Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Domestic sheep (Ovis aries) have long been important to humans for their milk, meat, and wool. In 2000, the United Nations Food and Agriculture Organization (FAO) compiled a list of recognized breeds of domesticated mammals which included 1495 breeds of sheep (tallies from other sources may differ, but the number is clearly in the hundreds) (Scherf 2000 cited in Groves and Leslie 2011).

The origins of domestic sheep are not well known. It is generally believed that sheep domestication occurred shortly after goat domestication (probably 7000 to 10000 years ago) and in the same region, the Fertile Crescent of the Middle East. Genetic studies have not yet provided a clear indication of the wild ancestors of modern domestic sheep, although progress has made in addressing this question. Groves and Leslie (2011) suggest that the Anatolian Sheep or Asiatic Mouflon (Ovis gmelini) is likely the ancestor of domestic sheep and that European Mouflon, sometimes referred to as O. musimon or O. orientalis musimon, are the feral descendants of the first domestic sheep brought to Europe. The name O. aries is often used to refer only to domestic sheep, but has also been used more broadly, depending on which forms are recognized as distinct species--for example, including mouflon as well (see Rezaei et al. 2010 and Groves and Leslie 2011).

In some areas, such as parts of Australia and the United States, overgrazing by domestic sheep has caused great ecological damage. In addition, transmission of diseases to wild relatives such as the Bighorn Sheep (Ovis canadensis) of North America have resulted in significant mortality.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Domestic sheep live worldwide in association with humans. The first domesticated sheep resided mainly in the Middle East and Central Asia but since then have been introduced everywhere.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Unknown

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Southern and eastern Turkey, Armenia, southern Azerbaijan, northern Iraq, and western Iran; domesticated worldwide; primitive domestic populations (mouflon) are feral on Corsica, Cyprus, and Sardinia, introduced from there to Europe, Crimea, U.S. (including Hawaii), Chile, Kerguelen Islands, Tenerife (Canary Islands), St. Kilda and other small islands off the British Isles; improved domestic stock is feral in Norway, Sweden, U.S., islands off the coasts of British Isles and New Zealand, Kerguelen Islands, and probably other oceanic islands (Grubb, in Wilson and Reeder 1993). Few populations of wild sheep remain in Eurasia, but domestic sheep occur worldwide in association with humans. Feral populations are firmly established on Hawaii, principally on Mauna Kea and Hualalai; mainly at 600-3950 m; formerly on other islands and more widespread on Hawaii (Tomich 1986); mouflon ("OVIS MUSIMON") occur on western Lanai and on the Big Island (Hawaii) on Mauna Loa and among other feral sheep on Mana Kea (Tomich 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Cyprus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The physical details of domestic sheep vary greatly among breeds. Head and body length is 1,200-1,800 mm and shoulder height is 650-1,270 mm. Female sheep tend to be three quarters to two thirds the size of males. Wild sheep have tails between 70-150 mm but in domestic sheep tails may be larger and used as a fat reserve, although these long tails are removed on most commercial farms. Sheep have a vertical cleft and narrow snout completely covered with short hair except on the margins of the nostrils and lips. The genus Ovis is characterized by the presence of glands situated in a shallow depression in the lacrimal bone, the groin area, and between the two main toes of the foot. These glands secrete a clear semi-fluid substance that gives domestic sheep their characteristic smell. The skulls of domesticated sheep differ from those of wild sheep in that the eye socket and brain case are reduced. Selection for economically important traits has produced domestic sheep with or without wool, horns, and external ears. Coloration ranges from milky white to dark brown and black. There is considerable diversity among the over 200 distinct breeds of sheep. For details on a specific breeds consult   http://pc200.anmsci.okstate.edu/BREEDS/SHEEP.

Range mass: 20 to 200 kg.

