Overview

Brief Summary

The Nilgai (Boselaphus tragocamelus) is one of only two species in the tribe Boselaphini, one of the three tribes in the subfamily Bovinae (the other species in this tribe is the much smaller Chowsingha, Tetracerus quadricornis). Nilgai are native to northeastern Pakistan, lowland areas of southern Nepal, and peninsular India. They have been successfully introduced to Italy near Rome (but were extirpated there during World War II), South Africa, the southern United States (Texas), and northern Mexico.

In their native range in India and Nepal, Nilgai prefer level to rolling terrain with scattered short trees and brush interspersed with open grasslands. They are rarely found in dense forest. Although Nilgai are mainly crepuscular, they can be active throughout the day and night (they sometimes raid agricultural fields at night). In both their native range and in Texas the distribution of Nilgai is limited by the availability of drinking water.

Females are typically sexually mature at two years. Twins are common (accounting for around 50% of births in southern Texas, with occasional triplets). Males may be sexually mature at three years, but males of 4 to 5 years are the most active breeders. During the breeding season, males may fight and serious injuries are not uncommon.

Only male Nilgai have horns. These are typically short, black, smooth, and nearly straight. Both sexes have tails that are white below and white patches on the throat, cheeks, and lips, as well as a white ring above and a white ring below the fetlock.

Globally, Nilgai populations are secure. There are around 100,000 Nilgai in India and a handful in Pakistan; they have been extirpated from Bangladesh. The introduced population in southern Texas includes around 37,000 individuals.

  • Leslie, D.M., Jr. 2011. Nilgai (Boselaphus tragocamelus). Pp. 591-592 in: Wilson, D.E. and Mittermeier, R.A., eds. Handbook of the Mammals of the World. Volume 2. Hoofed Mammals. Lynx Edicions, Barcelona.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Miscellaneous Details

"It requires a good horse to catch the bull, which has, however, been not unfrequently run down and speared, but he must be pressed at list. The cow, Kinloch says, cannot be run down by a single rider, and I never heard of one being speared. Few sportsmen care about shooting nilgai, and in some places they become very tame, as they are generally protected by Hindus, who regard them as a kind of cow. Nilgai are easily tamed, but the males are sometimes savage in confinement. Tame individuals have been taught to draw light carriages, and Sterndale relates that he trained one to carry a load and to be ridden. They have bred in confinement in Europe. The flesh of the nilgai is fairly good, though inferior to that of most Indian wild Bovidae. (Blanford 1888)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

"The Nilgai, is the largest Asian antelope and is also one of the most commonly seen wild animal of northern and central India. They are diurnal animals, generally avoiding dense forests and preferring woodlands and grasslands instead. Outside the breeding season, they usually form single sex herds"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Boselaphus tragocamelus, also called the nilgai antelope, evolved in penninsular India during the Tertiary geological period, where they are also currently found. They were imported to the United States as zoo animals before the mid-1920s and released into Texas about 1930. Today they are found on large ranches in Kenedy and Willacy counties of Texas.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Widely distributed in India and in the lowland zone of Nepal, extending into border areas of Pakistan where it is rare. Now extinct in Bangladesh.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Eastern Pakistan and northern India south to Bombay and Mysore. Introduced and established in southern Texas (free-ranging populations on several large ranches) (Schmidly 2004)..

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Nilgai antelope are among the largest of the asian antelopes. They stand about 120-150cm at the shoulder and have a body length of 180-200cm. They have a short coat which is yellow-brown in females and turns blue-grey in adult males. Calves are pale brown. The hair of the adult nilgai antelope is thin and oily, but the skin is thick on the chest and neck of the males. There are patches of white on the face and below the chin. This extends into a broad, white "bib" on the throat. In males below the "bib" hangs a tuft of hair, or "beard" that can be as long as 13cm.

