Overview

Distribution

Range Description

The Blackbuck formerly occurred across almost the whole of the Indian subcontinent. Their range decreased sharply during the 20th century and they are now extinct in Bangladesh, Nepal and Pakistan. Attempted reintroductions have taken place in Pakistan and Nepal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The blackbuck is found in Pakistan and India.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Pakistan (extirpated but reintroduced) and India, from Punjab south to Madras and east to Bihar (formerly up to Assam); extirpated in Bangladesh and now localized in India; native range now much reduced; introduced in Nepal, Argentina, and Texas (Grubb, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult bucks stand approximately 73.7 - 83.8cm at the shoulder and on average have a head and body length of 120cm. The blackbuck is one of the few antelope whose color differs between sexes. The males are rich dark brown above, on the sides, and on the outside of the legs. Females tend to be yellowish in the same areas. Both sexes exhibit white underparts and insides of the legs, and a prominent white circular patch around the eye. Also, males gradually become darker with age. Blackbucks have a graceful and slender built. The horns are borne only by males and range from 50 - 61 cm; they are ringed at the base and twist spirally up to approxiamtely 4 turns. The narrow muzzle is sheeplike, the tail is short, and the hooves are delicate and sharply pointed.

Range mass: 32 to 43 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species inhabits grassland and lightly-wooded country. They require water daily, which restricts distribution to areas where surface water is available for the greater part of the year. Blackbuck are primarily grazers. And mainly sedentary, but in summer may move long distances in search of water and forage (Rahmani 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Blackbuck live on open woodlands and semi-desert areas, but also enjoy areas with thorn or dry deciduous forest. They like to stay near areas where grassland is available. On hot days blackbucks rest in the shade.

Terrestrial Biomes: savanna or grassland

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: Habitat in Texas include areas with a patchwork of grassland and brush (Schmidly 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Blackbuck are grazers, they feed on short grass and various cultivated cereals. Concerning their drinking habits, T.J. Roberts writes, " It has been reliably established that they do not drink water even when it is available . . . It may be, that they can recirculate the nitrogen in their bodies rather than having to excrete it in their urine."

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Antilope cervicapra (antelopes, gazelle, backbuck, nilgai) is prey of:
Canis lupus
Canis lupus familiaris

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Antilope cervicapra (antelopes, gazelle, backbuck, nilgai) preys on:
Eleucine
Cyperus
Cenchrus
Zizyphus
Crotalaria
Prosopis cineraria

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: wild:
18.0 years.

Average lifespan

Status: wild:
15.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.9 years (captivity) Observations: In captivity, these animals can live up to 23.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating occurs throughout the year, with the most rutting activity in March - April and August - October. During the rut, the mature male establishes a territory by regularly depositing faeces in particular places. Males are extremely aggressive during this time and drive all other males from their territory by a throaty grunt and an ocassional horn fight. The gestation period is about six months, and most of the time a single young is born. The young is able to run about soon after birth.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 5 to 6 months.

Range weaning age: 1.87 to 2.1 months.

Average weaning age: 1.985 months.

Average birth mass: 3850 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
466 days.

Parental Investment: precocial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproductively active nearly year-round in Texas (Howery et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antilope cervicapra