Range length: 120 to 180 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Domestic sheep are extremly versitile and exist in a wide variety of habitats worldwide ranging from temperate mountain forests to desert conditions. (Grzimek 1990, MacDonald 1984)

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Mouflon in Hawaiian Islands: rugged ridges and gullies sloping westward to sea on Lanai; in scrub habitat at 1200-2400 m on Mauna Loa (Tomich 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Domestic sheep are extremely hardy animals and can survive on a diet consisting of only cellulose, starch or sugars as an energy source and a nitrogen source which need not be protein. In general, sheep feed mainly on grasses while in pastures and can be fed a wide variety of hays and oats. Considerable research has been done on sheep nutritional requirements, and feed substitution tables are present in Ensminger's 1965 "The Stockman's Handbook". Grazing sheep ingest a large amount of food in a short time, then retire to rest and rechew the ingested matter. Sheep spend their day alternating between these periods of grazing and ruminating. Ovis aries has a large and complex stomach which is able to digest highly fibrous foods that can not be digested by many other animals. Its modest nutritional requirements contribute to its economic significance.(Hecker 1983, Ensminger 1965)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / dung/debris feeder
larva of Aphodius borealis feeds on dung/debris dung of Ovis aries
Other: major host/prey

Plant / resting place / within
imago of Aphodius coenosus may be found in dung of Ovis aries

Plant / resting place / within
imago of Aphodius erraticus may be found in dung of Ovis aries
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius haemorrhoidalis feeds on dung/debris dung of Ovis aries
Other: major host/prey

Animal / dung/debris feeder
larva of Aphodius lapponum feeds on dung/debris dung of Ovis aries
Other: major host/prey

Plant / resting place / within
imago of Aphodius lividus may be found in dung of Ovis aries

Animal / dung/debris feeder
larva of Aphodius luridus feeds on dung/debris dung of Ovis aries

Plant / resting place / within
imago of Aphodius nemoralis may be found in dung of Ovis aries
Other: minor host/prey

Plant / resting place / within
imago of Aphodius obliteratus may be found in dung of Ovis aries

Plant / resting place / within
imago of Aphodius putridus may be found in dung of Ovis aries

Animal / dung/debris feeder
larva of Aphodius quadrimaculatus feeds on dung/debris dung of Ovis aries
Other: sole host/prey

Animal / dung/debris feeder
larva of Aphodius scrofa feeds on dung/debris dung of Ovis aries
Other: major host/prey

Animal / dung saprobe
perithecium of Arnium hirtum is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung/debris feeder
gymnothecium of Arthroderma uncinatum feeds on dung/debris woollen of cloth of Ovis aries

Animal / dung saprobe
apothecium of Ascobolus albidus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
apothecium of Ascobolus degluptus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
sessile apothecium of Ascobolus equinus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
apothecium of Ascobolus immersus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
apothecium of Ascobolus perplexans is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
apothecium of Ascobolus roseopurpurascens is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
apothecium of Ascobolus stictoideus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
solitary or gregarious apothecium of Ascodesmis nigricans is saprobic in/on dung or excretions of dung of Ovis aries

Animal / pathogen
Blue Tongue virus (BTV) infects Ovis aries
Other: major host/prey

Animal / dung saprobe
basally immersed, mostly densely clustered perithecium of Cercophora coprophila is saprobic in/on dung or excretions of dung of Ovis aries
Other: minor host/prey

Animal / dung saprobe
basally immersed, scattered or in small groups perithecium of Cercophora mirabilis is saprobic in/on dung or excretions of dung of Ovis aries
Other: minor host/prey

Animal / dung saprobe
perithecium of Chaetomium globosum is saprobic in/on dung or excretions of dung of Ovis aries
Other: unusual host/prey

Animal / dung saprobe
sessile apothecium of Cheilymenia raripila is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
fruitbody of Coprinopsis filamentifer is saprobic in/on dung or excretions of weathered dung of Ovis aries

Animal / dung saprobe
fruitbody of Coprinopsis utrifer is saprobic in/on dung or excretions of weathered dung of Ovis aries
Other: major host/prey

Animal / dung saprobe
fruitbody of Coprinopsis vermiculifer is saprobic in/on dung or excretions of weathered dung of Ovis aries
Other: major host/prey

Animal / dung saprobe
sessile apothecium of Coprotus granuliformis is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
sessile apothecium of Coprotus lacteus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
pseudothecium of Delitschia canina is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
pseudothecium of Delitschia patagonica is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
pseudothecium of Delitschia winteri is saprobic in/on dung or excretions of dung of Ovis aries
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
Dermacentor reticulatus sucks the blood of Ovis aries

