Overview

Brief Summary

Biology

Asian buffalo graze in the morning and evening, and occasionally at night, on lush grass and leafy aquatic vegetation (2). During the hotter part of the day, they bathe and wallow in mud to keep cool and to protect them from biting insects (3). A gregarious but not territorial animal, this buffalo lives in stable clans of females and their young, led by a dominant matriarch (2). Young males leave this clan at the age of three, normally to join bachelor groups of around ten individuals (2). Mating is polygynous, with breeding being seasonally dependent in some areas, where it often occurs after the rainy season, for example during October and November in Thailand, and occurring year-round elsewhere. Females typically produce one calf every two years, with Asian buffalo having the longest gestation period of all bovids, lasting 300 to 340 days. Nursing lasts six to nine months and sexual maturity is reached at around one and a half years for females, three for males. Asian buffalo are known to have lived up to 12 years in the wild (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

At up to more than a tonne in weight, the Asian buffalo is a massive, powerful animal, with a wider horn span than any other bovid (2). These crescent-shaped, ribbed horns are heavy-set at the base, tapering to a narrow tip, and are larger in males than females, sometimes spanning over two metres (2) (3) (5). Large, splayed hooves are also advantageous for walking in the muddy, marshy ground on which this buffalo grazes (2) (6). The animal has a sparse covering of long, ashy-grey to black hair, with dirty-white 'stockings' up to the knees (3). The tail is relatively long and bushy at its tip (3), and a distinctive white 'V' marks the lower neck (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

During the Pleistocene epoch the genus Bubalus was widely distributed throughout Europe and southern Asia and contained forms conspecific with B. arnee. When the climate became drier the genus was restricted to the Indian subcontinent, mainland South-East Asia, and some of the South-East Asian islands. In historical times B. arnee ranged across South and South-East Asia, occurring from Mesopotamia to Indochina (Epstein 1971; Mason 1974; Cockrill 1984).

Remnant populations of Wild Water Buffalo are thought to occur at single sites in each of southern Nepal, southern Bhutan, western Thailand, eastern Cambodia, and northern Myanmar, and at several sites in India: in the Bastar region of Madhya Pradesh, in Assam, in Arunachal Pradesh, and possibly in Meghalaya, Orissa and Maharashtra.

Wild Water Buffalo is believed to be extinct in Bangladesh, Peninsular Malaysia, and on the islands of Sumatra, Java, and Borneo. The domestic form (considered by IUCN as B. bubalis) occurs as feral and domesticated populations worldwide (Grubb 2005).

The situation in Indochina is less certain. Lao PDR, Cambodia, and Viet Nam were not included within the range of Wild Water Buffalo given in Corbet and Hill (1992). Free-living buffalo of unknown pedigree occur throughout the region (e.g. Sayer 1983; Laurie et al. 1989; Salter et al. 1990; S. Hedges pers. comm. 2008) but Wild Water Buffalo is probably extinct in Viet Nam and almost certainly in Lao PDR (Groves 1996; Grubb 2005; Duckworth et al. 1999; Tordoff et al. 2005; R. J. Timmins pers. comm. 2008).

The origin and current genetic status of the herds of apparently wild buffaloes in Sri Lanka is uncertain but it is thought unlikely that any true wild buffaloes remain there today. Corbet and Hill (1992) included Sri Lanka within the historical range of wild buffalo, although Ellerman and Morrison-Scott (1951), Gee (1964), and Maia (1970) thought that the Sri Lankan buffaloes were descended from introduced domestic stock. Certain ancient texts seem to support this view (Ashby and Santiapillai 1983). The fact that no buffaloes occur south of the Godavari river in India has also been taken to suggest that Sri Lanka possesses only feral buffaloes descended from introduced animals. However, Deraniyagala (1953), considered that the occurrence of fossil buffalo teeth in the gem sands of the Ratnapura area disproved this view, although it is not clear how old these buffalo teeth are (and Gaur remains found at similar depths in the same area were less than 1,000 years old). Moreover, morphometrics suggest that there was an ancestral population of animals on that island closer to Wild Water Buffalo than to Domestic Water Buffalo (Groves and Jayantha Jayawardene unpublished). Nevertheless, even if the Water Buffalo is indigenous to Sri Lanka the question of whether the free-living herds found there today should be treated as wild B. arnee still arises. In the nineteenth-century, free-ranging herds were common over much of the island’s dry low country but they were nearly eliminated by an outbreak of rinderpest at the end of the century, and for a time their survival was in doubt (Phillips 1935). Phillips reported that small populations might have survived in the hill country but the subsequent intensification of agriculture probably led to their demise (Ashby and Santiapillai 1983). After the rinderpest outbreak buffalo recolonized much of the dry zone but most of them had apparently interbred with domestic stock and in 1953 Deraniyagala wrote ‘[the] relatively purest herds are restricted to Yala Game Sanctuary, but much vigilance will be necessary if this remnant is to be kept free from domestic animals which are now encroaching upon this once inaccessible area’. Woodford (1979) also suggested that the genetic integrity of the wild form has already been lost in Ruhuna. To conclude, even if it is assumed that Wild Water Buffalo once occurred on Sri Lanka it seems unlikely that they survived the rinderpest outbreak and the subsequent genetic swamping by feral and domestic buffalo: consequently all free-living buffalo populations on Sri Lanka almost certainly contain genetic input from domestic or feral stock.

Neither Java nor Sumatra are included within the original range of wild Bubalus arnee as presented in many accounts. Nevertheless Stremme (1911) thought that the occurrence of the fossil B. palaeokerabau in Java made it probable that the buffaloes there belonged to the original fauna of the island (as Cuvier believed). Merkens (1927) also doubted, on historical grounds, the domestic origin of all free-living buffaloes on the island as did Mason (1974) who stated that domestic buffalo were present on Sumatra and Java long before the Hindus arrived almost 2,000 years ago. Moreover Van der Maarel (1932) provisionally regarded the fossil specimens which he obtained from Java (and indeed B. palaeokerabau) as specifically indistinct from modern buffaloes, pointing to a Pleistocene presence of the species on the island (cf. Medway 1972). Corbet and Hill (1992) also thought it probable that wild buffaloes occur on Java and Sumatra. Despite the doubts raised by Van der Maarel and Dammerman there is in fact little doubt that all the apparently wild buffaloes now living on Java and Sumatra are descended from domestic animals, or from Wild Water Buffaloes that have interbred with domestic and/or feral buffaloes (S. Hedges pers. comm. 2008).

Opinion is divided over whether to include Borneo within the historic range of the species. Corbet and Hill (1992) did not list it, and neither Mason (1974) nor Payne et al. (1985) considered it likely that Water Buffalo was part of the indigenous fauna. Lydekker (1898), by contrast, described the small buffalo of Sarawak as a separate subspecies (B. b. hosei), although Mason (1974) thought that Lydekker was probably describing the feral animals which were common there. Cockrill (1968) suggested that traders from the Hindu empire in Sumatra may have introduced the buffalo in the twelfth and thirteenth centuries and he did not think that there was any convincing evidence that would suggest that it was an indigenous species. Nevertheless, animal remains from the Niah caves indicate a Stone Age presence of buffalo in Sarawak (Harrisson 1961). Van Strien (1986) also considered it probable that Bubalus bubalis was part of the original fauna of the island and gave north-west Borneo as its current distribution. Harrisson, however, thought that the wild form was extinct. Feral (and semi-feral) buffaloes were formerly numerous throughout Borneo but the current status of the island’s feral population is poorly known. What does seem certain, however, is that even if the species is indigenous to the island (as seems to be the case) no true wild B. arnee occur there today since they would have been genetically swamped by the numerous feral animals some of which were descended from buffaloes introduced from outside Borneo (S. Hedges pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Asian water buffalo, Bubalus bubalis, has been heavily domesticated and thus is now widespread. The suspected native domain of B. bubalis was from Central India to southern Nepal in the west to Vietnam and Malaysia in the east. It is believed that true wild populations still survive in parts of India, Nepal, Bhutan, and Thailand. Domesticated and or feral populations are very widespread. River buffalo (a domesticated variety) are found more in the west and reside in Indochina, the Mediterranean, and parts of South and Central America. Swamp buffalo (another variety under domestication) are more easterly in distribution and inhabit Indochina and Southeast Asia as well as Australia.

Biogeographic Regions: palearctic (Introduced ); oriental (Native ); neotropical (Introduced ); australian (Introduced )

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Ligda, D. 1999. "Introduction, Breeds, Genetics" (On-line). Water Buffalo. Accessed January 31, 2004 at http://ww2.netnitco.net/users/djligda/waterbuf.htm.
  • Macdonald, D. 2001. Wild Cattle and Spiral-Horned Antelope. Pp. 530-539 in G Bateman, T Allan, M Salad, eds. The New Encyclopedia of Mammals. New York: Oxford University Press.
  • Shackleton, D., A. Harestad. 2003. Bovids I - Kudus, buffaloes, and bison. Pp. 11-25 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Grzimek's Animal Life Encylopedia, Vol. 16, 2nd Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Native to Southeast Asia, the Asian buffalo has been heavily domesticated and is now widespread, reaching as far as North Africa and the Near East, as well as Australia, Brazil and Central America (3). However, true wild Asian buffalo are thought only to remain in parts of Bhutan, Nepal, India and Thailand, with the majority of individuals occurring in India (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bubalus bubalis is a large animal. Individuals stand 1.5 to 1.9 m in height at the shoulder, and have large feet with splayed hooves. The face is long and narrow, with rather small ears and large horns. The horns of this species have the widest spread found in any bovid. Unlike African buffalo, in which the bases of the horns almost meet at the forehead, the bases of the horns in Asian water buffalo are far apart. Both sexes bear horns, although those of the female are smaller than those of the male. Horns of both sexes are heavy set at the base, ribbed, and are triangular in cross-section.

Bubalus bubalis has a body length of 240 to 300 cm and a tail length of 60 to 100 cm. Wild male water buffalo weigh up to 1,200 kg, and females can weigh up to 800 kg. Domesticated water buffalo range from 250 to 550 kg.