A white band along the brisket area goes over the abdomen and spreads between the hind legs, which forms a narrow rump patch that is outlined with darker hair. They have slender legs which support their stocky bodies. The head is long and slender and males have horns about 20-25cm, which are black in color, sharp, and curved.

Range mass: 120 to 240 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"General form somewhat equine ; neck deep and compressed. Tail reaching hocks. Colour on adult male dark grey, varying from bluish to brownish grey throughout, except the mane, throat tuft, terminal half of the ear outside and two spots inside, and the tip of the tail, which are black, and a patch on the throat, two spots on each cheek, the lips, chin, inside of the ears, except the two black spots, the lower surface of the tail, the abdomen, and a ring above and another below each fetlock, which are white. Females and young males brown. Horns black."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

"Male usually 52 to 56 inches (13 to 14 hands) high at the shoulder, but 58 inches is said by McMaster to have been measured ; length from nose to rump 6 to 7 feet, tail 18 to 21 inches, ear 7. Basal length of a male skull 15.3; orbital breadth 5.85. Females considerably smaller. Horns are usually 8 to 9 inches long and 8 in girth at the base, maximum recorded measure-ments 11.75 and 9.5."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Nilgai antelopes live in dry areas with a variety of land types. They range from grassy, steppe woodlands, to hillsides. In India, they occur in the foothills of the Himalayan Mountains southward to Mysore. The brush country of South Texas is well suited to their natural preferences.

Terrestrial Biomes: savanna or grassland ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Occur in arid areas, scrub, dry deciduous forests and agricultural areas, but avoid dense forest and deserts. They are both browsers and grazers (Rahmani 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Terrestrial

Comments: Habitat in Texas includes relatively dry areas of flat to rolling country with a moderate cover of thin forest or scrub (Schmidly 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Nilgai antelopes graze and browse, with grass as the main source of their diet. In Asia, they eat mainly woody plants. In Texas, they eat mesquite, oak, partridge peas, croton, nightshade, and a variety of grasses. Sometime they upgrade their diet by eating plant parts, such as flowers, seeds, fruits, leaves, and stem tops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Boselaphus tragocamelus (antelopes, gazelle, backbuck, nilgai) is prey of:
Canis lupus
Canis lupus familiaris

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Boselaphus tragocamelus (antelopes, gazelle, backbuck, nilgai) preys on:
Eleucine
Cyperus
Cenchrus
Zizyphus
Crotalaria
Prosopis cineraria

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

"Thin bush with scattered low trees or alternations of scrub and open grassy plains are the usual haunts of this animal; it is found either on level or undulating ground or on hills. It is rarely met with in thick forest, though it may often be found on cultivated plains, where it does much damage to crops. Males are often solitary, but they occasionally associate in herds. Females and young, sometimes accompanied by one or more old males, are found usually in small parties of from four to ten, though sometimes in herds of 15 to 20 or more. Nilgai feed a good deal throughout the day, and care but little for sun, though they lie down at times in shade. They both graze and browse, feeding on the leaves of ber (Zizyphus) and other trees, and, according to Sterndale, they devour quantities of the acrid fruits of aonla (Phyllanthus). In the cold season they only drink at intervals of two or three days. They keep much to the same ground, and their haunts may be recognized by their droppings, which they are in the habit of repeatedly depositing in the same spot, until considerable accumulations are formed. The pace of the nilgai when alarmed is a heavy gallop."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
21.0 years.

Average lifespan

Status: captivity:
21.7 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.7 years (captivity) Observations: Longevity in captivity is at least 21.7 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Females and males remain segregated for most of the year, except for when the bulls join the cows for breeding. Breeding groups consist of one dominant bull and one to many cows. Mating usually occurs from December to March, but breeding can occur through the year. The gestation period is 240-258 days and it is common for nilgai antelopes to bear twins. Females can conceive at 18 months of age, but very few mate before 3 years of age. Males are sexually mature by 2 1/2 years of age, but cannot compete very well with other males until 4 years of age.