Animal / parasite / endoparasite
fluke of Dicrocoelium lanceolatum endoparasitises liver of Ovis aries

Animal / parasite / endoparasite
hydatid cyst of Echinococcus granulosus endoparasitises brain of Ovis aries

Animal / dung saprobe
apothecium of Fimaria theioleuca is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung/debris feeder
larva of Geotrupes vernalis feeds on dung/debris buried dung of Ovis aries

Animal / parasite / ectoparasite / blood sucker
Haemaphysalis punctata sucks the blood of Ovis aries

Animal / dung saprobe
immersed perithecium of Hypocopra merdaria is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
apothecium of Iodophanus carneus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / parasite / ectoparasite / blood sucker
Ixodes canisuga sucks the blood of Ovis aries

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Ovis aries

Animal / pathogen
Louping Ill virus infects Ovis aries

Animal / parasite / ectoparasite
larva of Lucilia sericata ectoparasitises wound of Ovis aries

Plant / resting place / within
larva of Melophagus ovinus may be found in wool of Ovis aries
Other: sole host/prey

Animal / dung saprobe
effuse colony of Monodictys dematiaceous anamorph of Monodictys asperospora is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
sporangiophore of Mucor saturninus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
fruitbody of Mycocalia denudata is saprobic in/on dung or excretions of wet, weathered dung of Ovis aries

Plant / resting place / under
imago of Odonteus armiger may be found under dry dung of Ovis aries

Animal / dung/debris feeder
larva of Onthophagus joannae feeds on dung/debris buried dung of Ovis aries

Animal / dung/debris feeder
larva of Onthophagus similis feeds on dung/debris buried dung of Ovis aries

Animal / dung/debris feeder
larva of Onthophagus vacca feeds on dung/debris buried dung of Ovis aries

Animal / dung saprobe
ascoma of Onygena corvina is saprobic in/on dung or excretions of wool of Ovis aries
Other: major host/prey

Animal / carrion / dead animal feeder
ascoma of Onygena equina feeds on dead hoof of Ovis aries

Animal / dung saprobe
fruitbody of Panaeolus semiovatus var. phalaenarum is saprobic in/on dung or excretions of weathered dung of Ovis aries
Other: major host/prey

Animal / dung saprobe
fruitbody of Panaeolus subfirmus is saprobic in/on dung or excretions of weathered dung of Ovis aries

Animal / dung saprobe
immersed perithecium of Phomatospora coprophila is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
sporangiophore of Pilobolus crystallinus var. kleinii is saprobic in/on dung or excretions of dung of Ovis aries

Animal / pathogen
confluent Pithomyces dematiaceous anamorph of Pithomyces chartarum infects live face of Ovis aries

Animal / dung saprobe
partly immersed perithecium of Podospora intestinacea is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
mostly crowded apothecium of Podospora myriospora is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
partly immersed perithecium of Podospora pauciseta is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
partly immersed perithecium of Podospora setosa is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
effuse colony of Oedocephalum anamorph of Pyronema omphalodes is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
perithecium of Pyxidiophora microspora is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
sporangiophore of Rhopalomyces magnus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
scattered, often immersed apothecium of Ryparobius dubius var. dubius is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
solitary, superficial, sessile apothecium of Saccobolus caesariatus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus citrinus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
scattered or gregarious, superficial, sessile apothecium of Saccobolus depauperatus is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
solitary or gregarious, superficial, sessile apothecium of Saccobolus glaber is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
perithecium of Schizothecium hispidulum is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
stromatic perithecium of Selinia pulchra is saprobic in/on dung or excretions of dung of Ovis aries

In Great Britain and/or Ireland:
Animal / dung/debris feeder
fruitbody of Sistotrema coronilla feeds on dung/debris old, discarded wool of blanket of Ovis aries
Other: unusual host/prey

