Overview

Comprehensive Description

Miscellaneous Details

"Where not much pursued or fired at, it will often allow men to come in the open within about 150 yards, sometimes nearer. Of country-carts, bullocks, or coolies carrying loads, it often takes but little notice at half that distance. The speed and endurance of the antelope are well known. Col. W. Campbell, in 'My Indian Journal,' relates how his brother, on a fast Arab horse, once ran down and speared a bucknear Dharwar, but the feat has not often been repeated. Wounded antelope are often ridden down, but sometimes require a good horse to catch them. I was once completely beaten on fair ground by a buck with a broken fore-leg, but I was on a horse that, although speedy, had but little endurance. Jerdon says : """"Very rarely good greyhounds have pulled down this antelope nwounded on ordinary ground; but there are at least three localities where this coursing used to be practised successfully."""" The localities were on heavy sand at Pooree in Orissa and at Sirsa in the Punjab, and on fine pasture land at Point Calimere, south of Trichinopoly. Jerdon adds that on soft ground, during the rains, antelope are easily caught by good dogs. He also says : """"Greyhounds are very keen after a wounded antelope, and occasionally get savage and fight over it when pulled down."""" This is confirmed by McMaster. Like most antelopes, and indeed ruminants in general, this species is easily tamed, if captured young. Many used to be taken in nets or in snares, and one native method of capturing the bucks was to send a tame black buck with nooses attached to his horns into the herd, and to seize the wild one when entangled in the fight which inevitably ensued. The flesh of the Indian antelope is excellent (Blanford 1888)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Summary

"The Blackbuck is the only living species in the genus Antilope. Male blackbucks are dark brown, black, and white and have long, twisted horns, while females are fawn-coloured with no horns. They generally live in herds of 15-20 individuals with a dominant male. They are very fast and was chiefly preyed upon by the now extinct Cheetah. It feeds mostly on grasses."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Blackbuck formerly occurred across almost the whole of the Indian subcontinent. Their range decreased sharply during the 20th century and they are now extinct in Bangladesh, Nepal and Pakistan. Attempted reintroductions have taken place in Pakistan and Nepal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The blackbuck is found in Pakistan and India.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Pakistan (extirpated but reintroduced) and India, from Punjab south to Madras and east to Bihar (formerly up to Assam); extirpated in Bangladesh and now localized in India; native range now much reduced; introduced in Nepal, Argentina, and Texas (Grubb, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"The horns vary in divergence and in closeness of spiral ; in some the points are not more than 7 inches apart, in others as much as 20, irrespective of length ; the turns of the spiral in adults vary from less than 3 to 5. Horned females are occasionally, but very rarely, met with. Colour of does and young bucks yellowish-fawn above and on the outside of the limbs, lower parts white, the two colours sharply divided ; a distinct pale lateral band a little above the line of division. Old bucks are blackish brown above, becoming almost black in very old animals, except on the nape, which remains brownish rufous, whilst the sides and front of the neck, and also the face except a white area round each eye, are blackish brown. The pale lateral band disappears in old males."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Adult bucks stand approximately 73.7 - 83.8cm at the shoulder and on average have a head and body length of 120cm. The blackbuck is one of the few antelope whose color differs between sexes. The males are rich dark brown above, on the sides, and on the outside of the legs. Females tend to be yellowish in the same areas. Both sexes exhibit white underparts and insides of the legs, and a prominent white circular patch around the eye. Also, males gradually become darker with age. Blackbucks have a graceful and slender built. The horns are borne only by males and range from 50 - 61 cm; they are ringed at the base and twist spirally up to approxiamtely 4 turns. The narrow muzzle is sheeplike, the tail is short, and the hooves are delicate and sharply pointed.