Range number of offspring: 1 to 2.

Average number of offspring: 1.3.

Range gestation period: 8.27 to 8.6 months.

Average gestation period: 8.435 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 5875 g.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (female)

Sex: female:
815 days.

Parental Investment: altricial ; post-independence association with parents

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Texas: rutting season December-March; males begin to mature sexually in their 3rd year, but may not be active breeder until 4th year (Lochmiller and Sheffield 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"The period of gestation was found in the Regent's Park Zoological Gardens to be between 8 and 9 months (P. Z. S. 1863, p. 230). One or very often two young are produced."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boselaphus tragocamelus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATTAATCGCTGATTATTCTCAACCAACCATAAAGATATTGGCACCCTGTATCTACTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCTTAAGTCTGCTAATTCGTGCTGAATTAGGTCAACCTGGAACCCTACTTGGAGATGACCAAATTTACAACGTCGTCGTAACTGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGGTTTGGTAACTGACTTGTCCCTTTAATAATTGGCGCCCCCGATATAGCATTTCCTCGAATAAATAATATAAGCTTCTGACTCCTCCCACCTTCCTTTTTACTGCTTCTAGCATCATCTATAGTCGAAGCCGGAGCGGGAACAGGTTGAACTGTGTATCCTCCCCTAGCAGGTAATCTAGCCCATGCAGGAGCCTCAGTAGACTTAACTATTTTTTCTCTCCATCTAGCAGGTGTCTCCTCAATTTTAGGGGCCATCAATTTCATTACAACAATTATCAACATAAAACCCCCTGCAATATCACAATACCAAACACCCTTATTCGTGTGATCTGTAATGATTACTGCCGTCCTACTACTCCTTTCACTCCCCGTACTAGCAGCCGGTATTACAATACTACTAACAGATCGAAATCTAAATACAACTTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTATATCAACACTTGTTCTGATTCTTCGGACACCCTGAAGTCTATATTCTTATTTTACCTGGATTCGGAATAATTTCCCACATCGTAACCTATTACTCAGGAAAAAAAGAACCATTCGGGTACATAGGAATAGTCTGAGCTATAATATCAATCGGATTCTTAGGGTTTATCGTATGAGCCCACCACATATTTACAGTCGGAATAGACGTCGACACACGAGCCTATTTTACATCAGCCACTATGATTATTGCTATTCCAACTGGAGTAAAAGTATTTAGTTGATTAGCAACACTCCACGGAGGCAATATTAAATGATCCCCTGCTATAATATGAGCTCTAGGCTTCATCTTCCTATTTACAGTAGGAGGCTTGACCGGGATTGTCTTAGCCAACTCTTCTCTTGACATCGTCCTTCACGACACATATTACGTTGTTGCACACTTTCACTACGTACTATCAATAGGGGCAGTATTTGCCATTATAGGGGGATTCGTACACTGATTCCCACTATTTTCAGGCTACACCCTTAACGAAACATGAGCCAAAATTCATTTTGCAATTATATTTGTAGGCGTTAATATAACTTTCTTCCCACAACACTTCCTAGGACTATCTGGCATACCACGACGATACTCTGACTACCCAGATGCGTACACAATATGAAACACCATTTCATCAATAGGCTCATTCATCTCTCTAACAGCAGTCATACTAATAGTATTTATTATCTGAGAAGCATTCGCATCCAAACGAGAAGTACTAACTGTAGATTTAACCACAACAAACCTAGAATGGTTAAACGGATGTCCCCCACCATACCACACATTCGAAGAACCTACATATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Boselaphus tragocamelus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Hunting by humans threatens nilgai antelopes.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Mallon, D.P.