Animal / dung saprobe
mostly grouped perithecium of Sordaria lappae is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
superficial, frequently gregarious perithecium of Sphaerodes fimicola is saprobic in/on dung or excretions of dung of Ovis aries
Other: major host/prey

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella australis is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella grandispora is saprobic in/on dung or excretions of dung of Ovis aries

Animal / dung saprobe
mostly immersed pseudothecium of Sporormiella pulchella is saprobic in/on dung or excretions of dung of Ovis aries

Foodplant / saprobe
fruitbody of Stropharia semiglobata is saprobic on dung of Ovis aries
Other: major host/prey

Animal / parasite / endoparasite
Cysticercus larva of Taenia hydatigena endoparasitises body cavity of Ovis aries

Animal / parasite / endoparasite
Coenurus larva of Taenia multiceps endoparasitises brain of Ovis aries

Animal / parasite / endoparasite
Cysticercus larva of Taenia ovis endoparasitises muscle of Ovis aries

Animal / parasite / endoparasite
larva of Toxocara canis endoparasitises tissue of Ovis aries

Animal / parasite / endoparasite
cyst of Toxocara cati endoparasitises body cavity of lamb of Ovis aries

Animal / associate
imago of Typhaeus typhoeus is associated with dung of Ovis aries

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Population on Hirta (St. Kilda) exhibits marked and persistent instability in population size (600-1600 individuals); high mortality occurs in winter, due mainly to starvation (Clutton-Brock et al. 1991).

Mouflon in Hawaii: travels generally in small groups, sometimes forms herds of more than 100 (Tomich 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
22.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.8 years (captivity) Observations: Domestic sheep exhibit gradual senescence. The onset of reproductive senescence has been shown to occur at 5 and 6 years of age (Mysterud et al. 2002). One captive specimen lived 22.8 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ovis aries breeds on a seasonal basis, determined by day length, with females (ewes) first becoming fertile in the early fall and remaining fertile through midwinter. Estrus cycles range between 14 and 20 days with 17 as the average. Females are in heat on average for 30 hours. Males (rams) are fertile year round and most domestic sheep breeders use 1 ram to 25 to 35 ewes. Gestation averages 148 days with most lambs born in mid spring. One or two lambs, which are able to stand and suckle within a few minutes of birth, are born to each ewe. Both male and female lambs reach sexual maturity within one year. (Ensminger 1965)

Range number of offspring: 1 to 2.

Average number of offspring: 1.3.

Average gestation period: 5.03 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual

Average birth mass: 2370 g.

Average gestation period: 146 days.

Average number of offspring: 1.58.

Average age at sexual or reproductive maturity (male)

Sex: male:
914 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
548 days.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds year round in Hawaii, with a peak in late winter-early spring and a lesser peak in late summer. Gestation lasts around 150 days. May attain sexual maturity within one year. Litter size 1-2. One or two litters/year. Litter size and frequency of litters are minimal in females breeding as yearlings(Kramer 1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Underhairs provide insulation: Merino sheep
 

The wool of Merino sheep forms an insulating layer via underhair that creates hundreds of trapped air pockets.

       
  "Generally a dense coat of underhairs, as in the wool of a sheep, is particularly effective in temperature control, because hundreds of tiny air pockets become trapped among the hairs and make an insulating layer between animal and climate. Sheep with thick wool, such as the merinos of Australia, can stay warm in freezing weather and, conversely, stay cool in the heat of summer. In both cases the difference between the temperature at the skin and on the wool surface (a distance of 8 cm) may be 40˚C or more. In animals with less thick coats, simply erecting the hair increases the resistance to cold." (Foy and Oxford Scientific Films 1982:84)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ovis aries