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2414-09|AP003422|Antilope cervicapra| AACCGCTGATTGTTCTCAACTAACCATAAAGACATTGGTACCTTATATCTCATATTTGGTGCCTGAGCTGGCATAGTAGGAACTGCCCTA---AGTCTACTAATTCACGCTGAACTAGGTCAACCCGGAACCTTGCTTGGGGAC---AACCACATCTATAATGTAGTTGTAACCGCACATGCATTTGTAGTAATTTTCTTTATAGTAATGCCCATTATAATTGGAGGATTTGGCAACTGACTAGTCCCTCTAATA---ATTGGTGCTCCCTATATAGCATTTCCCCGAATAAACAATATAAGTTTTTGACTCCTCCCTCCCTCTTTCCTATTACTTCTAGCATCTTCTATAGTCGAAGCAGGAGCAGGAACAGGCTGAACTGTATATCCCCCTCTAGCAAGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTG---ACTATTTTTTCTTTACACCTGGCAGGTGTCTCCTCAATTTTAGGTGCCATTAACTTTATTACAACAATTATTAATATAAAACCTCCCGCAATATCGCAATATCAAACCCCTCTATTTGTGTGATCTGTCTTAATTACCGCCGTACTTCTACTCCTTTCACTTCCTGTACTAGCTGCT---GGCATTACAATACTTCTAACAGACCGAAACCTAAATACAACCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATCCTATATCAACACCTATTCTGATTCTTTGGACACCCTGAAGTATATATTCTCATCCTACCCGGATTTGGAATAATTTCCCACATTGTTACCTACTACTCAGGGAAGAAA---GAACCATTTGGGTACATGGGAATAGTATGAGCTATGATATCCATCGGGTTTTTAGGATTCATTGTATGAGCCCACCATATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Antilope cervicapra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Rahmani, A.R. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
Range and numbers have declined sharply during the last 100 years. More recently, numbers increased from 24,000 in the late 1970s to an estimated 50,000, and the population was described as reasonably secure and increasing in many protected areas and a crop pest in some places (Rahmani 2001). However, Blackbuck habitat is subject to heavy pressure from human population growth, increasing numbers of domestic livestock, and economic development. The area available is declining and the species is estimated to be close to meeting the 30% decline figure over ten years that would qualify for Vulnerable under criterion A3c.

History
  • 2003
    Near Threatened
    (IUCN 2003)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The blackbuck was once the most abundant hoofed mammal in India and Pakistan, but their populations have been greatly reducedthrough excessive hunting and loss of habitat due to agricultural development.

US Federal List: no special status

CITES: appendix iii

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Native to Pakistan (extirpated but reintroduced) and India, from Punjab south to Madras and east to Bihar (formerly up to Assam); extirpated in Bangladesh and now localized in India; native range now much reduced; introduced in Nepal, Argentina, and Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population has increased from an estimated 22,000-24,000 in the 1970s to an estimated 50,000. The largest numbers are found in the states of Rajasthan, Punjab, Madhya Pradesh, Maharashtra, and Gujurat (Rahmani 2001). Introduced populations in Argentina and the USA may number 8,600 and 35,000, respectively (Mallon and Kingswood 2001).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Although Blackbuck have disappeared from many areas due to habitat destruction through conversion to agricultural use, they are increasing in many protected areas and areas dominated by Vishnoi communities in Rajasthan and Haryana (Rahmani 2001). In some areas, the population has increased so much that the Blackbuck has become a pest in agricultural crops. Some Blackbuck are shot illegally, especially in areas where it shares the same habitat with Nilgai.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Fully protected by law in India. Occurs in many protected areas, including Velavadar Blackbuck Sanctuary and Point Calimere Wildlife Sanctuary.

Listed in CITES Appendix III (Nepal).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Blackbucks have a tendency to raid crops, paticularly sorghum and millet. As a result, farmers lose crops and money. Many farmers set up traps and hunt the blackbuck to stop them from destroying crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The blackbuck is prized for its meat.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blackbuck

The blackbuck (Antilope cervicapra) is an antelope species native to the Indian subcontinent that has been classified as endangered by IUCN since 2003, as the blackbuck range has decreased sharply during the 20th century.[1]

The blackbuck is the only living species of the genus Antilope.[2] Its generic name 'Antilope' stems from the Latin word antalopus, a horned animal.[3] The binomial 'cervicapra' is composed of the Latin words capra, she-goat and cervus, deer.[4]

Contents

Characteristics

Male and female blackbuck

Males and females have distinctive coloration. Male blackbucks are dark brown, black, and white and have long twisted horns, while females are fawn coloured with no horns. Blackbucks closely resemble Kobs.[5] Body Length: 100–150 cm (3.3–4.9 ft)
Shoulder Height: 60–85 cm (2.0–2.79 ft)
Tail Length: 10–17 cm (3.9–6.7 in)
Weight: 25–35 kg (55–77 lb)[6]

The horns of the blackbuck are ringed with 1 to 4 spiral turns, rarely more than 4 turns, and can be as long as 79 cm (31 in). A trophy blackbuck is greater than 46 cm (18 in). In the male, the upper body is black (dark brown), and the belly and eye rings are white. The light-brown female is usually hornless.[5]

Albinism in blackbuck is rare and caused by the lack of the pigment melanin. The animal looks fully white due to the lack of melanin in their skin. Wildlife experts say that the biggest problem with these Albinos is that they are singled out by predators and hunted.