Range mass: 32 to 43 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

"Length about 4 feet to root of tail, which is 7 inches; height at shoulder 32 inches;.5ear 5|. Horns from 20 to 27 inches long, diverging at the tip from 9 to 18 inches."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species inhabits grassland and lightly-wooded country. They require water daily, which restricts distribution to areas where surface water is available for the greater part of the year. Blackbuck are primarily grazers. And mainly sedentary, but in summer may move long distances in search of water and forage (Rahmani 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Blackbuck live on open woodlands and semi-desert areas, but also enjoy areas with thorn or dry deciduous forest. They like to stay near areas where grassland is available. On hot days blackbucks rest in the shade.

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: Habitat in Texas include areas with a patchwork of grassland and brush (Schmidly 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Blackbuck are grazers, they feed on short grass and various cultivated cereals. Concerning their drinking habits, T.J. Roberts writes, " It has been reliably established that they do not drink water even when it is available . . . It may be, that they can recirculate the nitrogen in their bodies rather than having to excrete it in their urine."

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Antilope cervicapra (antelopes, gazelle, backbuck, nilgai) is prey of:
Canis lupus
Canis lupus familiaris

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Antilope cervicapra (antelopes, gazelle, backbuck, nilgai) preys on:
Eleucine
Cyperus
Cenchrus
Zizyphus
Crotalaria
Prosopis cineraria

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"Open plains of short grass, level or undulating, and cultivated laiid are the usual haunts of the Indian antelope, which is generally found in herds ; these are sometimes extremely numerous, and comprise occasionally several thousand animals of both sexes and all ages ; but more often small herds of does, generally 10 to 30 in number, but sometimes as many as 50, are met with, attended by a single black buck, which does not always accompany the females. Very often two or three younger bucks coloured like the does remain with the latter ; but these young males are sometimes driven away by older bucks, and form separate herds. This antelope never enters forest nor high grass, and is but rarely seen amongst bushes. The Indian antelope appears to have no particular hours for feeding, though it generally rests in the middle of the day. The Indian antelope, has the habit of occasionally springing into the air, all the members of a herd generally bounding, one after the other. This is done, before they are much frightened, and when the herd is first moving off. When at speed the gallop is like that of any other animal. Occasionally these antelopes conceal themselves in grass or culti-vation, and wounded animals not unfrequently hide. Young fawns, too, are generally concealed by the mothers. The only sound the buck utter is a peculiar grunt that he makes when excited ; the females have a hissing alarm note, according to Forsyth. Like most other Indian antelopes, they deposit their dung repeatedly on the same spot. The rutting-season, says Mr. Elliot, commences about February or March, but fawns are seen of all ages at every season. During the spring months the buck often separates a particular doe from the herd, and will not suffer her to join it again, cutting her off and intercepting every attempt to mingle with the rest. The two are often found alone also, but on being followed always rejoin the herd."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: wild:
18.0 years.

Average lifespan

Status: wild:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.9 years (captivity) Observations: In captivity, these animals can live up to 23.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating occurs throughout the year, with the most rutting activity in March - April and August - October. During the rut, the mature male establishes a territory by regularly depositing faeces in particular places. Males are extremely aggressive during this time and drive all other males from their territory by a throaty grunt and an ocassional horn fight. The gestation period is about six months, and most of the time a single young is born. The young is able to run about soon after birth.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 5 to 6 months.

Range weaning age: 1.87 to 2.1 months.

Average weaning age: 1.985 months.

Average birth mass: 3850 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
466 days.

