^ "Mountain Lion (Puma concolor)". Texas Parks and Wildlife. http://www.tpwd.state.tx.us/huntwild/wild/species/mlion/. Retrieved March 30, 2007. 
  29. ^ a b "Eastern Cougar Fact Sheet". New York State Department of Environmental Conservat ion. http://www.dec.ny.gov/animals/6974.html. Retrieved March 30, 2007. 
  30. ^ ADW: Puma concolor: Information. Animaldiversity.ummz.umich.edu. Retrieved on September 15, 2011.
  31. ^ a b c d e f g h i j Nowell, K. and Jackson, P (2006) (PDF). Wild Cats. Status Survey and Conservation Action Plan.. IUCN/SSC Cat Specialist Group. IUCN, Gland, Switzerland. http://carnivoractionplans1.free.fr/wildcats.pdf. Retrieved July 27, 2007. 
  32. ^ "University of Michigan Museum of Zoology, Animal Diversity Web — Felis concolor information". http://animaldiversity.ummz.umich.edu/site/accounts/information/Puma_concolor.html. 
  33. ^ "Puma concolor – Mountain Lion – Discover Life". Pick4.pick.uga.edu. http://pick4.pick.uga.edu/mp/20q?search=Puma+concolor. Retrieved February 16, 2011. 
  34. ^ Brakefield, Tom (1993). ISBN 0-89658-329-5. 
  35. ^ Spalding, D. J.. "Cougar in British Columbia". http://www.env.gov.bc.ca/wld/documents/cougar.htm. 
  36. ^ a b c "Cougar". Hinterland Who's Who. Canadian Wildlife Service and Canadian Wildlife Federation. http://www.hww.ca/hww2.asp?pid=1&id=87&cid=8. Retrieved May 22, 2007. 
  37. ^ Weissengruber, GE; G Forstenpointner, G Peters, A Kübber-Heiss, and WT Fitch (2002). "Hyoid apparatus and pharynx in the lion (Panthera leo), jaguar (Panthera onca), tiger (Panthera tigris), cheetah (Acinonyx jubatus) and domestic cat (Felis silvestris f. catus)". Journal of Anatomy (Anatomical Society of Great Britain and Ireland) 201 (201): 195–209. doi:10.1046/j.1469-7580.2002.00088.x. PMC 1570911. PMID 12363272. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1570911. 
  38. ^ Maurice G. Hornocker; Sharon Negri (December 15, 2009). Cougar: ecology and conservation. University of Chicago Press. pp. 114–. ISBN 978-0-226-35344-9. http://books.google.com/books?id=ZSDUxT3fSYEC&pg=PA114. Retrieved September 15, 2011. 
  39. ^ "About Eastern Cougars". Eastern Cougar Foundation. http://www.easterncougar.org/pages/abouteasterncougars.htm. Retrieved June 3, 2007. 
  40. ^ "Black cougar more talk than fact". Tahlequah Daily Press. February 1, 2006. http://www.news-tribune.net/features/cnhinsoutdoors_story_032111454.html. Retrieved May 20, 2007. "Game Warden: Never in the history of the United States has there ever been, in captivity or in the wild, a documented black mountain lion" 
  41. ^ "Mutant Pumas". http://www.messybeast.com/genetics/mutant-pumas.html. 
  42. ^ "Mountain Lion (Puma, Cougar)". San Diego Zoo.org. Zoological Society of San Diego. http://www.sandiegozoo.org/animalbytes/t-puma.html. Retrieved April 2, 2007. 
  43. ^ a b c "Cougars in Canada (Just the Facts)". Canadian Geographic Magazine. http://www.canadiangeographic.ca/Magazine/mj04/indepth/justthefacts.asp. Retrieved April 2, 2007. 
  44. ^ a b c "Mountain Lion, Felis concolor". Sierra Club. http://arizona.sierraclub.org/conservation/mt-lion/index.asp. Retrieved May 20, 2007. 
  45. ^ Turner, John W.; Morrison, Michael L. (2008). "Influence of Predation by Mountain Lions on Numbers and Survivorship of a Feral Horse Population". The Southwestern Naturalist 46 (2): 183–190. doi:10.2307/3672527. JSTOR 3672527. http://wf2dnvr2.webfeat.org/. Retrieved August 29, 2008. 
  46. ^ a b "Wildlife: Wolves". Yellowstone National Park. http://www.yellowstonenationalpark.com/wolves.htm. Retrieved April 8, 2007. 
    * Holly Akenson, James Akenson, Howard Quigley. "Winter Predation and Interactions of Wolves and Cougars on Panther Creek in Central Idaho". http://www.yellowstonenationalpark.com/wolves.htm. 