Distribution and habitat

Antelope Jumping in Hyderabad

Blackbucks originally ranged over large tracts of India except in north-eastern India. Today the blackbuck population is confined to areas in Maharashtra, Orissa, Punjab, Rajasthan, Haryana, Gujarat, Andhra Pradesh, Tamil Nadu and Karnataka with a few small pockets in Central India.[7][8]

In Nepal, the last surviving population of blackbuck is found in the Blackbuck Conservation Area south of the Bardia National Park. In 2008, the population was estimated to comprise 184 individuals.[9]

There are four subspecies or geographic races

  • Antilope cervicapra cervicapra
  • Antilope cervicapra rajputanae
  • Antilope cervicapra centralis
  • Antilope cervicapra rupicapra

Ecology and behaviour

Blackbuck fleeing at Point Calimere Wildlife Sanctuary, Tamil Nadu, India

Blackbucks generally live on open plains in herds of 15 to 20 animals with one dominant male.

Blackbucks are very fast. Speeds of more than 80 km/h (50 mph) have been recorded.[2]

Its chief predator was the now extinct Indian cheetah. It is now sometimes preyed upon by wolves and feral dogs.[citation needed]

The diet of the blackbuck consists mostly of grasses, although it will eat pods, flowers and fruits to supplement its diet. The maximum life span recorded is 16 years and the average is 12 years.[citation needed]

Threats

Royalty hunting blackbuck with Asiatic Cheetah in South Gujarat, 1812
Akbar Hunting Black Buck-Akbarnama

The main threats to the species are poaching, predation, habitat destruction, overgrazing, diseases, inbreeding and sanctuary visitors.

Large herds once roamed freely on the plains of North India, where they thrived best. During the 18th, 19teenth and the first half of the 20th centuries, blackbuck was the most hunted wild animal all over India. Until India's independence, many princely states used to hunt this antelope and Indian gazelle, the Chinkara with specially trained pet Asiatic Cheetah. It used to be one of the most abundant hoofed mammal in the Indian subcontinent, so much so that as late as early 1900s, naturalist Richard Lydekker mentions herds of hundreds in his writings, though today only small herds are seen that too inside reserves, chief reason of their decline being excessive hunting.[5] Till Indian independence in 1947, many princely states used to hunt the Indian Antelope and gazelle with cheetahs, which became extinct in 1960s. Though the royal sport had ended, growing cultivation saw it as crop-raider, further leading to its decline. Eventually, when in the 1970s several areas reported their extinction, it was enlisted as a protected animal under the Wildlife Protection Act of 1972.[10] The blackbuck is hunted for its flesh and its skin. Although Indian law strictly prohibits the hunting of these endangered animals, there are still occasional incidents of poaching. The remaining populations are under threat from inbreeding. The natural habitat of the Blackbuck is being encroached upon by man's need for arable land and grazing ground for domesticated cattle. Exposure to domesticated cattle also renders the Blackbuck exposed to bovine diseases.

Its protected status has gained publicity through a widely reported court case, in which one of India's leading film stars, Salman Khan, was sentenced to five years imprisonment for killing two blackbucks and several endangered chinkaras. The arrest was prompted by intense protests from the Bishnoi ethnic group, which holds animals and trees sacred, and on whose land the hunting had taken place.