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGCTGATTATTTTCAACCAACCACAAAGATATCGGCACCCTTTACCTTCTATTTGGTGCCTGAGCTGGTATAGTAGGAACCGCCTTAAGCCTACTAATTCGCGCCGAACTAGGCCAACCCGGAACTCTACTCGGAGATGACCAAATCTACAACGTAATTGTAACCGCACATGCATTTGTAATAATTTTCTTTATAGTAATGCCTATTATAATCGGTGGATTCGGCAACTGACTAGTTCCTCTGATAATTGGAGCCCCTGATATAGCATTTCCTCGGATAAATAACATAAGCTTTTGACTTCTTCCCCCATCTTTCCTGTTACTCCTAGCATCCTCTATGGTTGAGGCCGGAGCAGGAACAGGTTGAACCGTATACCCTCCTCTAGCAGGCAACCTAGCCCATGCAGGAGCCTCAGTAGATCTAACTATTTTCTCCCTACATCTGGCAGGTGTCTCTTCAATTCTAGGAGCCATTAATTTTATTACAACTATTATTAATATAAAACCCCCTGCGATGTCACAGTATCAAACCCCCTTGTTTGTATGATCTGTACTAATTACTGCCGTACTTCTCCTTCTCTCACTTCCTGTATTAGCAGCTGGTATCACAATACTACTAACGGACCGAAACCTGAATACAACCTTTTTTGACCCAGCAGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTCTTTGGGCACCCTGAAGTATATATTCTTATTTTACCTGGGTTTGGGATAATCTCCCATATTGTGACCTACTATTCAGGAAAAAAAGAACCATTCGGATATATAGGAATAGTATGAGCCATAATATCAATTGGGTTCCTAGGATTCATTGTATGAGCCCACCATATATTCACAGTCGGAATAGACGTCGATACACGGGCTTACTTCACGTCAGCTACTATAATTATCGCCATCCCAACAGGAGTAAAAGTATTCAGTTGACTAGCAACGCTTCATGGGGGTAATATCAAATGATCTCCTGCCATAATATGAGCCCTAGGTTTCATCTTTCTTTTCACAGTCGGAGGCTTAACTGGAATTGTTCTAGCCAACTCCTCCCTTGACATTGTCCTCCATGACACATATTATGTAGTAGCACATTTCCACTACGTATTATCAATAGGAGCTGTATTTGCTATTATAGGAGGATTTGTACATTGATTTCCCCTATTCTCAGGCTATACTCTCAATGATACATGAGCCAAAATCCACTTTGCAATTATATTTGTAGGTGTTAACATGACTTTCTTTCCACAACATTTCCTAGGACTATCCGGTATACCACGACGATACTCTGATTATCCAGACGCATATACAATATGAAATACTATCTCATCTATAGGCTCATTTATCTCACTAACAGCAGTAATACTAATAATCTTCATCATCTGAGAAGCATTTGCATCTAAACGAGAAGTCCTAACTGTAGACCTAACCACAACAAACCTAGAATGACTAAACGGATGTCCTCCACCATACCACACATTTGAAGAACCCACATATGTTAACCTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ovis aries

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 41
Specimens with Barcodes: 57
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The world population of domestic sheep has steadly increased since their domestication and the world sheep population totals over a billion sheep.

US Federal List: no special status

CITES: appendix i; no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Ovis aries, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Ovis aries has no adverse effects on human populations. The proliferation of domestic sheep, though, has adversely effected populations of their wild relatives through competition for forage and the spread of disease.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ovis aries is one of the most economically significant species on the planet. Since their domestication between 9000 and 11000 years ago they have been a source of meat, milk, wool and hides in nearly every country. In some cultures sheep are considered highly useful as a sacrificial animal. The versatility of the species contributes to its economic significance as large herds of animals can be maintained in many environments at relatively low costs. Besides their usefulness in an agricultural sense, sheep have become important as a tool for scientific research. Because of their large size and low maintenance costs they make an ideal model for a great deal of scientific research.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Feral sheep, including mouflon, have been hunted in Hawaii, but management as game species is incompatible with protection of native ecosystems (see Tomich 1986). Feral populations that are ecologically undesirable may nevertheless include potentially valuable genetic traits (Van Vuren and Hedrick 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Has been a serious pest in Hawaii where it is destructive to mamane (SOPHORA) trees and thus incompatible with protection of habitat for palila and other endemic birds (Scott et al. 1984); control measures in the early 1980s reduced the population to a low level (Tomich 1986). Also has caused ecological damage on Santa Cruz Island, California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Polled Dorset

Not to be confused with Poll Dorset.