Parental Investment: precocial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproductively active nearly year-round in Texas (Howery et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antilope cervicapra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCACAAAGATATTGGTACCCTGTATCTCCTATTTGGTGCCTGAGCTGGCATAGTAGGAACCGCCTTAAGCTTATTAATTCGTGCTGAATTAGGCCAACCCGGAACTTTACTCGGAGATGATCAGATTTATAATGTAGTCGTAACTGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCTATTATAATCGGAGGATTTGGTAATTGACTAGTCCCCCTAATAATTGGCGCTCCCGACATAGCATTTCCCCGAATAAACAACATGAGCTTCTGACTTCTCCCTCCCTCTTTTCTATTGCTCCTAGCATCTTCTATAGTTGAAGCAGGAGCAGGGACAGGCTGAACTGTATACCCTCCTCTAGCGGGCAACCTGGCCCACGCAGGTGCTTCAGTAGATCTAACCATCTTCTCTCTTCACCTGGCAGGTGTCTCCTCAATCTTAGGTGCCATTAACTTTATTACAACAATTATTAATATAAAACCTCCCGCAATATCGCAATATCAAACCCCTCTATTTGTGTGATCTGTCTTAATTACCGCCGTACTTCTACTCCTTTCACTTCCTGTACTAGCTGCTGGCATTACAATACTTCTAACAGACCGAAACCTAAATACAACCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATCCTATATCAACACCTATTCTGATTCTTTGGACACCCTGAAGTATATATTCTCATCCTACCCGGATTTGGAATAATTTCCCACATTGTTACCTACTACTCAGGGAAGAAAGAACCATTTGGGTACATGGGAATAGTATGAGCTATGATATCCATCGGGTTTTTAGGATTCATTGTATGAGCCCACCATATATTTACAGTCGGAATAGACGTCGACACACGAGCCTACTTCACATCAGCTACCATAATTATTGCTATTCCAACTGGAGTAAAAGTCTTCAGCTGACTAGCCACGCTTCACGGAGGTAACATTAAATGATCACCTGCTATAATATGAGCACTAGGCTTTATTTTCCTCTTTACAGTCGGAGGCTTGACTGGAATCGTCCTCGCTAACTCCTCTCTTGATATTGTTCTCCACGACACATACTATGTAGTTGCACACTTTCACTATGTATTATCAATAGGAGCCGTGTTTGCCATCATAGGAGGGTTCGTACACTGATTCCCACTATTCTCAGGCTACACCCTTAATGATACATGAGCCAAGATTCACTTCGCAATTATATTTGTAGGTGTAAACATAACCTTCTTCCCACAACATTTCCTAGGATTATCCGGAATGCCACGACGATACTCCGACTACCCCGATGCATACACAATATGAAACACTATTTCATCTATGGGCTCATTCATCTCACTAACAGCAGTGATATTAATAATTTTTATCATTTGAGAAGCATTTGCGTCCAAACGGGAAGTCCTGACTGTAGATCTTACCACAACAAATTTAGAGTGACTAAATGGATGCCCTCCCCCATATCACACATTTGAAGAGCCCACATATGTTAACTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Antilope cervicapra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Rahmani, A.R. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
Range and numbers have declined sharply during the last 100 years. More recently, numbers increased from 24,000 in the late 1970s to an estimated 50,000, and the population was described as reasonably secure and increasing in many protected areas and a crop pest in some places (Rahmani 2001). However, Blackbuck habitat is subject to heavy pressure from human population growth, increasing numbers of domestic livestock, and economic development. The area available is declining and the species is estimated to be close to meeting the 30% decline figure over ten years that would qualify for Vulnerable under criterion A3c.

History
  • 2003
    Near Threatened
    (IUCN 2003)
  • 2003
    Near Threatened
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red List Category & Criteria: Near Threatened ver 3.1 Year Published: 2008
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The blackbuck was once the most abundant hoofed mammal in India and Pakistan, but their populations have been greatly reducedthrough excessive hunting and loss of habitat due to agricultural development.

US Federal List: no special status

CITES: appendix iii

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Native to Pakistan (extirpated but reintroduced) and India, from Punjab south to Madras and east to Bihar (formerly up to Assam); extirpated in Bangladesh and now localized in India; native range now much reduced; introduced in Nepal, Argentina, and Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population has increased from an estimated 22,000-24,000 in the 1970s to an estimated 50,000. The largest numbers are found in the states of Rajasthan, Punjab, Madhya Pradesh, Maharashtra, and Gujurat (Rahmani 2001). Introduced populations in Argentina and the USA may number 8,600 and 35,000, respectively (Mallon and Kingswood 2001).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Although Blackbuck have disappeared from many areas due to habitat destruction through conversion to agricultural use, they are increasing in many protected areas and areas dominated by Vishnoi communities in Rajasthan and Haryana (Rahmani 2001). In some areas, the population has increased so much that the Blackbuck has become a pest in agricultural crops. Some Blackbuck are shot illegally, especially in areas where it shares the same habitat with Nilgai.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat destruction.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Fully protected by law in India. Occurs in many protected areas, including Velavadar Blackbuck Sanctuary and Point Calimere Wildlife Sanctuary.