In another notorious incident of criminal poaching, Mansoor Ali Khan Pataudi also killed a blackbuck -[1], and then absconded as a fugitive. He finally surrendered only when the case was transferred from the criminal court to a Special Environment court, where he would face lighter sentencing.The Founder Chairman PFA Haryana Naresh Kadyan, whistle blower in this case also booked by Jhajjar Police for no reasons but he moved public interest litigation before High Court, Chandigarh and get transferred this case from Jhajjar to Faridabad.

Conservation

Male and female in Tamil Nadu, India.

Like most wild animals, the blackbuck is in principle protected in India by the Wildlife Protection Act of 1972. The blackbuck population is stable with 50,000 native individuals, plus an additional 43,000 descended from individuals introduced to Texas and Argentina. The species can be seen in zoos.

Blackbucks are protected in several protected areas of India and in Pakistan including:

They are also found in an open area near Dindori, Madhya Pradesh at Karopani Black Buck Conservation Area, which is located approximately 15 km from Dindori.

In culture

The blackbuck is the provincial animal of India and known as Krishna Mriga in Kannada. Also known as Krishna Jinka in Telugu, it has been declared as the state animal of Andhra Pradesh. Other local names for the species include Krishnasar in Bengali, Kala Hiran, Sasin, Iralai Maan, and Kalveet in Marathi.[12] It is often simply called Indian antelope though this term might also be used for other Antilopinae from the region.

The skin of Krishna Mrigam plays an important role in Hinduism, and Brahmin boys are traditionally required to wear a strip of unleathered hide after performing Upanayanam.

According to the Hindu mythology Blackbuck or Krishna Jinka is considered as the vehicle (vahana) of the Moon-god Chandrama.

According to the Garuda Purana of Hindu Mythology, Krishna Jinka bestows prosperity in the areas where they live.

A blackbuck is featured in the 2010 film Prince of Persia.

References

  1. ^ a b Mallon, D.P. (2008). "Antilope cervicapra". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/1681. 
  2. ^ a b Nowak, R. M. (1999). Blackbuck. Pages 1193–1194 in: Walker's Mammals of the World. Volume 1. The Johns Hopkins University Press, Baltimore, USA and London, UK.
  3. ^ Palmer, T. S.; Merriam, C. H. (1904). Antilope in: Index generum mammalium : a list of the genera and families of mammals. Government Printing Office, Washington.
  4. ^ Palmer, T. S.; Merriam, C. H. (1904). Capra in: Index generum mammalium : a list of the genera and families of mammals. Government Printing Office, Washington.
  5. ^ a b c Burton, Maurice; Robert Burton (2002). International Wildlife Encyclopedia (Volume 9). Marshall Cavendish. p. 226. ISBN 0-7614-7266-5. http://books.google.co.in/books?id=cb7N0CV0JbAC&pg=PA226&dq=Blackbuck&cd=1#v=onepage&q=Blackbuck&f=false. 
  6. ^ Antilope cervicapra
  7. ^ East, R.; Mallon, D. P., Kingswood, S. C. (2001). Antelopes: Global Survey and Regional Action Plans, Volume 4. IUCN. p. 184. ISBN 2-8317-0594-0. http://books.google.com/books?id=uFo03Nd2oj8C&pg=PA184&cd=8#v=onepage&f=false. 
  8. ^ Walther, F. R.; Mungall, E. C., Grau, G. A. (1983). Gazelles and their relatives: a study in territorial behavior. William Andrew. p. 74. ISBN 0-8155-0928-6. http://books.google.co.in/books?id=lhjWEX-_GkUC&pg=PA74&cd=10#v=onepage&f=false. 
  9. ^ Bhatta, S. R. (2008). People and Blackbuck: Current Management Challenges and Opportunities. The Initiation 2(1): 17–21.
  10. ^ Luna, R.K. (May 25, 2002). "Black bucks of Abohar". The Tribune. http://www.tribuneindia.com/2002/20020525/windows/main3.htm. 
  11. ^ Steps Taken to Save Blackbucks the Hindu, Chinnai, 2011-1-6
  12. ^ "After Black bucks, leopards to be bred in captivity". Business Line. Nov 18, 2008. http://www.thehindubusinessline.com/2008/11/18/stories/2008111850142200.htm. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!