    * John K. Oakleaf, Curt Mack, Dennis L. Murray. "Winter Predation and Interactions of Cougars and Wolves in the Central Idaho Wilderness". http://www.yellowstonenationalpark.com/wolves.htm. 
  47. ^ Ross, R.; Jalkotzy, MG., Festa-Bianchet, M. (May 1993). "Cougar predation on bighorn sheep in southwestern Alberta during winter". Canadian Journal of Zoology 75 (5): 771–75. doi:10.1139/z97-098. http://md1.csa.com/partners/viewrecord.php?requester=gs&collection=ENV&recid=4321651. Retrieved April 8, 2007. 
  48. ^ Bauer, Jim W.; Kenneth A. Logan, Linda L. Sweanor, Walter M. Boyce (December 2005). Jones, Cheri A.. ed. "Scavenging behavior in Puma". The Southwestern Naturalist 50 (4): 466–471. doi:10.1894/0038-4909(2005)050[0466:SBIP]2.0.CO;2. ISSN 0038-4909. 
  49. ^ a b c d e Cougar Discussion Group (January 27, 1999). "Utah Cougar Management Plan (Draft)" (PDF). Utah Division of Wildlife Resources. http://www.wildlife.utah.gov/pdf/cmgtplan.pdf. Retrieved May 2, 2007. 
  50. ^ a b Matthew Hamilton; Peter Hundt, Ryan Piorkowski. "Mountain Lions". University of Wisconsin, Stevens Point. http://www.uwsp.edu/wildlife/carnivore/Mountain%20Lion%20Natural%20History_files/Mountain%20Lion%20Natural%20History_copy(1).htm. Retrieved May 10, 2007. 
  51. ^ Bonier, F., H. Quigley, S. Austad (2004). "A technique for non-invasively detecting stress response in cougars". Wildlife Society Bulletin 32 (3): 711–717. doi:10.2193/0091-7648(2004)032[0711:ATFNDS]2.0.CO;2. http://post.queensu.ca/~bonierf/pubs/pub1.pdf. 
  52. ^ "Staying safe in cougar country". Wildlife.utah.gov. http://wildlife.utah.gov/dwr/learn-more/living-with-cougars.html. Retrieved October 6, 2011. 
  53. ^ a b Sweanor, Linda; Kenneth A. Logan, Maurice G. Hornocker (2000). "Cougar Dispersal Patterns, Metapopulation Dynamics, and Conservation". Conservation Biology 14 (3): 798–808. doi:10.1046/j.1523-1739.2000.99079.x. 
  54. ^ "Scratch". http://www.bigcatrescue.org/forever/scratchcougar.htm. Retrieved August 21, 2009. 
  55. ^ Biek, Roman; Allen G. Rodrigo, David Holley, Alexei Drummond, Charles R. Anderson Jr., Howard A. Ross, and Mary Poss (September 2003). "Epidemiology, Genetic Diversity, and Evolution of Endemic Feline Immunodeficiency Virus in a Population of Wild Cougars". Journal of Virology 77 (17): 9578–89. doi:10.1128/JVI.77.17.9578-9589.2003. PMC 187433. PMID 12915571. http://jvi.asm.org/cgi/content/abstract/77/17/9578. Retrieved May 22, 2007. 
  56. ^ a b Mahaffy, James (December 2004). "Behavior of cougar in Iowa and the Midwest". Dordt College. http://homepages.dordt.edu/~mahaffy/mtlion/mtlionshort_behaviour.html. Retrieved May 11, 2007. 
  57. ^ "Mountain Lion (Felis concolor) study on Boulder Open Space" (PDF). Letter to the Parks and Open Space Advisory Committee, Boulder, Colorado. Sinapu. March 22, 2007. http://www.sinapu.org/PDF/Front%20Range%20lion%20study.pdf. Retrieved May 11, 2007. 
  58. ^ Marschall, Laurence A. (March 2005). "Bookshelf". Natural Selections. Natural History Magazine. http://www.naturalhistorymag.com/master.html?http://www.naturalhistorymag.com/0305/0305_selections.html. Retrieved May 6, 2007. 
  59. ^ Belanger, Joe (May 25, 2007). "DNA tests reveal cougars roam region". London Free Press. http://pbdba.lfpress.com/cgi-bin/publish.cgi?p=183996&s=pets_nature. Retrieved June 5, 2007. 