Reviewer/s
Rahmani, A.R. & Mallon, D.P. (Antelope Red List Authority)

Contributor/s

Justification
Numbers in India are estimated to exceed 100,000 and their distribution covers a large part of the subcontinent. No decline has been reported and the species adapts well to agricultural areas.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red List Category & Criteria: Least Concern ver 3.1 Year Published: 2008
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Rahmani (2001) estimated that the Indian population could exceed 100,000. Locally common to abundant in agricultural areas in the states of Haryana, Uttar Pradesh, Rajasthan and Gujarat. No figures are available for Nepal. Numbers are very low in Pakistan. About 37,000 feral nilgai are established on Texas ranches.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Considered an agricultural pest in parts of India and, although legally protected in India, legislation has been amended to permit hunting when crop damage becomes excessive. Hunting and habitat destruction have had an adverse effect in Pakistan and Bangladesh (Rahmani 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Occur in numerous National Parks and other Protected Areas in India (particularly Gir N.P., Ranthambore N.P., Sariska N.P. and Kumbhalgarh Sanctuary), although most of the population occurs outside of protected areas (Rahmani 2001). Considered sacred by Hindus because of resemblance to the cow so rarely persecuted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Nilgai antelope may damage human food crops in the areas in which they are found.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The nilgai antelope is hunted for its meat. Overhunting may negatively impact populations of nilgai antelope.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Appears to coexist nicely with native ungulates in Texas (Schmidly 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Nilgai

"Blue bull" redirects here. For the South African rugby union team, see Blue Bulls.

The nilgai (Boselaphus tragocamelus), sometimes called nilgau, is the largest Asian antelope. It is one of the most commonly seen wild animals of central and northern India, often seen in farmland or scrub forest. The mature male appears ox-like and is also known as the blue bull. A blue bull is called a nil gai or nilgai in India, from nil meaning blue and gai meaning a bovine animal (literally 'cow'). It is also present in parts of southern Nepal and eastern Pakistan. The species has become extinct in Bangladesh. It was known as the nilghor (nil = blue, ghor = horse) during the rule of Aurangzeb in the Mughal era.[2] It is the only member of genus Boselaphus.[3][4]

Description[edit]

Nilgaihead.jpg

Nilgai stand 1.1 to 1.5 m (3 ft 7 in to 4 ft 11 in) at the shoulder and measure 1.7 to 2.1 m (5 ft 7 in to 6 ft 11 in) in head-body length, with a 45- to 50-cm (18- to 20-in) tail. Males are larger than females, weighing 109 to 288 kg (240 to 635 lb), with a maximum of 308 kg (679 lb), compared with the adult female weight of around 100 to 213 kg (220 to 470 lb).[3]

The nilgai has thin legs and a robust body that slopes down from the shoulder. They show marked sexual dimorphism, with only the males having horns. Adult males have a grey to bluish-grey coat, with white spots on the cheeks and white colouring on the edges of the lips. They also have a white throat bib and a narrow white stripe along the underside of the body that widens at the rear. The tips of the long, tufted tail and of the ears are black. They also possess a tubular-shaped "pennant" of long, coarse hair on the midsection of the throat.[3]

The males have two black, conical horns, arising close together just behind the eyes. The horns project upwards, but are slightly curved forward; they measure between 15 and 24 centimetres (5.9 and 9.4 in) in a fully grown adult. Although the horns are usually smooth, in some older males, they may develop ring-shaped ridges near the base.[3]

In contrast, females and young are tawny brown in colour, although otherwise with similar markings to the male; they have no horns and only a very small "pennant". Both sexes have an erect mane on the back of the neck, terminating in a bristly "hog-tuft" just above the shoulders.[3]

Distribution[edit]

Nilgai pursued by dholes, as drawn by Robert Armitage Sterndale in Denizens of the Jungles, 1886

Nilgai antelope are found throughout most of India, from the base of the Himalayas in the north, down to the state of Karnataka in the south, being absent only in eastern Bengal, Assam, the Malabar Coast, and regions close to the Bay of Bengal.[1] They inhabit the Gir forest and across Rajasthan in the west to the states of Assam and West Bengal in the east.[citation needed] In Nepal, they occur patchily in the southern lowlands. Historic notes mention the nilgai in southern parts of India, but these may be a feral population:

I believe that the Coimbatore and Salem collectorates are almost the only places in Southern India, in which nil-gai are to be found. It is difficult to account for the animals being thus so widely divided from their usual haunts unless as has been generally supposed, these Southern specimens are the progeny of a semi-domesticated herd, which, at some by-gone period, had escaped from the preserve of a native potentate.