Listed in CITES Appendix III (Nepal).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Blackbucks have a tendency to raid crops, paticularly sorghum and millet. As a result, farmers lose crops and money. Many farmers set up traps and hunt the blackbuck to stop them from destroying crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The blackbuck is prized for its meat.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blackbuck

The blackbuck (Antilope cervicapra) is an ungulate species of antelope native to the Indian Subcontinent that has been classified as near threatened by IUCN since 2003, as its range has decreased sharply during the 20th century. The native population is stable, with an estimated 50,000 individuals.[1]

The blackbuck is the only living species of the genus Antilope.[2][3] Its generic name stems from the Latin word antalopus, a horned animal.[4] The specific name cervicapra is composed of the Latin words capra, she-goat and cervus, deer.[5]

Characteristics[edit]

Male and female blackbucks

Blackbucks generally resemble gazelle, found on the Arabian peninsula. Blackbucks are slender with a head-to-body length of about 120 cm (47 in). They are about 73.7 to 83.8 cm (29.0 to 33.0 in) high at the shoulder.[3] Males are larger than females. Adult males range in weight from 34 to 45 kg (75 to 99 lb); females weigh 31 to 39 kg (68 to 86 lb).[6] The tail is short and compressed. Both sexes are white on the belly, around the eyes and on the inside of the legs. They differ in the coloration of the head and back. Female and young blackbucks are yellowish-fawn coloured on the back and on the outside of the limbs; the lower parts are white. The two colours are sharply divided by a distinct pale lateral band. Old male bucks are blackish brown on the back, on the sides and front of the neck. They become almost black with age, only the nape remains brownish rufous, and the pale lateral band disappears. Only males have horns that are diverging, cylindrical, spiral, and ringed throughout. The rings are closer together near the skull. The turns of the spiral vary from less than 3 to 5.[2] Horns are 45.6–68.5 cm (18.0–27.0 in) long.[3]

Horns can be as long as 71 cm (28 in). Blackbucks closely resemble kobs.[7]

Albinism in blackbuck is rare and caused by the lack of the pigment melanin. Wildlife experts say the biggest problem with these albinos is they are singled out by predators and hunted.[citation needed]

Distribution and habitat[edit]

Antelope jumping in Hyderabad

In the 19th century, blackbucks ranged in open plains from the base of the Himalayas to the neighbourhood of Cape Comorin, and from the Punjab to Lower Assam. They were abundant in the North-Western Provinces, Rajputana, parts of the Deccan, and on the plains near the coast of Orissa and Lower Bengal. Herds occasionally comprised several thousand animals of both sexes and all ages.[2]

Today, the blackbuck population is confined to areas in Maharashtra, Odisha, Punjab, Rajasthan, Haryana, Gujarat, Andhra Pradesh, Tamil Nadu and Karnataka, with a few small pockets in central India. They occur in several protected areas of India including:[8]

In Nepal, the last surviving population of blackbuck is found in the Blackbuck Conservation Area south of the Bardia National Park. In 2008, the population was estimated at 184.[13]

In Pakistan, blackbucks are irregular vagrants moving along the border areas with India. They are kept in enclosures in the Lal Suhanra National Park for possible reintroduction. They are considered extinct in Bangladesh.[8]

Two subspecies are recognized:[14]

  • A. c. cervicapra (nominate subspecies)
  • A. c. rajputanae

Blackbucks were introduced to Argentina and the USA. These populations numbered about 43,600 individuals at the turn of the century.[8]