  60. ^ Board of Directors (2004). "The "Big" Picture". The Cougar Network. http://www.cougarnet.org/bigpicture.html. Retrieved May 20, 2007.  The Cougar Network methodology is recognized by the U.S. Fish and Wildlife Service.
  61. ^ [MRNF] (2010). "Your part in helping endangered species". Quebec MRNF. http://www.mrnf.gouv.qc.ca/faune/especes/menacees/faire.jsp. Retrieved January 7, 2010.  Ministry of Wildlife and natural resources Wildlife Service.
  62. ^ "NH Sightings Catamount" (PDF). Beech River Books. http://www.rick-davidson.com/PDF/Mountain%20Lion%20Sightings%20Open%20Office%20092008%20photo%20final.pdf. Retrieved March 20, 2009. 
  63. ^ "Skinner, Victor. 2009. Photo shows cougar presence in Michigan. The Grand Rapids Press. November 15, 2009". Mlive.com. http://www.mlive.com/outdoors/index.ssf/2009/11/photo_shows_cougar_presence_in.html. Retrieved February 16, 2011. 
  64. ^ "Cedar Rapids man shoots mountain lion in Iowa County". Cedar Rapids Gazette. December 15, 2009. http://gazetteonline.com/breaking-news/2009/12/15/cedar-rapids-man-shoots-mountain-lion-in-iowa-county. Retrieved December 16, 2009. 
  65. ^ Carlson, James A. (April 22, 2009). "Sightings show cougars expanding into central US". Seattle Times. http://seattletimes.nwsource.com/html/nationworld/2009099370_apuslivingwithlions.html. Retrieved April 22, 2009. 
  66. ^ "DNR confirms Indiana mountain lion sighting". WISHTV8.com. http://www.wishtv.com/dpp/news/local/south_central/dnr-confirms-indiana-mountain-lion-sighting. Retrieved July 5, 2010. 
  67. ^ "Mountain lion reportedly spotted roaming Connecticut town". Fox News. June 10, 2011. http://www.foxnews.com/us/2011/06/10/mountain-lion-reportedly-spotted-roaming-connecticut-town/. Retrieved June 12, 2011. 
  68. ^ "Mountain Lion killed by car on Connnecticut highway". CNN. June 11, 2011. http://www.cnn.com/2011/US/06/11/connecticut.mountain.lion/index.html. 
  69. ^ David Baron The Cougar Behind Your Trash Can. New York Times. July 29, 2011
  70. ^ "Cougar facts" (PDF). National Wildlife Federation. http://www.nwf.org/cats/pdfs/cougarfacts.pdf. Retrieved May 20, 2007. 
  71. ^ "Cougar Management Plan". Wildlife Division: Wildlife Management Plans. Oregon Department of Fish and Wildlife. 2006. http://www.dfw.state.or.us/wildlife/cougar/. Retrieved May 20, 2007. 
  72. ^ a b c "Mountain Lions in California". California Department of Fish and Game. 2004. Archived from the original on April 30, 2007. http://web.archive.org/web/20070430012010/http://www.dfg.ca.gov/news/issues/lion.html. Retrieved May 20, 2007. 
  73. ^ a b c "Safety Guide to Cougars". Environmental Stewardship Division. Government of British Columbia, Ministry of Environment. 1991. http://www.env.gov.bc.ca/wld/documents/cougsf.htm. Retrieved May 28, 2007. 
  74. ^ COSEWIC. Canadian Wildlife Service (2002) (PDF). Assessment and Update Status Report on the Grizzly Bear (Ursus arctos). Environment Canada. http://dsp-psd.pwgsc.gc.ca/Collection/CW69-14-166-2002E.pdf. Retrieved April 8, 2007. 
  75. ^ Gugliotta, Guy (May 19, 2003). "In Yellowstone, it's Carnivore Competition". Washington Post. http://www.washingtonpost.com/ac2/wp-dyn?pagename=article&node=&contentId=A2158-2003May17&notFound=true. Retrieved April 9, 2007. 
  76. ^ "Overview: Gray Wolves". Greater Yellowstone Learning Center. Archived from the original on September 29, 2007. http://web.archive.org/web/20070929115515/http://www.greateryellowstonescience.org/topic/wolves/wolvesoverview.html. Retrieved April 9, 2007. 
  77. ^ Cockle, Richard (October 29, 2006). "Turf wars in Idaho's wilderness". The Oregonian. http://www.oregonwild.org/press-room/press-clips/turf-wars-in-idaho-s-wilderness. Retrieved April 9, 2007. 