The Polled Dorset is a breed of sheep developed for meat at the North Carolina State University Small Ruminant Unit in 1956. The name refers to the fact that it is a hornless variation of the Horned Dorset breed. The Polled Dorset is the result of a genetic mutation by which some of the offspring of a certain ram grew no horns. After some years of breeding work, a strain of Dorset was developed which had lost the characteristic horns and which bred true.

Polled Dorsets are an all-white, medium-sized sheep, prolific and able to breed out of season. The carcases are muscular with good conformation and the adults produce a thick fleece, which is free from dark fibers. Since its development, the number of Polled Dorsets registered in the United States has grown to exceed the number of Horned Dorsets. Without horns the sheep are easier to handle and there is much less risk of the rams hurting themselves or others by butting. The Polled Dorset is sometimes confused with the Australian Poll Dorset, but that breed did not start as a genetic mutation but resulted from the introduction of Corriedale and Ryeland blood into the Dorset breeding program.

History[edit]

In 1949, four hornless lambs were sired from a Horned Dorset on a farm at North Carolina State University in Raleigh, North Carolina. Over the next five years, as part of their normal breeding program, those four ewes and the other ewes on the farm were bred to the Horned Dorset. Eventually, a ewe gave birth to twin rams. NCSU 401 was a regular horned Dorset, but his brother, "NCSU 402", was born polled, without horns, due to a genetic mutation. Thus, the Polled Dorset was born.[1] NCSU 402 was the official name given to the first true Polled Dorset sheep. It was named in accordance with the naming system that has been used at the NCSU Small Ruminant Unit since it started its breeding program.

After research and testing were done to confirm that the Polled Dorset carried the same characteristics as the Horned Dorset and was able to pass on these traits, the Continental Dorset Club, formed in 1898, registered the very first Polled Dorset sheep in 1956.[2][3] Livestock scientists, the late Dr. Lemuel Goode and the late Sam Buchanan, are credited with identifying and developing the hornless sheep. The offspring of NCSU 402 were bought by other breeders and within twenty years, seventy percent of all registered Dorsets were polled. The success of the Polled Dorset has made it considered to be the second most popular sheep breed in the United States.[1] A polled strain of Dorsets were also developed in Australia in the 1900s,[3] however, these were not as a result of a genetic mutation but resulted from the introduction of Corriedale and Ryeland blood into the Dorset Horn.[2]

Conformation[edit]

A Polled Dorset ewe and her lambs at a North Carolina State University farm

Polled Dorsets are a medium-sized sheep that are long lived and prolific, heavy milkers. They produce hardy lambs with moderate growth and maturity that yield heavily muscled carcasses.[4] Their fleece is very white, strong, close, free from dark fiber and extends down the legs. When shorn, fleece averages between five and nine pounds (2.23 to 4 kg) in ewes and fifty to seventy percent of their fleece can be used.[5] The staple length ranges from 2.5 to 4 inches (6 to 10 cm) with a numeric count of 46's-58's. The fiber diameter ranges from 27.0 to 33.0 microns. At maturity, ewes weigh between 150 and 200 pounds (67 to 91 kg), some weighing more in show condition. Mature rams range in weight from 225 to 275 pounds (102 to 125 kg). Dorsets are noted for their ability to be bred more than once per year and are commonly used in crossbreeding to produce females for out-of-season breeding.[4] They are one of the few breeds that have this characteristic. Multiple births are common and they work well in commercial operations, including programs where rams are specifically used to sire lambs for slaughter. These rams are known as terminal sires since their genetics are more suitable for slaughter than breeding purposes.[5]

Since the breed first became commercial, it has spread to Canada and become a major contributor in the commercial lamb industry. The breed adapts well to confinement and is readily used in accelerated crossbreeding programs. Polled Dorsets thrive under grass-based and feedlot conditions and are more suitable on small farms that are intensely managed.[6]

Polled versus Horned Dorsets[edit]