—A. C. McMaster (1871)[5]

The population density of nilgai in central India is 0.07 per square kilometre (0.18/sq mi).[citation needed] Nilgai have existed north of Bangalore and probably still do.[citation needed] Nilgai were introduced in the US state of Texas in the 1920s by the King Ranch for recreational purposes. Over the years, some escaped and they are now free-ranging in various southern portions of the state.

Nilgai can survive for days without water, but they live close to waterholes. The deserts earlier limited their range, but the extension of irrigation canals and proliferation of tube-wells in the Thar desert have helped them colonise the desert districts of Jodhpur, Barmer, Jaisalmer, Bikaner and Ganganagar.[citation needed]

Habitat and diet[edit]

Nilgai eating leaves, Mughal, Jahangir period (1605–27), circa 1620

Nilgai are habitat generalists, living in grasslands and woodlands where they eat grasses, leaves, buds, and fruit. They avoid dense forest and prefer the plains and low hills with shrubs, but may also be found in cultivated areas.[3]

Nilgai are usually found in their favoured areas of scrub jungle (acacia forests) grazing upon succulent kader grass. They are not averse to crossing marshlands.[citation needed]

Behavior[edit]

Nilgai are diurnal, and tend to form single-sex herds outside of the breeding season. Herds are not of fixed composition, with individuals joining and rejoining through the year. Female herds typically contain three to six adults, together with their calves, whereas bulls form herds of two to 18 individuals.[3] In winter, male nilgai form herds of 30 to 100 animals in northern India.[citation needed]

Nilgai herds in Texas have been reported to have an average home range of 4.3 square kilometres (1.7 sq mi). Both males and females mark their territories by defecating in fixed locations on open ground, with piles building up to reach at least 3 m (9.8 ft) in diameter.[3] They also possess scent glands on the legs and close to the feet, which they may use to scent mark their daily resting places. They are generally quiet animals, but have been reported to make short guttural grunts when alarmed, and females to make clicking noises when nursing young.[6]

Interspecific relationships[edit]

Male Nilgai resting in grassy land at Velavadar Black Buck Sanctuary
A Rojh (Neelgai) in Ganganagar district Rajasthan

Nilgai can be seen with blackbuck in the open plains, and in the lower Terai regions, they may be seen with chital and hog deer. The chital and hog deer, being comparatively smaller in size, usually keep a respectful distance from the much larger nilgai. Sambar frequent hills and dense forests and are rarely found in the same habitat as nilgai.

Predators of nilgai include tigers and leopards, although the latter are only capable of capturing calves, and not fully grown adults. Packs of feral dogs will also attack Nilgai, especially calves. Scat analysis has shown lions, although present in some parts of the nilgai's range, generally do not prey on the animals, with nilgai comprising less than 3% of their diets.[3] Other predators include wolves[7] and striped hyenas.