  78. ^ Hamdig, Paul. "Sympatric Jaguar and Puma". Ecology Online Sweden. Archived from the original on July 16, 2006. http://web.archive.org/web/20060716064117/http://www.ecology.info/ecology-jaguar-puma.htm. Retrieved August 30, 2006. 
  79. ^ Rodrigo Nuanaez, Brian Miller, and Fred Lindzey (2000). "Food habits of jaguars and pumas in Jalisco, Mexico". Journal of Zoology 252 (3): 373. http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=58851. Retrieved August 8, 2006. 
  80. ^ Robinson, Hugh S.; Robert B. Wielgus, and John C. Gwilliam (2002). "Cougar predation and population growth of sympatric mule deer and white-tailed deer". Canadian Journal of Zoology 80 (3): 556–68. doi:10.1139/z02-025. http://rparticle.web-p.cisti.nrc.ca/rparticle/AbstractTemplateServlet?journal=cjz&volume=80&year=&issue=&msno=z02-025&calyLang=fra. Retrieved May 20, 2007. 
  81. ^ Bryant, Andrew A.; Page, Rick E. (May 2005). "Cougar predation and population growth of sympatric mule deer and white-tailed deer". Canadian Journal of Zoology 83 (5): 674–82. doi:10.1139/z05-055. http://www.ingentaconnect.com/content/nrc/cjz/2005/00000083/00000005/art00006?crawler=true. Retrieved May 20, 2007. 
  82. ^ Fountain, Henry. "Observatory: When Mountain Lions Hunt, They Prey on the Weak" November 16, 2009 New York Times.
  83. ^ Weaver, John L.; Paquet, Paul C.; Ruggiero, Leonard F. (1996). "Resilience and Conservation of Large Carnivores in the Rocky Mountains". Conservation Biology 10 (4): 964. doi:10.1046/j.1523-1739.1996.10040964.x. 
  84. ^ "Geocites – Liger & Tigon Info". Archived from the original on October 15, 2007. http://web.archive.org/web/20071015110856/http://www.geocities.com/pride_lands/Liger_Tigon.html. Retrieved June 9, 2008. 
  85. ^ "Appendices I, II and III". Convention on International Trade in Endangered Species of Wild Fauna and Flora. http://www.cites.org/eng/app/appendices.php. Retrieved May 24, 2007. 
  86. ^ Bolgiano, Chris (August 1995). Mountain Lion:An Unnatural History of Pumas and People (Hardcover ed.). Mechanicsburg, PA: Stackpole Books. ISBN 978-0-8117-1044-2. 
  87. ^ Eberhart, George M. (2002). Mysterious Creatures: A Guide to Cryptozoology. Volume 2. Santa Barbara, CA: ABC-CLIO. pp. 153–161. ISBN 1-57607-283-5. http://www.ebook3000.com/animals/Mysterious-Creatures--A-Guide-to-Cryptozoology_64383.html. 
  88. ^ "Eastern Cougar". Endangered and Threatened Species of the Southeastern United States (The Red Book). U.S. Fish and Wildlife Service. 1991. Archived from the original on April 3, 2007. http://web.archive.org/web/20070403000340/http://www.fws.gov/endangered/i/a/saa48.html. Retrieved May 20, 2007. 
  89. ^ "Florida Panther". Endangered and Threatened Species of the Southeastern United States (The Red Book). United States Fish and Wildlife Service. 1993. Archived from the original on June 4, 2007. http://web.archive.org/web/20070604163840/http://www.fws.gov/endangered/i/a/saa05.html. Retrieved June 7, 2007. 
  90. ^ "Florida Fish and Wildlife Conservation Commission. 2002–2003 Panther Genetfic Restoration Annual Report" (PDF). Archived from the original on June 16, 2007. http://web.archive.org/web/20070616200443/http://myfwc.com/panther/news/pdf/FWC2002-2003PantherGeneticRestorationAnnualReport.pdf. Retrieved June 5, 2007. 
  91. ^ Barringer, Felicity (March 2, 2011). "U.S. Declares Eastern Cougar Extinct, With an Asterisk". The New York Times. http://www.nytimes.com/2011/03/01/us/03cougar.html?hpw. Retrieved March 2, 2011. 
  92. ^ Committee on Status of Endangered Wildlife in Canada. Cosewic.gc.ca. Retrieved on September 15, 2011.
  93. ^ Eastern Cougar, Nature Canada. Naturecanada.ca. Retrieved on September 15, 2011.
  94. ^ TPWD: Mountain Lions. Tpwd.state.tx.us (July 16, 2007). Retrieved on September 15, 2011.