Ecology and behaviour[edit]

Blackbuck fleeing at Point Calimere Wildlife Sanctuary, Tamil Nadu, India

Blackbucks generally live on open plains and open woodlands in herds of 5 to 50 animals with one dominant male. They are very fast. Speeds of more than 80 km/h (50 mph) have been recorded.[3]

They are primarily grazers and avoid forested areas. They require water every day and may move long distances in search of water and forage in summer. Usually, they feed during the day. Their diet consists mostly of grasses, but they have occasionally been observed browsing on acacia trees in the Cholistan Desert.[8] In the Velavadar National Park, they were observed feeding on pods of Prosopis juliflora during seasonal lows in forage quality.[9]

Their chief predator was the now extinct Asiatic cheetah.[15] Currently, wolves are the main predators of both fawns and adults. Fawns are also hunted by jackals. Village dogs are reported to kill fawns but are unlikely to successfully hunt and kill adults.[6]

The maximum life span recorded is 16 years and the average is 12 years.[citation needed]

Threats[edit]

Royalty hunting blackbuck with Asiatic cheetah in South Gujarat, 1812

The main threats to the species are poaching, predation, habitat destruction, overgrazing, diseases, inbreeding and sanctuary visitors.

Large herds once roamed freely on the plains of North India, where they thrived best. During the 18th, 19th and the first half of the 20th centuries, blackbuck was the most hunted wild animal all over India. Until India's independence in 1947, many princely states hunted this antelope and Indian gazelle, the chinkara, with specially trained captive Asiatic cheetahs. (Asiatic cheetahs became extinct in the 1960s.) It once was one of the most abundant hoofed mammals in the Indian Subcontinent, so much so that as late as early 1900s, naturalist Richard Lydekker mentioned herds of hundreds in his writings. Today, only small herds are seen, largely inside reserves. The chief cause of their decline is excessive hunting.[7] Though the royal sport had ended, farmers of the expanding areas of cultivation saw it as crop-raider, further leading to its decline. Eventually, when in the 1970s, several areas reported their extinction, it was listed as a protected animal under the Wildlife Protection Act of 1972.[16] The blackbuck is hunted for its flesh and its skin. Although Indian law strictly prohibits the hunting of these endangered animals, occasional incidents of poaching still occur. The remaining populations are under threat from inbreeding. The natural habitat of the blackbuck is being encroached upon by man's need for arable land and grazing ground for domesticated cattle. Exposure to domesticated cattle also exposes them to bovine diseases.

It's protected status has gained publicity through a widely reported court case, in which one of India's leading film stars, Salman Khan, was sentenced to five years imprisonment for killing two blackbucks and several endangered chinkaras, in some protected area. The court case was prompted by intense protests from the Bishnoi ethnic group, which holds animals and trees sacred, and on whose land the hunting had taken place. Salman Khan was also in trouble for driving his Land Cruiser and crashing it into two men, during the early 2000s.

In another notorious incident of criminal poaching, Mansoor Ali Khan Pataudi also killed a blackbuck,[1] and then absconded as a fugitive. He finally surrendered only when the case was transferred from the criminal court to a special environment court, where he would face lighter sentencing.

Conservation[edit]

Male and female in Hyderabad, India

In India, hunting of blackbucks is prohibited under the Wildlife Protection Act of 1972.[1] Blackbucks can be seen in zoos.[17]

Blackbucks are protected in

They are also found in open areas near Dindori, Madhya Pradesh at Karopani Black Buck Conservation Area, which is located about 15 km from Dindori and also near Koppal in Koppal District about 15 km from its headquarters. In Balaghat lane, Kolar Gold Field black bucks are found in unprotected area.