Water buffalo have sparse hair that is long and ashy gray to black. Their relatively long tail is bushy at the tip. Their legs are often dirty white up to the knees. Adult buffalo are almost hairless and their skin color varies with weather conditions, though it is difficult to ascertain the skin color, as these animals are usually covered with mud. When not mud covered and dry, the skin is dark grey; however, when moist (and not mud covered), the skin is dark brown to black. Swamp buffalo (a variety of B. bubalis under domestication) are more ashy gray in color, has a drooping neck, and horns that are swept back and out, whereas river buffalo (the other domesticated variety) are more black and have tightly curled horns.

A closely related species found in the Philippines is Bubalus mindorensis, or tamaraw. It is smaller than B. bubalis, weighing 300 kg and standing 100 cm at the shoulder. Tamaraws have more hair than Asian water buffalo, are dark brown to black, and have shorter horns.

Range mass: 250 to 1200 kg.

Range length: 240 to 300 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

  • Lekagul, B., J. McNeely. 1988. Mammals of Thailand. Bangkok, Thailand: Darnsutha Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Wild buffaloes are tied to the availability of water: historically their preferred habitats were low-lying alluvial grasslands and their surrounds, with riparian forests and woodlands also used (Lydekker 1926; Prater 1971; Choudhury 1994). In Indochina the species frequented the lowlands dominated by deciduous forests and with a marked dry season, where it apparently used small pools and marshes, in addition to permanently flowing rivers (Wharton 1957). Free-ranging domestic animals continue to live like this today; in such areas buffalo retreat to the vicinities of larger more permanent waterbodies during the height of the dry season, but move widely through the forests at other times of the year (Timmins and Ou 2001; R.J. Timmins pers. comm. 2008).

Before their major population decline, wild buffaloes were known to make long-distance movements with season, such that when an undoubted wild buffalo turned up in Panna district, India, some 225 km northwest of its nearest known present-day occurrence in Raipur district, this was not an unprecedented movement (Hasan 1980; Arun Singh 1980).

The upper elevational limit is difficult to determine, although animals certainly occur down at sea level; it possibly relates to a need for level land rather than preference for lower elevations, thus allowing for plateaux, and wild-living feral buffaloes live up to at least 1,000 m asl in East Java (S. Hedges pers. comm. 2008).

Little has been published on the diet of wild (or feral) Water Buffaloes. They are probably grazers by preference, feeding mainly on grasses when available, but they also eat herbs, fruits, and bark as well as browsing trees and shrubs. Daniel and Grubh (1966) listed Cynodon dactylon, Themeda quadrivalvis, and Coix sp., as grasses known to be eaten by wild buffaloes in India. They also saw them feeding on the sedge Cyperus corymbosus. Dahmer (1978), Shrestha (1981), and Hiralal Prasad Kushwaha (1986) provided a little information about the diet in Nepal. Wild Buffalo also feeds on crops, including rice, sugar cane, and jute, sometimes causing considerable damage (Lekagul and McNeely 1977; Hiralal Prasad Kushwaha 1986; Bauer 1987b).

Wild Water Buffalo can be both diurnal and nocturnal. Typically, it forms maternal groups of loosely structured herds, typically containing 10–20, but up to 100, individuals, year round. Adult males form bachelor herds of up to 10 individuals, with older males often solitary. The species exhibits a polygynous mating system, with females typically giving birth to single offspring, although twins are possible. It is a seasonal breeder in most of its range, typically in October and November, however, some populations breed year round. Its gestation lasts 10-11 months, with an interbirth interval of one year. Age at sexual maturity is 18 months for males, and three years for females. The maximum known lifespan is 25 years in the wild (Nowak 1999).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

In the wild, water buffalo are found in tropical and subtropical forests as well as wet grasslands. They are considered terrestrial but are heavily dependent on water and spend a majority of time wallowing in rivers or mud holes. Thus, B. bubalis is found in wet habitats ranging from riverine forests and grasslands, to marshes and swamps. These habitats are a mixture of tall grasses, rivers and streams, and a scattering of trees and forests. Such an environment provides B. bubalis with adequate water for drinking and wallowing, abundant food, and dense cover.

In general, water buffalo are found in lower elevations, but in Nepal, swamp buffalo can commonly be found at elevations of 2,800 m. Domesticated animals are widespread, and therefore are found in a wide variety of habitats. The majority of the domesticated water buffalo are found in agricultural communities, but they can also be found in many cities.

Range elevation: 0 to 2800 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

Wetlands: marsh ; swamp

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Ligda, D. 1999. "Work" (On-line). Water Buffalo. Accessed January 31, 2004 at http://ww2.netnitco.net/users/djligda/waterbuf.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Wild Asian buffalo are considered terrestrial but are heavily dependent on water, spending much of their time wallowing in rivers or mud holes. The species therefore occupies wet habitats ranging from riverine forests, woodlands and grasslands, to marshes and swamps, usually in lowlands but up to elevations of 2,800 metres in Nepal (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bubalus bubalis is a ruminant and is predominately a grazer on grasses. It also eats herbs, aquatic plants, leaves, agricultural crops, and various other vegetation that grows in or along rivers and streams.

Plant Foods: leaves; wood, bark, or stems; macroalgae

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Bubalus bubalis is preyed upon by tigers, thus providing a food source for top predators. Remains of dead water buffalo are also fed upon by various scavengers. Large herds have been shown to impact the nesting sites of some birds such as magpie geese. Water buffalo have proven destructive to caimans and their nesting sites in Brazil, adversely affecting the caimans' productivity and long-term density. Large herds of water buffalo also may damage certain flora, either directly by trampling or grazing, or indirectly by soil compaction. Water buffalo have been blamed for exacerbating the spread of exotic weeds in northern Australia. Finally, their excrement provides fertilizer for various flora.

  • Fensham, R., I. Cowie. 1998. Alien plant invasions on the Tiwi Islands. Extent, implications and priorities for control. Biological Conservation, 83: 55-68.
  • Campos, Z. 1993. Effect of habitat on survival of eggs and sex ratio of hatchlings of Caiman crocodilus yacare in the Pantanal, Brazil. Journal of Herpetology, 27: 127-132.
  • Corbett, L., A. Hertog, W. Muller. 1996. An experimental study of the impact of feral swamp buffalo Bubalus bubalis on the breeding habitat and nesting success of magpie geese Anseranas semipalmata in Kakadu National Park. Biological Conservation, 76: 277-287.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In general, the horns of bovids are effective anti-predator deterrents. Humans have been a significant threat to water buffalo, both through hunting and through habitat encroachment and fragmentation. Tigers are the only other predator on water buffalo, though water buffalo are challenging prey even to so large a cat. When confronted by a tiger, water buffalo often stand together as a herd and charge together in a line. They are usually successful at driving tigers off, and water buffalo have been known to kill tigers with their horns. Tigers often have their success stalking single animals and focusing on juveniles.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

In general, bovids communicate through posture and movement. Herds often grunt and snort to each other as they travel, while bellowing is rare. Bulls often snort and stamp the ground before charging. Charging may occur as a means of defense, or as an aggressive display of dominance, as seen in mate competition. Bubalus bubalis has a well developed sense of smell, and checmical cues seem to be important, at least in mating. These animals also have acute hearing. Water buffalo are not highly dependent on sight. Although physical aggression is rare, some tactile communication occurs between mates, as well as between mothers and their young.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Water buffalo are known to have a life of up to 25 years in the wild, and a longevity of up to 29 years in captivity.

Range lifespan

Status: wild:
25 (high) years.

Range lifespan

Status: captivity:
29 (high) years.

Average lifespan

Status: captivity:
34.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 34.9 years (captivity) Observations: In captivity these animals may live up to 34.9 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating is typically polygynous. Maternal groups exist in a large, loosely structured herds year round. During the wet season, adult males (from bachelor groups or solitary) enter the female groups, and mate with, but do not control, the receptive females who are in estrus for 11 to 72 hours. After mating, males are driven off. Male bovids in general display dominance by posture and movement, and few conflicts escalate to levels of serious injury. Bulls determine estrus by sniffing a cow’s urine and genitals.

Mating System: polygynous

Timing of reproduction in this species is somewhat variable. In some areas, breeding is seasonally dependent, whereas in other areas it is seasonally independent. Where seasonally dependent, breeding often occurs after the rainy season and calves are born the following year near the beginning of the rainy season. Where seasonally independent, calves may be born year round.

The estrus cycle is 21 days. Of female bovids, water buffalo have the longest gestation period: 300 to 340 days. Females usually have one calf, but they may have twins. A female typically produces an average of one calf every two years. Calves are born weighing 35 to 40 kg, and are red to yellow brown. Nursing lasts 6 to 9 months.

Females reach sexual maturity at approximately 1.5 years of age and remain in a maternal group within a larger herd. Males reach sexual maturity at the age of 3 years, at which point they leave the female group and often join bachelor groups.

Breeding interval: Females are capable of producing one calf every two years.

Breeding season: Most breeding in seasonal populatons occurs in October and November. However, some populations can breed year round.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 300 to 340 days.

Range weaning age: 6 to 9 months.

Average age at sexual or reproductive maturity (female): 1.5 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 37500 g.

Average number of offspring: 1.375.

Average age at sexual or reproductive maturity (female)

Sex: female:
502 days.

Males only exhibit mating effort, and after impregnating the females show no further parental investment. Females exhibit all parental care of the young. Females nurse their calves from 6 to 9 months. Before independence, females also protect their calves and can be aggressive. At age 3 males leave maternal group. Females remain in their maternal group, and inherit the loose territory of the larger female herd which is composed of multiple maternal groups.