The Dorset is an ancient breed that was most likely developed from horned sheep that lived in the valleys and pastures of southwestern England. Dorset Horn sheep were imported into the United States in 1860, and the first U.S. national flock book was formed in 1891.[7] Today, the Dorset is found in two varieties globally, Horned and Polled. In the Horn variety, both ewes and rams have horns, while the polled variety have no horns at all. Polled Dorsets are ideal for commercial settings because they do not have horns that can get caught in fencing or cause damage when they butt.[2]

Polled Dorsets are the most popular white-faced breed in North America,[citation needed] while the much less-common Dorset Horn is listed as "threatened" by The Livestock Conservancy in the United States.[2] In essence, the difference between the two breeds is that one has horns and the other does not.[8]

References[edit]

  1. ^ a b "Monument dedicated to sheep, scientists". Perspectives: The Magazine of the College of Agriculture and Life Sciences 1 (1). Winter 1999. 
  2. ^ a b c d "Dorset Horn Sheep", livestockconservancy.org (The Livestock Conservancy), retrieved 2013-09-02 
  3. ^ a b Carol Ekarius (2008), Storey's Illustrated Breed Guide to Sheep, Goats, Cattle and Pigs: 163 Breeds from Common to Rare, Storey Pub., pp. 236–237, ISBN 978-1-60342-036-5 
  4. ^ a b "Meat Breeds: Dorset (Polled and Horned)". American Sheep Industry Association. Retrieved May 30, 2013. 
  5. ^ a b "Dorsets Horned and Polled". Oklahoma State University Department of Animal Science. Retrieved May 30, 2013. 
  6. ^ "Polled Dorset". Canadian Cooperative Wool Growers. Retrieved May 30, 2013. 
  7. ^ Janet Vorwald Dohner (2001), The Encyclopedia of Historic and Endangered Livestock and Poultry Breeds, Yale University Press, pp. 108–110, ISBN 978-0-300-13813-9 
  8. ^ "Dorset Horn". SVF Foundation. May 30, 2013. 

Further reading[edit]

  • Barrell, G. K.; Lapwood, K. R. (1979). "Seasonality of semen production and plasma luteinizing hormone, testosterone and prolactin levels in Romney, Merino and polled dorset rams". Animal Reproduction Science 1 (3): 213. doi:10.1016/0378-4320(79)90003-4.  edit
  • Pritchard, D. H.; Napthine, D. V.; Sinclair, A. J. (1980). "Globoid Cell Leucodystrophy in Polled Dorset Sheep". Veterinary Pathology 17 (4): 399–405. doi:10.1177/030098588001700402. PMID 7385575.  edit
  • Bowman, J. C.; Hendy, C. R. C. (2010). "A study of retail requirements and genetic parameters of carcass quality in polled dorset horn sheep". Animal Production 14 (2): 189. doi:10.1017/S0003356100010874.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Sheep

For other uses, see Sheep (disambiguation).

Sheep (Ovis aries) are quadrupedal, ruminant mammals typically kept as livestock. Like all ruminants, sheep are members of the order Artiodactyla, the even-toed ungulates. Although the name "sheep" applies to many species in the genus Ovis, in everyday usage it almost always refers to Ovis aries. Numbering a little over one billion, domestic sheep are also the most numerous species of sheep. An adult female sheep is referred to as a ewe (/juː/), an intact male as a ram or occasionally a tup, a castrated male as a wether, and a younger sheep as a lamb.

Sheep are most likely descended from the wild mouflon of Europe and Asia. One of the earliest animals to be domesticated for agricultural purposes, sheep are raised for fleece, meat (lamb, hogget or mutton) and milk. A sheep's wool is the most widely used animal fiber, and is usually harvested by shearing. Ovine meat is called lamb when from younger animals and mutton when from older ones. Sheep continue to be important for wool and meat today, and are also occasionally raised for pelts, as dairy animals, or as model organisms for science.

Sheep husbandry is practised throughout the majority of the inhabited world, and has been fundamental to many civilizations. In the modern era, Australia, New Zealand, the southern and central South American nations, and the British Isles are most closely associated with sheep production.

Sheepraising has a large lexicon of unique terms which vary considerably by region and dialect. Use of the word sheep began in Middle English as a derivation of the Old English word scēap; it is both the singular and plural name for the animal. A group of sheep is called a flock, herd or mob. Many other specific terms for the various life stages of sheep exist, generally related to lambing, shearing, and age.