Black bucks in balaghat lane KGF

In culture[edit]

Painting of Akbar hunting blackbucks with trained Asiatic cheetahs in Akbarnama

The blackbuck is known by various names such as pulvaai, thirugumaan, velimaan, kadamaan, iralai, karinchikedai and murugumaan in Tamil. It is also known as Krishna Mruga in Kannada and as Krishna Jinka in Telugu, it has been declared as the state animal of Andhra Pradesh. Other local names for the species include Krishnasar in Bengali, Kala Hiran, Sasin, Iralai Maan, and Kalveet in Marathi.[19] It is often simply called Indian antelope, though this term might also be used for other Antilopinae from the region.

The skin of Krishna Mrugam plays an important role in Hinduism, and Brahmin boys are traditionally required to wear a strip of unleathered hide after performing Upanayanam. According to the Hindu mythology blackbuck or Krishna Jinka is considered as the vehicle (vahana) of the Moon-god Chandrama. According to the Garuda Purana of Hindu mythology, Krishna Jinka bestows prosperity in the areas where they live.

References[edit]

  1. ^ a b c Mallon, D. P. (2008). "Antilope cervicapra". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  2. ^ a b c Blanford, W.T. (1888–1891). The fauna of British India, including Ceylon and Burma. Mammalia. Taylor and Francis, London.
  3. ^ a b c d Nowak, R. M. (1999). Blackbuck. Pages 1193–1194 in: Walker's Mammals of the World. Volume 1. The Johns Hopkins University Press, Baltimore, USA and London, UK.
  4. ^ Palmer, T. S.; Merriam, C. H. (1904). Antilope in: Index generum mammalium : a list of the genera and families of mammals. Government Printing Office, Washington.
  5. ^ Palmer, T. S.; Merriam, C. H. (1904). Capra in: Index generum mammalium : a list of the genera and families of mammals. Government Printing Office, Washington.
  6. ^ a b Ranjitsinh, M. K. (1989). The Indian Blackbuck. Natraj Publishers, Dehradun.
  7. ^ a b Burton, M.; R. Burton (2002). International Wildlife Encyclopedia (Volume 9). Marshall Cavendish. p. 226. ISBN 0-7614-7266-5. 
  8. ^ a b c d Mallon, D. P., Kingswood, S. C. (compilers) (2001). Antelopes: Global Survey and Regional Action Plans, Volume 4. IUCN. p. 184. ISBN 2-8317-0594-0. 
  9. ^ a b Jhala, Y. V. (1997). Seasonal effects on the nutritional ecology of blackbuck Antelope cervicapra. Journal of Applied Ecology 34: 1348–1358.
  10. ^ Singh, H. S., Gibson, L. (2011). "A conservation success story in the otherwise dire megafauna extinction crisis: The Asiatic lion (Panthera leo persica) of Gir forest". Biological Conservation 144 (5): 1753–1757. doi:10.1016/j.biocon.2011.02.009. 
  11. ^ Isvaran, K. (2007). Intraspecific variation in group size in the blackbuck antelope: the roles of habitat structure and forage at different spatial scales. Oecologia 154(2): 435–444.
  12. ^ Bagchi, S., Goyal, S. P., Sankar, K. (2003). Habitat separation among ungulates in dry tropical forests of Ranthambhore National Park, Rajasthan. Tropical Ecology 44(2): 175–182.
  13. ^ Bhatta, S. R. (2008). People and Blackbuck: Current Management Challenges and Opportunities. The Initiation 2(1): 17–21.
  14. ^ Grubb, P. (2005). "Order Artiodactyla". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 678. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  15. ^ Gee, E. P. (1969). The wildlife of India. Collins, London.
  16. ^ Luna, R.K. (May 25, 2002). "Black bucks of Abohar". The Tribune. 
  17. ^ Walther, F. R.; Mungall, E. C.; Grau, G. A. (1983). Gazelles and their relatives: a study in territorial behavior. William Andrew. p. 74. ISBN 0-8155-0928-6. 
  18. ^ Steps Taken to Save Blackbucks the Hindu, Chinnai, 2011-1-6
  19. ^ "After Black bucks, leopards to be bred in captivity". Business Line. Nov 18, 2008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!