Parental Investment: no parental involvement; precocial ; female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female); post-independence association with parents; inherits maternal/paternal territory

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Lekagul, B., J. McNeely. 1988. Mammals of Thailand. Bangkok, Thailand: Darnsutha Press.
  • Ligda, D. 1999. "Reproduction" (On-line). Water Buffalo. Accessed January 31, 2004 at http://ww2.netnitco.net/users/djligda/waterbuf.htm.
  • Macdonald, D. 2001. Wild Cattle and Spiral-Horned Antelope. Pp. 530-539 in G Bateman, T Allan, M Salad, eds. The New Encyclopedia of Mammals. New York: Oxford University Press.
  • Shackleton, D., A. Harestad. 2003. Bovids I - Kudus, buffaloes, and bison. Pp. 11-25 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Grzimek's Animal Life Encylopedia, Vol. 16, 2nd Edition. Farmington Hills, MI: Gale Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bubalus bubalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0255-06|AY488491|Bubalus bubalis| AACCGCTGATTATTCTCAACCAATCATAAAGATATCGGCACCCTATACTTACTATTTGGTGCCTGGGCCGGCATAGTAGGAACAGCCCTA---AGCCTGCTAATTCGCGCTGAATTGGGTCAACCCGGAACCCTGCTCGGAGAT---GACCAAATCTACAACGTAGTTGTAACTGCACACGCATTTGTAATAATCTTCTTTATAGTAATGCCAATTATAATTGGAGGGTTCGGTAATTGACTAGTTAATCTAATA---ATTGGCGCCCCCGACATAGCATTCCCCCAGATAAATAATATAAGCTTCTGACTCCTTCCCCCCTCCTTCCTACTACTTCTAGCATCATCCATAGTTGAGGCTGGGGCAGGAACAGGTTGAACCGTGTATCCCCCTTTAGCAGGTAACCTGGCCCAGGCAGGAGCCTCAGTAGACCTA---ACCATTTTCTCTTTACACTTGGCAGGTGTCTCCTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATAAACCCCCCCGCAATGTCACAATGCCAAACCCCTCTATTCGTGTGATCCGTAATAATCACCGCCGTATTACTGCTCCTTTCACTTCCTGTACTAGCAGCT---GGCATTACAATGCTACTAACAGATCGAAATCTAAATACAACCTTCTTTGACCCGGCAGGAGGAGGGGACCCTAACCTATACCAACACTTATCTTGATTCTTTGGACACCCCGAAGTCTATATTCTTATTCTACCTGGGTTTGGAATAATCTCTCATATTGTAACTTACTACTCAGGG---GAAAAAGAACCATTCGGATATATAGGAATAGTTTGAGCTATAATATCAATCGGATTTTTAGGGTTCATCATATGAGCTCACCACATATTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bubalus bubalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cde+3cde+4cde; C1

Version
3.1

Year Assessed
2008

Assessor/s
Hedges, S., Sagar Baral, H., Timmins, R.J. & Duckworth, J.W.

Reviewer/s
Burton, J. & Hedges, S. (Asian Wild Cattle Red List Authority)

Contributor/s

Justification
Wild Water Buffalo is listed as Endangered A2cde+3cde+4cde; C1. The remaining world population totals under 4,000, with an estimate of fewer than 2,500 mature individuals. An estimated population reduction of at least 50% over the last three generations (generation length estimated at 8–10 years) seems likely given the severity of the threats, especially hybridization; it is projected to continue into the future.

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although domesticated water buffalo are thriving and are distributed well beyond their native range, true wild water buffalo are in jeopardy. It may be that no true wild water buffalo exist, but have been lost to interbreeding with domesticated or feral buffalo. It is difficult to distinguish between wild water buffalo, feral, domesticated, and their hybrids, thus making their actual status uncertain. They are currently listed as endangered under the IUCN Red List of Threatened Species, and it is estimated that there are less than 1,000 wild water buffalo remaining. These suspected wild individuals reside in small parts of India, Bhutan, Nepal, and Thailand. The possibility of extinction of wild populations is quite real.

The major threats to the species include continued habitat destruction and fragmentation as agricultural land use expands; hunting; and interbreeding with domestic and feral buffalo. Other serious threats include competition with domestic livestock, and diseases carried by domestic livestock.

Wild water buffalo are legally protected in Bhutan, Nepal, India, and Thailand on nature reserves, and are listed in CITES under Appendix III (Nepal). Conservation programs are focusing on preserving their habitat, which is becoming increasingly difficult as human populations expand.

US Federal List: no special status

CITES: appendix iii

IUCN Red List of Threatened Species: endangered

  • Choudhury, A. 1994. The decline of the wild water buffalo in north-east India. Oryx, 28: 70-73.
  • Hedges, S. 1996. "Species Information" (On-line). The IUCN Red List of Threatened Species. Accessed February 07, 2004 at http://www.redlist.org/search/details.php?species=3129.
  • Heinen, J. 1993. Population viability and management recommendations for wild water buffalo Bubalus bubalis in Kosi Tappu Wildlife Reserve, Nepal. Biological Conservation, 65: 29-34.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed under Appendix III (Nepal) of CITES (as Bubalus arnee) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total world population of Wild Water Buffalo is almost certainly less than 4,000 animals and may well be less than 200, occupying an area of less than 20,000 km². Indeed it is possible that no pure-bred Wild Water Buffaloes remain. However, these figures are little more than informed guesses, since any assessment of buffalo numbers is hampered by the difficulty of distinguishing between free-ranging domestic buffaloes, feral buffaloes, truly wild buffaloes, and hybrids between wild and other buffaloes. Individuals of Wild Water Buffalo and Domestic Water Buffalo are difficult to distinguish in some areas, and some domestic populations may be very closely related to (perhaps identical to) Wild Water Buffalo, as in Cambodia, where traditional forms of buffalo husbandry allow herds to range freely in forest areas (Timmins and Ou 2001; R. J. Timmins pers. comm. 2008). There have been few detailed analyses of the purity of the presumed remaining Wild Water Buffalo populations, nor in many cases is it obvious how such an assessment would be made. The Domestic Water Buffalo occurs as feral and domesticated populations worldwide, including in sympatry with most remaining populations of Wild Water Buffalo (Grubb 2005; S. Hedges pers comm. 2008). Some feral and domestic populations may well have conservation significance, retaining some of the genetic stock of the wild populations for that particular region, this may be especially true in Indochina due to traditional methods of Water Buffalo husbandry (S. Hedges pers comm. 1994, 2008; Timmins and Ou 2001; R.J. Timmins pers. comm. 2008).

In India, Wild Water Buffalo is now largely restricted to Assam, Arunachal Pradesh, and Madhya Pradesh. In Assam, the species is found in and around Manas Sanctuary, Laokhowa Sanctuary, Kaziranga National Park, and Dibru Sanctuary. In Arunachal Pradesh, the species occurs in and around Namdapha Sanctuary. There are two populations in Madhya Pradesh (Bastar district), one in Indravati National Park, and another in Udanti Sanctuary, which might extend into adjacent parts of Orissa. However, most, if not all, surviving populations are believed to have interbred with domesticated and/or feral Domestic Water Buffalo. In the late 1980s, Divekar suggested that there were fewer than 100 truly wild buffaloes left in India (in Madhya Pradesh); and by 1992 the numbers had dropped even further to an estimated 50 animals. However, Choudhury (1994) reported that in the early 1990s there may still have been about 3,300–3,500 wild buffaloes in Assam and the adjacent states of northeast India, plus a small number in Madhya Pradesh. A 1997 CAMP workshop assessed the number of mature individuals in India to be less than 1,500 (S. Hedges pers. comm. 1995). The population data suggest a decline of about 80% between 1966 and 1992 in central India. In northeast India, insufficient data exist to enable trends to be calculated but there is little doubt that the number of true wild buffalo has declined and is continuing to decline as a result of interbreeding with domestic and/or feral buffalo, hunting, and habitat loss (S. Hedges and J. W. Duckworth pers. comm. 2000).

An unknown number of Wild Water Buffaloes, believed to include truly wild individuals, occurs in and around Bhutan's Royal Manas National Park. This is the only subpopulation in Bhutan and is contiguous with that in Manas Tiger Reserve in India.

Kosi Tappu Wildlife Reserve contains the only population in Nepal, where there were 159 wild Asian Buffalo in 2004 but this sole Nepali population is currently seriously threatened (Heinen and Kandel 2006).

There are no population estimates for Myanmar, reflecting a paucity of recent surveys. The extent of suitable habitat means the species could be still extant, and a few wild-living animals independent of human husbandry live in the Hukaung Valley of Kachin state (Than Zaw pers. comm. 2006; Saw Htun pers. comm. 2006; A.W. Tordoff pers. comm. 2006 to J.W. Duckworth pers. comm. 2008 ). Pending further information, these should be seen as likely to be genuinely wild stock or at least if feral, of archaic origin, and so, in either case, of conservation significance.

In Thailand, 40–50 wild buffaloes are reported to occur in the Huai Kha Khaeng Wildlife Sanctuary; this is the only population remaining in Thailand (Rattanawat Chairat in litt. to Anak Pattanavibool pers. comm. 2006). This population may be interbreeding with Domestic Water Buffalo, although individuals can often be distinguished in the field (Anak Pattanavibool pers. comm. 2006). In Thailand, wild buffalo numbers have apparently been relatively stable since the mid-1980s (R. Steinmetz pers. comm. 2006).

The population in Cambodia, which is confined to a small area of easternmost Mondulkiri and possibly Ratanakiri Provinces is very small, with perhaps a few dozen individuals remaining (Timmins and Ou 2001; Tordoff et al. 2005). There has not been any thorough analysis of the purity of these animals (i.e. whether they are truly wild, rather than some mix or perhaps just feral domestic animals), as is the case with most other putative populations of the species (Timmins and Ou 2001; R.J. Timmins pers. comm. 2008).

Before 1999, there was reportedly a population in Mom Ray, Viet Nam, but this population no longer exists (Dang Huy Huynh in litt.; Do Tuoc pers. comm. 2006). Rumours still persist of presence in other areas, for example the Satay region (Tordoff et al. 2005; R.J. Timmins pers. comm. 2008). Wild buffaloes of the Cambodian population may wander into western Dak Lak province, but no recent records in Viet Nam have been confirmed to represent wild Water Buffalo (Le Xuan Canh et al. 1997; Eames et al. 2004; Tordoff et al. 2005; R.J. Timmins pers. comm. 2008).