Reproduction[edit]

Nilgai female and calves

Breeding occurs in late autumn to early winter. Prior to the rut, males compete to establish dominance. Males display to each other by holding their heads erect and presenting the white patch and tassel on their throats. They may also rush towards one another, holding their heads down so their horns project forwards. Such displays often escalate to direct conflict, including head-butting and neck-fighting. Although bulls have thick skin on their heads and necks, which helps protect them in such fights, serious injury can nonetheless occur. Females also compete to establish dominance around the time of the rut, including neck-fighting, and butting rivals on their shoulders or flanks.[3]

Males mate with several females over the course of the breeding season, but do not establish clear harems, instead wandering between different all-female groups. Courtship lasts about 45 minutes, with the male adopting a stiff gait with tail held erect, and the female responding with a flehmen gesture and raised tail before permitting mounting.[3]

Gestation lasts 243 to 247 days, resulting in the birth of twins in about 50% of cases, although births of one or three do occur. Females become solitary towards the end of their pregnancy, and hide their young from other nilgai for the first month of their lives. The calves are precocious, being able to stand within 40 minutes of birth, and they begin to forage during their fourth week of life.[6] Calves usually weigh 14 to 16 kg (31 to 35 lb) at birth.[citation needed]

Females reach sexual maturity at around two years of age, and males by their third year, although the most reproductively active bulls are typically at least four or five years old. They live for around 12 or 13 years in the wild, but have survived for up to 21 years in captivity.[3]

Status[edit]

Tamed nilgai, male, Lakeshwari, Gwalior district

The estimated population of nilgai in India is about 100,000. Wild populations also exist in the US states of Alabama, Florida, Mississippi and Texas and the Mexican state of Tamaulipas, where they have escaped from private exotic ranches. The population around the Texas-Mexico border is estimated to be around 30,000,[8][9] and the King Ranch, where nilgai were first released, now has around 10,000 of them.[10]

Like many Indian animals, nilgai are often victim to vehicular accidents, and their carcasses are often seen on major highways in northern India. The main threat to this species is the loss of habitat due to human population growth. However, nilgai are a crop menace, causing large-scale damages, especially along the Gangetic belt, especially in the Rohilkhand division of Uttar Pradesh. They have been declared as vermin in northern India, and they may be legally hunted after obtaining a permit. Nevertheless, the local belief that nilgai are cattle and hence sacred, has protected them against hunting.

Some Texas "exotic ranches" offer nilgai hunting. Nilgai meat is said to resemble beef, but with lower fat content and less flavour; one study showed tasting panels preferred wieners made from 30% nilgai meat mixed with beef to those with higher nilgai meat content.[11]

Distinctive white marks are clearly seen on the feet of this male nilgai

References[edit]

  1. ^ a b Mallon, D.P. (2008). Boselaphus tragocamelus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 29 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Gautam Masters dissertation unpubl : Dept. of Wildlife Sciences, Aligarh Muslim Univ.
  3. ^ a b c d e f g h i j k l D.M. Leslie (2008). "Boselaphus tragocamelus (Artiodactyla: Bovidae)". Mammalian Species: Number 813: pp. 1–16. doi:10.1644/813.1. 
  4. ^ [1]
  5. ^ McMaster, A. C. (1871) Notes on Jerdon's Mammals of India. Higginbothams, Madras. (pp. 123-124)
  6. ^ a b Goldman, J.E. & Stevens, V.J. (1980). "The birth and development of twin Nilgai Boselaphus tragocamelus at Washington Park Zoo, Portland". International Zoo Yearbook 20 (1): 234–240. doi:10.1111/j.1748-1090.1980.tb00982.x. 
  7. ^ Jethva, B.D. & Jhala, Y.V. (2004). "Foraging ecology, economics and conservation of Indian wolves in the Bhal region of Gujarat, western India". Biological Conservation 116 (3): 351–357. doi:10.1016/S0006-3207(03)00218-0. 
  8. ^ http://eol.org/pages/311908/details
  9. ^ "Nilgai Antelope in Northern Mexico", Journal of Wildlife Diseases, 2011 
  10. ^ King Ranch Nilgai Hunting 
  11. ^ Eggen, N. et al. (1973). "Utilization of nilgai antelope meat". Journal of Animal Science 37 (1): 260. 
  • Sheffield, William J., et al. The Nilgai Antelope in Texas (College Station: Texas Agricultural Experiment Station, Texas A&M University System, 1983).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!