  95. ^ ""Bay Area Puma Project" information page, Felidae Conservation Fund, accessed 18 February 2009". Felidaefund.org. http://www.felidaefund.org/research/bapp.html. Retrieved March 8, 2009. 
  96. ^ Beier, Paul (March 1993). "Determining Minimum Habitat Areas and Habitat Corridors for Cougars". Conservation Biology 7 (1): 94–108. doi:10.1046/j.1523-1739.1993.07010094.x. JSTOR 2386646. 
  97. ^ Northeast Region, U.S. Fish and Wildlife Service. Fws.gov. Retrieved on September 15, 2011.
  98. ^ Berrin, Katherine & Larco Museum. The Spirit of Ancient Peru:Treasures from the Museo Arqueológico Rafael Larco Herrera. New York: Thames and Hudson, 1997.
  99. ^ Tarmo, Kulmar; Kait Realo (translator). "On the role of Creation and Origin Myths in the Development of Inca State and Religion". Electronic Journal of Folklore. Estonian Folklore Institute. http://folklore.ee/folklore/vol12/inca.htm. Retrieved May 22, 2007. 
  100. ^ Cougars, The Encyclopedia of Hočąk (Winnebago) Mythology. Retrieved: 2009/12/08.
  101. ^ "Living with Wildlife: Cougars" (PDF). USDA Wildlife Services. http://www.aphis.usda.gov/wildlife_damage/nwrc/publications/living/cougar.pdf. Retrieved April 11, 2009. 
  102. ^ "Cattle report 1990". National Agricultural Statistics Service accessdate=September 11, 2009. http://usda.mannlib.cornell.edu/usda/nass/Catt//1990s/1990/Catt-07-27-1990.pdf. 
  103. ^ "Sheep and Goats report 1990". National Agricultural Statistics Service. http://usda.mannlib.cornell.edu/usda/nass/SheeGoat//1990s/1990/SheeGoat-02-02-1990.pdf. Retrieved September 11, 2009. 
  104. ^ "Mountain Lion Fact Sheet". Abundant Wildlife Society of North America. http://www.aws.vcn.com/mountain_lion_fact_sheet.html. Retrieved July 10, 2008. 
  105. ^ "Cougar Predation – Description". Procedures for Evaluating Predation on Livestock and Wildlife. http://agrilife.org/texnatwildlife/predators-and-predation/predator-species/cougars/. Retrieved August 3, 2008. 
  106. ^ a b Beier, Paul (1991). "Cougar attacks on humans in United States and Canada". Wildlife Society Bulletin. Northern Arizon University. http://users.frii.com/mytymyk/lions/beier.htm. Retrieved May 20, 2007. 
  107. ^ "Confirmed mountain lion attacks in the United States and Canada 1890 – present". Arizona Game and Fish. http://www.azgfd.gov/w_c/mtn_lion_attacks.shtml. Retrieved May 20, 2007. 
  108. ^ Search continues for mountain lion that killed Pinos Altos man, New Mexico Department of Game and Fish, press release June 23, 2008; Wounded mountain lion captured, killed near Pinos Altos, New Mexico Department of Game and Fish, press release June 25, 2008]; Second mountain lion captured near Pinos Altos, New Mexico Department of Game and Fish, press release July 1, 2008]
  109. ^ Subramanian, Sushma (April 14, 2009). "Should You Run or Freeze When You See a Mountain Lion?". Scientific American. http://www.scientificamerican.com/article.cfm?id=should-you-run-or-freeze-when-you-see-a-mountain-lion. Retrieved March 10, 2012. 
  110. ^ Pamphlet: "Mountain Lions in Sabino and Madera Canyons and on Mt. Lemmon". 
  111. ^ "Neighbor saves Miami teen from cougar". Associated Press. MSNBC. November 16, 2008. http://www.msnbc.msn.com/id/27756765/ns/us_news-life/t/neighbor-saves-miami-teen-cougar/. Retrieved February 11, 2012. 
  112. ^ "2-Year-Old Boy Hurt In Pet Cougar Attack". New York Times. June 4, 1995. http://www.nytimes.com/1995/06/04/nyregion/2-year-old-boy-hurt-in-pet-cougar-attack.html. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Felis. Placed in the genus Puma by Wozencraft (in Wilson and Reeder 1993, 2005) and Jones et al. (1997).

Mitochondrial DNA analysis by Culver et al. (2000) revealed genetic uniformity across all regions of North America, relative to Central and South American populations, Culver et al. (2000) postulate that cougars were extirpated from North America during the Pleistocene extinctions of many large mammals, and only recently (circa 10,000 years ago) reinvaded North America; they suggest only one subspecies should be recognized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!