The species was thought to formerly occur in Lao PDR, but the date of extinction is not known (Duckworth et al. 1999).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The most important threats to Wild Water Buffalo are interbreeding with feral and domestic buffalo, hunting, and habitat loss/degradation. Diseases and parasites (transmitted by domestic livestock) and interspecific competition for food and water between wild buffalo and domestic stock are also serious threats. The scale of the threat posed to Wild Water Buffalo by the trade in wildlife products is difficult to quantify, not least because it is unclear how many of the trophies from reportedly wild buffalo are in fact from wild buffalo rather than from feral or hybrid animals (Divekar and Bharat Bhusan 1988; Heinen 1993; Choudhury 1994; S. Hedges pers. comm. 2000).

Most of the species' former lowland habitat has been lost to agriculture, and what remains is highly fragmented. However, especially in countries such as Cambodia and Lao PDR, vast tracts of suitable lowland forest remain from which the species has long since been hunted out, and certainly there are several viable tracts of habitat in which the species could be re-introduced (Tordoff et al. 2005; R. J. Timmins pers. comm. 2008).

The Cambodian population is under severe threat from hunting for trophy horns both by Cambodians and Viet Namese hunters crossing the border (Timmins and Ou 2001; Tordoff et al. 2005; R.J. Timmins pers. comm. 2008; Do Tuoc pers. comm. 2006). This threat is currently somewhat alleviated through to an active protected area management project, but hunting is still rife in much of the surrounding area, as is forest fragmentation due to human population in migration, infrastructural developments (especially roads), commercial agricultural expansion, economic land speculation and mineral extraction (Tordoff et al. 2005; R. J. Timmins pers. comm. 2008). However, the most significant threat to the area is the long-term uncertainty of continuation of effective conservation management of the Srepok Wilderness Area. This area faces an uncertain future. with part already degazetted from conservation status and the possibility that more would be excised in the future, the lack of long-term security of external funding adequate to maintain high standards of management, the uncertainty of long-term political support to uphold high protection standards and the uncertainties of maintaining a motivated and well-trained staff (R. J. Timmins pers. comm. 2008).

In Myanmar, the population of wild-ranging buffaloes either truly wild or at least living outside human custody for a long time in and around the proposed Hukaung Valley Tiger Reserve faces a very uncertain future. The seasonally-flooded plains, a matrix of grass and scrub, lies largely outside the already-established Hukaung Valley Wildlife Sanctuary and the areas of highest conservation significance lie south of the boundary even for a vast proposed extension to form the Hukaung Valley Tiger Reserve. All level areas in this region are under very high threat for conversion to agriculture, both rice and industrial-scale plantations of cash-crops. There is also an active hunting system for wild meat to feed hundreds of thousands of itinerant labourers in this area (J.W. Duckworth pers. comm. 2008).

The invasive Mikania sp. also potentially threatens wetlands in the South Asian range of wild Water Buffaloes (Hem Sagar Baral pers. comm. 2008).

Hydropower development and resulting changes in water flow and level conditions downstream also threaten the ecological maintenance of floodplain areas (Odden et al. 2005).

Disease epidemics spreading from domestic livestock presumably pose a threat, especially given the close overlap of Wild Water Buffalo populations and domestic livestock in South Asia, the high densities especially of the latter, and the small and localised nature of Wild Water Buffalo populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although domestic buffalo are widespread and thriving, there is a very real possibility that true wild Asian buffalo will become extinct in the near future, if they have not already done so (3). Indeed, the total world population is thought to almost certainly be less than 4,000 individuals, perhaps considerably less, but there is also a very real possibility that no pure-bred wild Asian buffalo exist anymore. Unfortunately, accurate assessment of numbers is problematic due to the difficulty of distinguishing pure animals from free-ranging domestic or feral buffalo (1). Nevertheless, the species is generally accepted to be undergoing very serious declines as a result of hunting, habitat loss and degradation as agricultural land use expands, and hybridisation with domestic and/or feral buffalo (1) (3). Other threats include diseases and parasites transmitted by domestic livestock and competition for food and water between wild and domestic buffalo (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Wild Water Buffalo is included in CITES under Appendix III (Nepal). It is legally protected in Bhutan, India, Nepal, and Thailand. The Cambodia population was a major factor in the decision to place further protection on the area, now designated as Mondulkiri Protection Forest, and a significant factor in the decision to establish the Srepok Wilderness Area Project of the Cambodian Department of Forestry and WWF (Goodman et al. 2003; R. J. Timmins pers. comm. 2008).

Most of the known populations are within protected areas. In Myanmar, which retains true lowland floodplains in near-natural state in the Hukaung Valley, the protected area system originally almost entirely excluded floodplain grasslands. The inclusion of some areas is now under consideration, and would benefit this species. However, the outcome is far from certain (J.W. Duckworth pers. comm. 2006).

Most remaining populations still require protection from hunting (especially those in Thailand and Cambodia, and Myanmar if still extant), but probably the greater threat in South Asia is protection from contact with other domestic bovines, especially Domestic Water Buffalo.

There is an urgent need to evaluate the integrity of wild-living buffalo populations, including those generally taken as being truly wild and those living as wild animals within the native range, using habitat typical of wild animals, and which have lived outside even occasional husbandry for a long time, in order to determine populations of conservation priority. This should involve the assessment of the relationship of such populations in the context of obvious domestic lineages, especially those in close proximity to wild populations. Such an approach should use multiple genetic markers in addition to an assessment of morphological characteristics.

Surveys to investigate current status of wild-living populations are needed in Myanmar and perhaps the Satay district of Viet Nam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Wild Asian buffalo are listed under Appendix III of the Convention on International Trade in Endangered Species (CITES) in Nepal, which limits the quantity of animal products that can be exported and imported across international borders, but this does not regulate domestic trade (4). Nevertheless, the species is legally protected across its range in Bhutan, Nepal, India and Thailand and it is thought that pure-bred populations may occur in several protected areas (1). Existing conservation programmes are focusing on preserving the buffalo's diminishing habitat, but this is becoming increasingly difficult as human populations expand and encroachment continues (3). Sadly, the future does not look bright for pure-bred Asian buffalo, which are currently in very grave danger of disappearing forever, if they have not already done so.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Water buffalo are determined animals, and they are very large. They may break into fields and consume produce. They are known to damage rice paddys and other growing crops. Wild bulls have been known to invade domesticated herds, killing the less capable domesticated bull, and breeding with receptive females. Therefore, loss is incurred through the death of the tame bull. Furthermore, the resulting offspring are less docile and possibly too large to fit a farmer's equipment. Occasionally, wild bulls not only invade tame herds, but also take over and drive off owners, keeping the herd for themselves. Lastly, wild or feral water buffalo are dangerous animals. Females with young can be very defensive and are known to charge and to injure humans. Bulls that are wounded are extremely dangerous and have been known to kill humans that are stalking them.

Negative Impacts: injures humans; crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The domestication of water buffalo 5,000 years ago has made them economically important animals. They provide more than 5% of the world’s milk supply. Their milk is exceedingly rich, having less water and more fat, lactose, and protein than cow milk. It is used to make butter, butter oil (ghee), high quality cheeses, and various other products. Their meat is very tender and palatable and is difficult to differentiate from beef. Their hides also are of significant importance in that they make superb leather products. They are a noteworthy beast of burden throughout much of their range. Water buffalo are equivalent to tractors in Southeast Asia, providing 20% to 30% of farm power; they also serve as means of transportation, and their dung is collected and used as fertilizer. Lastly, water buffalo are also important for some hunting businesses.

Positive Impacts: food ; body parts are source of valuable material; produces fertilizer

  • Ligda, D. 1999. "Milk" (On-line). Water buffalo. Accessed January 31, 2004 at http://ww2.netnitco.net/users/djligda/waterbuf.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Wild water buffalo

The wild water buffalo (Bubalus arnee) also called Asian buffalo and Asiatic buffalo is a large bovine native to Southeast Asia. The species is listed as endangered on the IUCN Red List since 1986, as the remaining population totals less than 4,000, with an estimate of fewer than 2,500 mature individuals.[1]

The global population has been estimated at 3,400 individuals, of which 3,100 (91%) live in India, mostly in Assam.[2]

The wild water buffalo is the ancestor of the domestic water buffalo, and the second-largest wild bovid, smaller only than the gaur.

The slightly smaller African buffalo or Cape buffalo (Syncerus caffer) is not closely related to the water buffalo.

Contents

Characteristics

Horn differences between Cape buffalo (above) and water buffalo (below) - the two groups are not closely related.

Wild water buffalo are larger and heavier than domestic buffalo, and weigh from 700 to 1,200 kg (1,500 to 2,600 lb). Their head-to-body-length is 240 to 300 cm (94 to 120 in) with a tail 60 to 100 cm (24 to 39 in) long, and a shoulder height of 150 to 190 cm (59 to 75 in). Both sexes carry horns that are heavy at the base and widely spreading up to 2 m (79 in) along the outer edges, exceeding in size the horns of any other living bovid. Their skin color is ash gray to black. The moderately long, coarse and sparse hair is directed forward from the haunches to the long and narrow head. There is a tuft on the forehead, and the ears are comparatively small. The tip of the tail is bushy; the hooves are large and splayed.[3]

Distribution and habitat

Landscape in Kaziranga National Park with a herd of water buffaloes in the background

Wild water buffalos occur in India, Nepal, Bhutan, Thailand, and Cambodia, with an unconfirmed population in Myanmar. They have been extirpated in Pakistan, Bangladesh, Laos and Vietnam.[1][2] They are associated with wet grasslands, swamps and densely vegetated river valleys.[3]

In India, they are largely restricted to in and around Kaziranga, Manas and Dibru-Saikhowa National Parks, Laokhowa and Burhachapori Wildlife Sanctuaries and a few scattered pockets in Assam; in and around D'Ering Memorial Wildlife Sanctuary in Arunachal Pradesh; a small population in Buxa Tiger Reserve northern West Bengal; Balpakram National Park Meghalaya and in Madhya Pradesh in the Indravati National Park and the Udanti Wildlife Sanctuary.[2] This population might extend into adjacent parts of Orissa. In the early 1990s, there may still have been about 3,300–3,500 wild buffaloes in Assam and the adjacent states of northeast India.[4] In 1997, the number was assessed at less than 1,500 mature individuals.[1]
Many surviving populations are believed to have interbred with domestic or feral water buffalos. In the late 1980s, fewer than 100 wild buffaloes were left in Madhya Pradesh.[5] By 1992, only 50 animals were estimated to have survived there.[4]

Nepal's only population lives in the Koshi Tappu Wildlife Reserve, and comprised 219 individuals in 2009.[2] This small population is currently seriously threatened.[6][7]

In and around Bhutan's Royal Manas National Park, a small number of wild water buffaloes occur. This is part of the subpopulation that occurs in India's Manas National Park.[2] In Myanmar, a few wild-living animals independent of human husbandry live in the Hukaung Valley Tiger Reserve.[1]

In Thailand, wild buffaloes have been reported to occur in small herds of less than 40 individuals. A population of 25–60 individuals inhabited lowland areas of the Huai Kha Khaeng Wildlife Sanctuary between December 1999 and April 2001. This population has not grown significantly in 15 years, and may be interbreeding with domestic water buffalo.[8]

The population in Cambodia is confined to a small area of easternmost Mondulkiri and possibly Ratanakiri Provinces. Only a few dozen individuals remain.[9]

Populations found elsewhere in Asia are feral breeds. They were introduced to northern Australia, Argentina and Bolivia.[3]

Ecology and behavior

Wild water buffalos are both diurnal and nocturnal. Adult females and their young form stable clans of as many as 30 individuals that have home ranges of 170 to 1,000 ha (0.66 to 3.9 sq mi), including areas for resting, grazing, wallowing and drinking. Clans are led by old cows, even when bulls accompany the group. Several clans form a herd of 30 to 500 animals that gather at resting areas. Adult males form bachelor groups of up to 10 individuals, with older males often solitary, and spend the dry season apart from the female clans. They are seasonal breeders in most of their range, typically in October and November. However, some populations breed year round. Dominant males mate with the females of a clan who subsequently drive them off. Their gestation period lasts 10 to 11 months, with an interbirth interval of one year. They typically give birth to a single offspring, although twins are possible. Age at sexual maturity is 18 months for males, and three years for females. The maximum known lifespan is 25 years in the wild.[3] In the wild in Assam, the herd size varied from three to 30 individuals.[2]

They are probably grazers by preference, feeding mainly on true grasses when available, such as scutch grass, and sedges, but they also eat herbs, fruits, and bark, as well as browsing on trees and shrubs.[10] They also feed on crops, including rice, sugarcane, and jute, sometimes causing considerable damage.[11]

Threats

A population reduction by at least 50% over the last three generations seems likely given the severity of the threats, especially hybridization; this population trend is projected to continue into the future. The most important threats are:[1]

Tigers prey on adult wild water buffalo, and Asian black bears have also been known to kill them.[12] The smaller and less aggressive domestic water buffalo can be taken by the saltwater crocodile (Crocodylus porosus), which rarely, if ever, encounters the wild buffalo species.

Conservation

Bubalus arnee is included in CITES Appendix III, and is legally protected in Bhutan, India, Nepal, and Thailand.[1]

Taxonomy

Water buffalo sculpture, Lopburi, Thailand, 2300 BCE

Carl Linnaeus applied the binomial Bos bubalis to the domestic water buffalo in his first description of 1758. In 1792, Robert Kerr applied the binomial Bos arnee to the wild species occurring in India north from Bengal. Later authors subordinated the species under either Bos, Bubalus or Buffelus.[13]

In 2003, the International Commission on Zoological Nomenclature fixed the first available specific name based on a wild population that the name for this wild species is valid by virtue of its being antedated by a name based on a domestic form. Most authors have adopted the binomial Bubalus arnee for the wild species as valid for the taxon.[14]

The river buffalo Bubalus bubalis bubalis and carabao or swamp buffalo Bubalus bubalis carabanensis are both derived from the wild water buffalo, and are the product of thousands of years of selective breeding carried out either in South Asia or Southeast Asia.[15]

Modern uses

Wildlife and conservation scientists have started to recommend and use introduced populations of feral domestic water buffalo in far away lands to manage uncontrolled vegetation growth in and around natural wetlands. Introduced water buffalo at home in such environs provide cheap service by regularly grazing the uncontrolled vegetation and opening up clogged water bodies for waterfowl, wetland birds and other wildlife.[16]

See also

References

  1. ^ a b c d e f g Hedges, S., Sagar Baral, H., Timmins, R.J., Duckworth, J.W. (2008). "Bubalus arnee". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/3129. 
  2. ^ a b c d e f Choudhury, A. (2010) The vanishing herds : the wild water buffalo. Gibbon Books, Rhino Foundation, CEPF & COA, Taiwan, Guwahati, India.
  3. ^ a b c d Nowak, R. M. (1999) Walker's Mammals of the World. Volume 1. The Johns Hopkins University Press, Baltimore, USA and London, UK
  4. ^ a b Choudhury, A. (1994) The decline of the wild water buffalo in northeast India. Oryx 28(1): 70–73
  5. ^ Divekar, H. K., Bhusan, B. (1988) Status of wild Asiatic buffalo (Bubalus bubalis) in the Raipur and Bastar Districts of Madhya Pradesh. Technical Report of the Bombay Natural History Society of the Salim Ali Nature Conservation Fund, SANCF Report No. 3/1988
  6. ^ Heinen, J. T. (1993) Population viability and management recommendations for wild water buffalo (Bubalus bubalis) in Kosi Tappu Wildlife Reserve, Nepal. Biological Conservation 65: 29–34
  7. ^ Heinen, J. T., Ramchandra, K. (2006) Threats to a small population: a census and conservation recommendations for wild buffalo Bubalus arnee in Nepal. Oryx 40: 1–8
  8. ^ Chaiyarat, R., Lauhachinda, V., Kutintara, U., Bhumpakphan, N., Prayurasiddhi, T. (2004) Population of Wild Water Buffalo (Bubalus Bubalis) in Huai Kha Khaeng Wildlife Sanctuary, Thailand. Natural History Bulletin Siam Society 52 (2): 151–162
  9. ^ Tordoff, A. W., Timmins, R. J., Maxwell, A., Huy Keavuth, Lic Vuthy and Khou Eang Hourt (eds). (2005) Biological assessment of the Lower Mekong Dry Forests Ecoregion. WWF Greater Mekong Programme. Phnom Penh, Cambodia
  10. ^ Daniel, J. C., Grubh, B. R. (1966) The Indian wild buffalo Bubalus bubalis (Linn), in peninsular India: a preliminary survey. Journal of the Bombay Natural History Society 63: 32–53
  11. ^ Lēkhakun, B., Mcneely, J. A. (1988) Mammals of Thailand. 2nd edition. Saha Karn Bhaet, Bangkok, Thailand
  12. ^ Humphrey, S. R., Bain, J. R. (1990) Endangered animals of Thailand. Issue 6 of Flora & Fauna handbook. Sandhill Crane Press. ISBN 1-877743-05-4
  13. ^ Ellerman, J. R., Morrison-Scott, T. C. S. (1966) Checklist of Palaearctic and Indian mammals 1758 to 1946. Second edition. London: British Museum of Natural History. Pp 383–384
  14. ^ Gentry, A. Clutton-Brock, J., Groves, C. P. (2004) The naming of wild animal species and their domestic derivatives. Journal of Archaeological Science 31: 645–651
  15. ^ Yang, D. Y., Li Liu, Chen, X., Speller, C. F. (2008) Wild or domesticated: DNA analysis of ancient water buffalo remains from north China. Journal of Archaeological Science 35 (2008) 2778–2785
  16. ^ BBC News February 2004 Buffalo improve wildlife habitat
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Murrah buffalo

The Murrah breed of Water buffalo (Bubalus bubalis) is a breed of domestic water buffalo kept for dairy production. It is originally from Punjab and Haryana states of India and Punjab province of Pakistan, but has been used to improve the milk production of dairy buffalo in other countries, such as Italy, Bulgaria and Egypt. In Italy, it is the basis of Mozzarella cheese production, and therefore Italian Pizza. By Italian law, Mozzarella may only be made from buffalo milk, which is preferred for its very high butterfat content, up to 16% compared with 4% for European (Bos taurus) dairy breeds such as Jersey cattle and 8% for Zebu (Bos indicus) breeds such as Sahiwal.

Appearance

Murrah Buffalo in Brazilian Farm - It seems to cry

Jet black in colour, sometimes with white markings on face or legs. Bulls weigh 550 kg and cows 450 kg[1][2].

In Brazil this breed of buffalo is very used for production of meat and also milk. They are docile and productive animals.


References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Water buffalo

The water buffalo or domestic Asian water buffalo (Bubalus bubalis) is a large bovine animal, frequently used as livestock in the Indian Subcontinent, and also widely in South America, southern Europe, the Middle East, northern Africa, and elsewhere.

In 2000, the United Nations Food and Agriculture Organization estimated there were approximately 158 million water buffalo in the world, with 97% of them (approximately 153 million animals) in Asia.[1] There are established feral populations in northern Australia, but the dwindling true wild populations are thought to survive in India, Bangladesh, Nepal, Bhutan, and Thailand. All the domestic varieties and breeds descend from one common ancestor, the wild water buffalo, which is now an endangered species.[2] The domestic water buffalo, although derived from the wild water buffalo, is the product of thousands of years of selective breeding in either the Indian Subcontinent or Southeast Asia.[3]

Buffalo are used as draft, meat, and dairy animals. Their dung is used as a fertilizer, and as a fuel when dried. In the Chonburi of Thailand, Pakistan, and the southwestern region of Karnataka, India, there are annual water buffalo races known as kambala. A few have also found use as pack animals, carrying loads even for special forces.[citation needed]

The water buffalo genus includes water buffalo, tamaraw and anoas, all of which are Asian species. The ancestry of the African buffalo is unclear, but it is not believed to be closely related to the water buffalo.[citation needed]

Contents

Wild water buffalo

It is known as "water buffalo" because it is adapted to and enjoys being in water.

True wild water buffalo are thought to survive in Bangladesh, India, Nepal, Bhutan, and Thailand.[citation needed]

The IUCN Red List of threatened species classifies wild water buffalo (Bubalis arnee)[4] as an endangered species in Southeast Asia. They run rampant as wild animals in the Northern Territory, Australia, which is the only part of the world where they are legally hunted because of their large numbers there. The total number of wild water buffalo left in Southeast Asia is thought to be less than 4,000, which suggests the number of mature individuals will be less than 2,500, and an estimated continuing decline of at least 20% within 14 years (about two generations) and at least 50% within 21 years seems likely, given the severity of the threats, especially hybridization with the abundant domestic Asian water buffalo, leading to genetic pollution.[5]

Anatomy and morphology

Horn differences between Cape buffalo (above) and Asian water buffalo (below)
An albino water buffalo in Chiang Mai province, Thailand

Adult water buffalo range in size from 400 to 900 kg (880 to 2,000 lb) for the domestic breeds, while the wild animals are nearly 3 m (9.8 ft) long and 2 m (6.6 ft) tall, weighing up to 1,200 kg (2,600 lb); females are about two-thirds this size.[6]

River buffalo are usually black, have curled horns, and are native to the western half of Asia, whereas swamp buffalo can be black, white or both, with long, gently curved, swept-back horns; they are native to the eastern half of Asia from India to Taiwan.[1] The largest recorded horns are just under two metres long.[6]

The rumen (the first chamber of the digestive system of a ruminant) of the water buffalo has important differences from that of other ruminants.[7]

The water buffalo rumen has been found to contain a larger population of bacteria, particularly the cellulolytic bacteria, lower protozoa and higher fungi zoospores. In addition, higher rumen ammonia nitrogen (NH4-N) and higher pH have been found as compared to those in cattle.[8]

Taxonomy

The classification of the water buffalo is uncertain. Some authorities list a single species, Bubalus bubalis, with three subspecies, the river buffalo (B. bubalis bubalis) of the Indian Subcontinent, the carabao or swamp buffalo (B. bubalis carabanesis) of the Philippines and Southeast Asia, and the arni, or wild water buffalo (B. bubalis arnee). Others regard these as closely related, but separate, species.[9] In 2003, the International Commission on Zoological Nomenclature ruled in favor of keeping wild water buffaloes a separate taxon from river buffaloes. They are now usually referred to as Bubalus arnee, though the former usage is still acceptable for authors who consider them conspecific.

The swamp buffalo has 48 chromosomes; the river buffalo has 50 chromosomes. The two types do not readily interbreed, but fertile offspring can occur. Buffalo-cattle hybrids have not been observed to occur, and the embryos of such hybrids do not reach maturity in laboratory experiments.[10]

Distribution

Buffalo headcount in 2004
Water buffalo ploughing rice fields in Java, Indonesia

Type Locality: "Habitat in Asia, cultus in Italia". Restricted by Thomas (1911a:154) to Italy, Rome, but Linnaeus' (1758) comment indicates Asia (India?).

Distribution: Bangladesh, Burma, Cambodia, India (survives in Assam and Orissa), Nepal, northern Thailand, Vietnam, and possibly at least formerly in Laos; domesticated in North Africa, southern Europe, and even England, east to Indonesia and in eastern South America; supposedly feral populations in Sri Lanka, Sumatra, Java, Borneo, Philippines and other parts of SE Asia; feral populations resulting from introductions in New Britain and New Ireland (Bismarck Arch., Papua New Guinea), and Australia.

The average lifespan in captivity is up to 25 years.

Water Buffalo (Suigyū) by Katsushika Hokusai, ca. 1875

Asia

Carabao cart in the Philippines in 1899

Asia is the native home of the water buffalo, with 95% of the world population, with about half of the total in India. Many Asian countries depend on the water buffalo as their primary bovine species. It is valuable for its meat and milk, as well as the labour it performs. As of 1992, the Asian population was estimated at 141 million. Buffalo milk has the lowest water content and highest fat content amongst farm animals, and the butterfat is a major source of ghee in some Asian countries. Its success in Asia is evident by its extensive range. Both variants occur in Asia. River buffalo are found in elevations of 2,800 m in Nepal, and swamp buffalo are found throughout the lowland tropics. Part of their success is due to their ability to thrive on poor foodstuffs and yet be valuable economically. Moreover, they are much better suited to plough the muddy paddy fields, as they are better adapted than common cattle (Bos taurus) to move in swamps. In India, buffalo populations are thriving because they are considered to be similar to the cattle, which are sacred to the Hindus. Some ethnic groups, such as Batak and Toraja in Indonesia and the Derung in China, use water buffalo or kerbau (called horbo in Batak or tedong in Toraja) as sacrificial animals at several festivals. Especially in the Tana Toraja Regency, a local variety of water buffalo (tedong bonga) features a unique black and white colouration.

Australia

Water buffalo on the side of a road in the Fogg Dam Conservation Reserve

Swamp buffalo were introduced into the Northern Territory from Timor early in the 19th century as a food source and a beast of burden. They escaped, thrived and became feral, causing significant environmental damage. Buffalo are also found in Arnhem Land and the Top End. An estimated 350,000 buffalo were living on the floodplains of Arnhem Land and the Katherine region in the 1980s. As a result, they were hunted in the Top End from 1885 until 1980. The commencement of the Brucellosis and Tuberculosis Campaign (BTEC) resulted in a huge culling program to reduce buffalo herds to a fraction of the numbers that were reached in the 1980s. The BTEC was finished when the Northern Territory was declared free of the disease in 1997.[11]

During the 1950s, buffalo were hunted for their skins and meat, which was exported and used in the local trade. In the late 1970s, live exports were made to Cuba and continued later into other countries. Buffalo are now crossed with riverine buffalo in artificial breeding (AI) programs, and may be found in many areas of Australia. Some of these crossbreds are used for milk production.[11]

Melville Island is a popular hunting location, where a steady population of up to 4,000 individuals exist. Safari outfits are run out of Darwin to Melville Island and other locations in the Top End, often with the use of bush pilots. The horns, which can measure up to a record of 3.1 metres tip-to-tip, are prized hunting trophies.[11]

The buffalo have developed a different appearance from the Indonesian buffalo from which they descend.[citation needed] They live mainly in freshwater marshes and billabongs, and their territory range can be quite expansive during the wet season. Their only natural predators in Australia are large adult saltwater crocodiles, with whom they share the billabongs, and dingoes, which have been known to prey on buffalo calves and occasionally adult buffalos when the dingoes are in large packs.[citation needed]

Europe and Middle East

Introduced into North Africa and the Near East by 600 AD, the water buffalo was brought to Europe with returning Crusaders in the Middle Ages,[citation needed] and herds can be found in Turkey, Bulgaria, Romania, Albania, Hungary, extreme south of Serbia, Austria and Italy. As in Asia, buffalo of the Middle East and Europe live on coarse vegetation on the marginal land traditionally available to peasants. They are an economic asset by serving as a protein source, draft animal, and storage of family or household wealth. In some areas, they also provide occasional recreation at annual racing festivals. These buffalo are mostly river buffalo; due to genetic isolation, they have adopted a distinct appearance. Buffalo milk is used for the production of buffalo mozzarella in Campania and many other locations around the world.

North America

Murrah Buffalo in a Brazilian Farm

There are very limited commercial herds in North America, for yogurt and cheese products. In Gainesville, Florida, a University of Florida professor, Hugh Popenoe, has raised water buffalo from young obtained from zoo overflow. He uses them primarily for meat production (frequently sold as hamburger), although other local ranchers use them for production of high-quality mozzarella cheese.[12]

South America

Water buffalo were introduced into the Amazon River basin in 1895. They are now extensively used there for meat and dairy production. In 2005, the buffalo herd in the Brazilian Amazon stood at approximately 1.6 million head, of which approximately 460,000 were located in the lower Amazon floodplain.[13] Breeds used include Mediterranean (from Italy), Murrah (India), Jafarabadi (India) and Carabao (Philippines).

In Argentina, many game ranches raise water buffalo for commercial hunting.

Importance to humans

Water buffalo are used for ploughing in Si Phan Don, Laos.
Horns of water buffaloes sacrificed in West Sumba, Indonesia, c. 1936 (collection Tropenmuseum)
Water buffalo dung is dried against the façade of a house in Yuanyang County, Yunnan, China

There are many breeds of domestic water buffalo.

Water buffalo have been domesticated for 5,000 years, and have become economically important animals. They provide more than 5% of the world’s milk supply and 20% to 30% of the farm power in Southeast Asia.[9] Milk from these animals is used by many human populations, and is the traditional raw material for mozzarella cheese and curd due to its higher fat content. In Africa and other locations, water buffalo milk is used for yogurt, as in Vermont, USA. The chief dairy breed of buffalo is the Murrah breed. Buffalo meat, sometimes called "carabeef", is often passed off as beef in certain regions, and is also a major source of export revenue for India, which has the largest population of buffalo in the world. In many Asian regions, buffalo meat is less preferred due to its toughness; however, recipes have evolved (rendang, for example) where the slow cooking process and spices not only makes the meat palatable, but also preserves it, an important factor in hot climates where refrigeration is not always available. Water buffalo horns are used for the embouchure of musical instruments, such as ney and kaval. Water buffalo hide provides a tough and useful leather, often used for shoes and motorcycle helmets. The bones and horns are often made into jewelry, especially earrings.

The water buffalo has promise as a major source of meat, even the milking ones. The water buffalo also is the classic work animal in Asia, an integral part of that continent’s traditional village farming structure, and also used for hauling cotton, pumping water in Pakistan and hauling logs in Turkey. The domesticated water buffalo is often referred to as “the living tractor of the East”, as it is relied upon for ploughing and transportation in many parts of Asia.

Nutrition

Milk Composition Analysis, per 100 grams

ConstituentsunitCowGoatSheepBuffalo
Waterg87.888.983.081.1
Proteing3.23.15.44.5
Fatg3.93.56.08.0
Carbohydrateg4.84.45.14.9
Energykcal666095110
kJ275253396463
Sugars (Lactose)g4.84.45.14.9
Fatty Acids:
Saturatedg2.42.33.84.2
Monounsaturatedg1.10.81.51.7
Polyunsaturatedg0.10.10.30.2
Cholesterolmg1410118
Calciumiu120100170195

[14][Full citation needed]

Top ten buffalo milk producers — 11 June 2008
CountryProduction (tonnes)Footnote
 India56 960 000*
 Pakistan21 500 000P
 People's Republic of China2 900 000F
 Egypt2 300 000F
 Nepal930 000F
 Iran241 500F
 Myanmar205 000F
 Italy200 000F
 Turkey35 100F
 Vietnam31 000F
 World85396902A
No symbol = official figure, P = official figure, F = FAO estimate, * = Unofficial/Semi-official/mirror data, C = Calculated figure A = Aggregate (may include official, semi-official or estimates);

Source: Food And Agricultural Organization of United Nations: Economic And Social Department: The Statistical Division


Adaptation and behavior

Semisubmerged buffalo

Water buffalo spend much of their day submerged in the muddy waters of Asia’s tropical and subtropical forests. They have wide-splayed hooves, which are used to prevent them from sinking too deeply in the mud. These adaptations allow them to move in wetlands and swamps. Water buffalo also prefer to feed in grasslands on grass and forbs.

Water buffalo behavior sometimes differs from cattle. For example, most water buffalo are not trained to be driven. Instead, the herdsman must walk alongside or ahead of them. They then instinctively follow. They also rub against trees more often than cattle do, and they sometimes debark the trees, causing them to die.

Reproduction

A water buffalo calf in India

The water buffalo has a reputation for being a sluggish breeder.[citation needed] Without reasonable nutrition, the animals cannot reach puberty as early in life as genetic capability would normally allow. Females normally produce calves every other year after gestation of 9 to 11 months. Young bulls typically remain with maternal herds, which consist of around 30 buffalo, for three years after birth. They then go on to form small, all-male herds.

Environmental effects

The water buffalo may affect the environment in either positive or negative ways.

Wildlife and conservation scientists have started to recommend and use introduced populations of feral water buffalo to manage uncontrolled vegetation growth in and around natural wetlands. Introduced Asian water buffalo at home in such environs provide cheap service by regularly grazing uncontrolled vegetation and opening up clogged water bodies for waterfowl, wetland birds and other wildlife.[15][16] Grazing water buffalo are sometimes used in Great Britain for conservation grazing, for example to manage Chippenham Fen NNR. These buffalo have been found to be better suited to the wet conditions and poor-quality vegetation than many cattle.[17]

Currently, research is being conducted at the Lyle Center for Regenerative Studies to determine the levels of nutrients removed and returned to wetlands when water buffalo are used for wetland vegetation management.[citation needed]

However, in uncontrolled circumstances, water buffalo can cause environmental damage, such as trampling vegetation, disturbing bird and reptile nesting sites, and spreading exotic weeds.[9]

Research

First cloned buffalo

The world's first cloned buffalo was developed by Indian scientists from National Dairy Research Institute, Karnal. The buffalo calf was named Samrupa. The calf did not survive more than a week, and died due to some genetic disorders. So, the scientists created another cloned buffalo a few months later, and named it Garima. [18]

On 15 September 2007, the Philippines announced its development of Southeast Asia's first cloned buffalo. The Philippine Council for Agriculture, Forestry and Natural Resources Research and Development (PCARRD), under the Department of Science and Technology in Los Baños, Laguna approved this project. The Department of Agriculture's Philippine Carabao Center (PCC) will implement "Cloning through somatic cell nuclear transfer as a tool for genetic improvement in water buffaloes". "Super buffalo calves" will be produced. There will be no modification or alteration of the genetic materials, as in genetically modified organisms (GMOs).[19]

Super carabao

On 1 January 2008, the Philippine Carabao Center in Nueva Ecija, per Filipino scientists, initiated a study to breed a super water buffalo that could produce 4 to 18 litres of milk/day using gene-based technology. Also, the first in vitro river buffalo was born there in 2004 from an in vitro-produced, vitrified embryo, named "Glory" after President Gloria Macapagal-Arroyo. Joseph Estrada's most successful project as an opposition senator, the PCC was created through Republic Act 3707, the Carabao Act of 1992.[20]

In culture

Ceramic water buffalo from 2300 BCE found in Lopburi, Thailand
  • Legend has it that the Chinese philosophical sage Laozi left China through the Han Gu Pass riding a water buffalo.
  • According to Hindu lore, the god of death Yama, rides on a male water buffalo.
  • The carabao subspecies is considered a national symbol in the Philippines.
  • In Vietnam, water buffalo are often the most valuable possession of poor farmers: "Con trâu là đầu cơ nghiệp". They are treated as a member of the family: "Chồng cày, vợ cấy, con trâu đi bừa" ("The husband ploughs, the wife sows, water buffalo draws the rake") and are friends of the children. Children talk to their water buffalo, "Bao giờ cây lúa còn bông. Thì còn ngọn cỏ ngoài đồng trâu ăn." (Vietnamese children are responsible for grazing water buffalo. They will feed them a lot of grass if they work laboriously for men.) In the old days, West Lake, Hà Nội was named Kim Ngưu - Golden Water Buffalo.
  • The Yoruban Orisha Oya (goddess of change) takes the form of a water buffalo.

Some popular water buffalo festivals

Fighting festivals

An unstaged water buffalo fight
  • Moh juj Water Buffalo fighting[21] is held every year in Bhogali Bihu in Assam. Ahotguri in Nagaon is famous for it.
  • The Do Son Water Buffalo Fighting Festival of Vietnam,[22][23] held each year on the ninth day of the eighth month of the lunar calendar at Do Son Township, Haiphong City in Vietnam, is one of the most popular Vietnam festivals and events in Haiphong City. The preparations for this buffalo fighting festival begin from the two to three months earlier. The competing buffalo are selected and methodically trained months in advance. It is a traditional festival of Vietnam attached to a Water God worshipping ceremony and the Hien Sinh custom to show martial spirit of the local people of Do Son, Haiphong.
  • "Hai Luu" Water Buffalo Fighting Festival of Vietnam[24][25] According to ancient records, the buffalo fighting in Hai Luu Commune has existed from the 2nd century B.C. General Lu Gia at that time, had the buffalo slaughtered to give a feast to the local people and the warriors, and organized buffalo fighting for amusement. Eventually, all the fighting buffalo will be slaughtered as tributes to the deities.
  • "Ko Samui" Water Buffalo Fighting Festival of Thailand[26][27] is a very popular event held on special occasions such as New Year's Day in January, and Songkran in mid-April, this festival features head-wrestling bouts in which two male Asian water buffalo are pitted against one another. Unlike in Spanish Bullfighting, wherein bulls get killed while fighting sword-wielding men, Buffalo Fighting Festival held at Ko Samui, Thailand is fairly harmless contest. The fighting season varies according to ancient customs & ceremonies. The first Buffalo to turn and run away is considered the loser, the winning buffalo becomes worth several million baht. Ko Samui is an island in the Gulf of Thailand in the South China Sea, it is 700 km from Bangkok and is connected to it by regular flights.
  • "Ma'Pasilaga Tedong" Water Buffalo Fighting Festival in Tana Toraja Regency of Sulawesi Island, Indonesia is a very popular event where the Rambu Solo' or a Burial Festival took place in Tana Toraja. It is very attractive moment before the buffalo are being sacrified.

Racing festivals

Water buffalo racing at Babulang 2006
  • Chon Buri Water buffalo racing festival, Thailand:[28] Thousands of people flock to this entertainment in downtown Chonburi, 70 km (43 mi) south of Bangkok, at the annual water buffalo festival. About 300 buffalo race in groups of five or six, spurred on by bareback jockeys wielding wooden sticks, as hundreds of spectators cheer. The water buffalo has always played an important role in agriculture in Thailand. For farmers of Chon Buri Province, near Bangkok, it is an important annual festival, beginning in mid-October. It is also a celebration among rice farmers before the rice harvest. At dawn, farmers walk their buffalo through surrounding rice fields, splashing them with water to keep them cool before leading them to the race field. This amazing festival started over a hundred years ago when two men arguing about whose buffalo was the fastest ended up having a race between them. That’s how it became a tradition and gradually a social event for farmers who gathered from around the country in Chonburi to trade their goods. The festival also helps a great deal in preserving the number of buffalo, which have been dwindling at quite an alarming rate in other regions. Modern machinery is rapidly replacing buffalo in Thai agriculture. With most of the farm work mechanized, the buffalo-racing tradition has continued. Racing buffalo are now raised just to race; they do not work at all. The few farm buffalo which still do work are much bigger than the racers because of the strenuous work they perform. Farm buffalo are in the “Buffalo Beauty Pageant”, a Miss Farmer beauty contest and a comic buffalo costume contest etc.. This festival perfectly exemplifies a favored Thai attitude to life — "sanuk," meaning fun.
  • Babulang Water buffalo racing festival, Sarawak, Malaysia: Babulang is the largest or grandest of the many rituals, ceremonies and festivals of the traditional Bisaya (Borneo) community of Limbang, Sarawak. Highlights are the Ratu Babulang competition and the Water buffalo races which can only be found in this town in Sarawak, Malaysia.
  • Vihear Suor village Water buffalo racing festival, Cambodia:[29] Each year, millions of Cambodians visit Buddhist temples across the country to honor their deceased loved ones during a 15-day period commonly known as the Festival of the Dead but in Vihear Suor village, about 22 miles (35 km) northeast of the capital of Cambodia, Phnom Penh, citizens each year wrap up the festival with a water buffalo race to entertain visitors and honour a pledge made hundreds of years ago. There was a time when many village cattle which provide rural Cambodians with muscle power to plough their fields and transport agricultural products died from an unknown disease. The villagers prayed to a spirit to help save their animals from the disease and promised to show their gratitude by holding a buffalo race each year on the last day of “P'chum Ben” festival as it is known in Cambodian. The race draws hundreds of spectators who come to see riders and their animals charge down the racing field, the racers bouncing up and down on the backs of their buffalo, whose horns were draped with colorful cloth.
  • Karapan Sapi racing festival, Madura, Indonesia: The Maduranese people of the island of Madura, East Java, Indonesia, race their strongest and fastest buffalo in races hold regularly a few times a year, typically in August, September and October. It is a very popular spectacle in the towns of Pamekasan, Sampang, and Bangkalan. Besides the prize (and the pride that comes with it), buffalo that win a race are regarded very valuable and are a lot more expensive than their peers. This motivates the owners to feed their buffalo unusual cocktails of high calorie food composed of raw eggs, honey, and herbs, in addition to their regular training regimen, to give them the edge.
  • Kambala races, Karnataka, India: The Kambala water buffalo races of Karnataka, India take place between December and March. The races are conducted by having the water buffalo run in long parallel slushy ditches, where they are driven by men standing on wooden planks drawn by the buffaloes. The objectives of the race are to finish first and to raise the water to the greatest height.

See also

References

  1. ^ a b "Water Buffalo, An asset undervalued". United Nations Food and Agriculture Organization. 2000. http://www.aphca.org/publications/files/w_buffalo.pdf. Retrieved 2008-10-18. 
  2. ^ "IUCN Red list of threatened species". International Union for Conservation of Nature and Natural Resources. http://www.iucnredlist.org/search/details.php/3129/all. Retrieved 2009-02-02. 
  3. ^ SFU.ca
  4. ^ The IUCN Red list of threatened species classifies wild water buffalo (Bubalis arnee) as "Endangered"
  5. ^ Animal Info - Wild Asian buffalo - Status: Endangered; By: Paul Massicot
  6. ^ a b "Water buffalo". Encyclopaedia Britannica. http://www.britannica.com/EBchecked/topic/636991/water-buffalo. Retrieved 2009-05-19. 
  7. ^ Wanapat, M. et al. 2000. A comparative study on the rumen microbial population of cattle and swamp buffalo raised under traditional village conditions in the northeast of Thailand. Asian-Aust. J. Anim. Sci. 13: 918-921.
  8. ^ M. Wanapat (2001). "Swamp buffalo rumen ecology and its manipulation". Proceedings Buffalo Workshop. http://www.mekarn.org/procbuf/wanapat.htm. 
  9. ^ a b c Roth, J. and P. Myers (2004). "Bubalis Bubalis". University of Michigan Museum of Zoology Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Bubalus_bubalis.html#1ad6bbdabf14d37f5fd3dd0a26e19210. Retrieved 2008-10-18. 
  10. ^ Laboratory report: "In vitro production of cattle-water buffalo (Bos taurus - Bubalus bubalis) hybrid embryos"
  11. ^ a b c Sharp, Kerry, “Frontier to the Crossroads”, Outback Magazine, Issue 67, Oct/Nov 2009, Offset Alpine Printing
  12. ^ The Woodstock Water Buffalo Company
  13. ^ Sheikh PA, Merry FD, McGrath DG (2006). "Water buffalo and cattle ranching in the Lower Amazon Basin: Comparisons and conflicts." Agricultural Systems 87: 313–330 (Elsevier). Retrieved 2009-11-19.
  14. ^ McCance, Widdowson, Scherz, Kloos. [1][dead link]
  15. ^ Buffalo improve wildlife habitat - The Wildlife Trust of South and West Wales use the formidable beasts to help in conservation work at the 264-acre Teifi Marshes reserve; BBC, 15 February 2004
  16. ^ "Buffaloes and wetlands" -- grazing in wetland management: A discussion from the Ramsar Forum over late March 1998
  17. ^ "Buffalo improve wildlife habitat in Cambridgeshire". Natural England. 2008-01-24. http://www.naturalengland.org.uk/regions/east/press-releases/240108.htm. Retrieved 2008-08-10. 
  18. ^ Samrupa, World's first cloned buffalo calf from India. Retrieved from Topinews.com
  19. ^ Hicap, Jonathan M. (17 September 2007). "RP to produce Southeast Asia`s first cloned buffalo". http://greenbio.checkbiotech.org/news/rp_produce_southeast_asias_first_cloned_buffalo. 
  20. ^ Uy, Jocelyn (2007-12-31). "'Super carabao' making the scene in year of the rats". http://newsinfo.inquirer.net/inquirerheadlines/nation/view/20071231-109740/Super_carabao_making_the_scene_in_year_of_the_rats. 
  21. ^ Dutta, Pullock (12 January 2008). "Bonfire, feast & lots more". The Telegraph (Calcutta, India). http://www.telegraphindia.com/1080112/jsp/northeast/story_8771062.jsp. Retrieved 2008-01-19. 
  22. ^ Do Son: buffalo fighting festival (Vietnam), 14 September 2005, VietNamNet Bridge
  23. ^ Do Son Buffalo Fighting Festival Vietnam, Asiarooms.com
  24. ^ Buffalo Fighting in Hai Luu Commune, Vietnam News Agency
  25. ^ VIDEO on YouTube:Water Buffalo-fighting festival: Buffalo-fighting festival is annually held on the 15th of the lunar two month in Hai Luu (Vinhphuc City). It results in this saying: "Go everywhere you want, but come back on the 15th of the lunar two month to attend the buffalo-fighting festival". Eventually, all those fighting buffalo are slaughtered as tributes to the deities.
  26. ^ Buffalo Fighting Festival Ko Samui, asiarooms.com
  27. ^ Buffalo Fighting Festival, Koh Samui Festivals & Events, Thailand. Hotel and Travel Links Co. Ltd. Thailand
  28. ^ Buffalo Racing, Thailand, thailand-guide.org (p) some content provided by Tourism Authority of Thailand, Last Updated : 1 July 2007; Watching the Buffalo Racing, by Panrit "Gor" Daoruang, 14 October 2003, Thailand Life; Running of the buffalo: Thais take their beasts of burden to the races; by: Alisa Tang, Associated Press Writer; Buffalo Racing, The lowdown by Aliwyn Cole, 1 August 2005, Urban Lowdown; "Running with the Buffalo", originally published in the Learning Post, a supplement of the Bangkok Post
  29. ^ Buffalo Racing in Cambodia, 27 September 2006
  30. ^ "Bull race held at Kaakkoor peacefully". The Hindu (Chennai, India). 27 February 2004. http://www.hindu.com/2004/02/27/stories/2004022702250500.htm. 
  31. ^ "'Maramadi' winners". The Hindu (Chennai, India). 27 February 2004. http://www.hindu.com/2004/02/27/stories/2004022702240500.htm. 
  • Clutton-Brock, J. 1999. A Natural History of Domesticated Mammals. Cambridge UK : Cambridge University Press. ISBN 0-521-63495-4.
  • Guinness Book of Records, 2005
  • Huffman, B. 2006. The ultimate ungulate page. UltimateUngulate.com.
  • International Union for Conservation of Nature and Natural Resources (IUCN). 2006. Syncerus caffer, Bubalus bubalis, Bubalus quarlesi, Bubalus depressicornis Bubalus mindorensis.
  • Ligda, D.J. 1996. The Water Buffalo. Website. Netnitco.net
  • Massicot, P. 2004. Animal Info. Website Wild Asian (Water) Buffalo
  • Nowak, R.M. and Paradiso, J.L. 1983. Walker's Mammals of the World. Baltimore, Maryland, USA: The Johns Hopkins University Press. ISBN 0-8018-2525-3
  • Olson, T.J. 2006. Turkey Creek Water Buffalo Valornet.com The best buffalo pictures!
  • Voelker, W. 1986. The Natural History of Living Mammals. Medford, New Jersey, USA: Plexus Publishing, Inc. ISBN 0-937548-08-1.
  • Roth, J. and P. Myers. "Bubalis Bubalis", University of Michigan Museum of Zoology Animal Diversity Web. Retrieved on 15 January 2009
  • Fahimuddin, M. 1989. Domestic Water Buffalo. Janpath, New Delhi: Oxford & IBH Publishing Co. Pvt. Ltd. ISBN 81-204-0402-5.
  • The Water Buffalo: New Prospects For An Underutilized Animal. Washington, D.C. 1981. National Academy Press. ISBN 8183416.
  • Wilson, D.E. and Reeder, D.M. 1993. Mammal Species of the World, Second Edition, A Taxonomic and Geographic Reference.Smithsonian Institution.

Further reading

  • Ruangprim, T. et al.2007. rumen microbes and ecology of male dairy, beef cattle and buffaloes. In Proc. Animal Science Annual Meeting, Khon Kaen University, Khon Kaen 40002,Thailand.
  • Thu, Nguyen Van and T.R. Preston. 1999. Rumen environment and feed degradability in swamp buffaloes fed different supplements. Livestock Research for Rural Development 11(3)
  • Wanapat, M. 2000. Rumen manipulation to increase the efficient use of local feed resources and productivity of ruminants in the tropics. Asian-Aust. J. Anim. Sci. 13(Suppl.):59-67.
  • Wanapat, M. and P. Rowlinson. 2007. Nutrition and feeding of swamp buffalo: Feed resources and rumen approach. Paper to be presented at the VIII World Buffalo Congress, 19–22 October 2007, Caserta, Italy, organized by The International Buffalo Federation.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!