Being a key animal in the history of farming, sheep have a deeply entrenched place in human culture, and find representation in much modern language and symbology. As livestock, sheep are most often associated with pastoral, Arcadian imagery. Sheep figure in many mythologies—such as the Golden Fleece—and major religions, especially the Abrahamic traditions. In both ancient and modern religious ritual, sheep are used as sacrificial animals.

Description and evolution[edit]

A sheep's skull

Domestic sheep are relatively small ruminants, usually with a crimped hair called wool and often with horns forming a lateral spiral. Domestic sheep differ from their wild relatives and ancestors in several respects, having become uniquely neotenic as a result of selective breeding by humans.[1][2] A few primitive breeds of sheep retain some of the characteristics of their wild cousins, such as short tails. Depending on breed, domestic sheep may have no horns at all (i.e. polled), or horns in both sexes, or in males only. Most horned breeds have a single pair, but a few breeds may have several.[3]

Another trait unique to domestic sheep as compared to wild ovines is their wide variation in color. Wild sheep are largely variations of brown hues, and variation within species is extremely limited. Colors of domestic sheep range from pure white to dark chocolate brown and even spotted or piebald.[4][5] Selection for easily dyeable white fleeces began early in sheep domestication, and as white wool is a dominant trait it spread quickly. However, colored sheep do appear in many modern breeds, and may even appear as a recessive trait in white flocks.[4][5] While white wool is desirable for large commercial markets, there is a niche market for colored fleeces, mostly for handspinning.[6] The nature of the fleece varies widely among the breeds, from dense and highly crimped, to long and hairlike. There is variation of wool type and quality even among members of the same flock, so wool classing is a step in the commercial processing of the fibre.

Suffolks are a medium wool, black-faced breed of meat sheep that make up 60% of the sheep population in the U.S.[7]

Depending on breed, sheep show a range of heights and weights. Their rate of growth and mature weight is a heritable trait that is often selected for in breeding.[7] Ewes typically weigh between 45 and 100 kilograms (99 and 220 lb), and rams between 45 and 160 kilograms (99 and 353 lb).[8] When all deciduous teeth have erupted, the sheep has 20 teeth.[9] Mature sheep have 32 teeth. As with other ruminants, the front teeth in the lower jaw bite against a hard, toothless pad in the upper jaw. These are used to pick off vegetation, then the rear teeth grind it before it is swallowed. There are eight lower front teeth in ruminants, but there is some disagreement as to whether these are eight incisors, or six incisors and two incisor-shaped canines. This means that the dental formula for sheep is either 0.0.3.34.0.3.3 or 0.0.3.33.1.3.3 [10] There is a large diastema between the incisors and the molars.

For the first few years of life it is possible to calculate the age of sheep from their front teeth, as a pair of milk teeth is replaced by larger adult teeth each year, the full set of eight adult front teeth being complete at about four years of age. The front teeth are then gradually lost as sheep age, making it harder for them to feed and hindering the health and productivity of the animal. For this reason, domestic sheep on normal pasture begin to slowly decline from four years on, and the average life expectancy of a sheep is 10 to 12 years, though some sheep may live as long as 20 years.[3][11][12]

Sheep have good hearing, and are sensitive to noise when being handled.[13] Sheep have horizontal slit-shaped pupils, possessing excellent peripheral vision; with visual fields of approximately 270° to 320°, sheep can see behind themselves without turning their heads.[6][14] Many breeds have only short hair on the face, and some have facial wool (if any) confined to the poll and or the area of the mandibular angle; the wide angles of peripheral vision apply to these breeds. A few breeds tend to have considerable wool on the face; for some individuals of these breeds, peripheral vision may be greatly reduced by "wool blindness", unless recently shorn about the face.[15] Sheep have poor depth perception; shadows and dips in the ground may cause sheep to baulk. In general, sheep have a tendency to move out of the dark and into well lit areas,[16] and prefer to move uphill when disturbed. Sheep also have an excellent sense of smell, and, like all species of their genus, have scent glands just in front of the eyes, and interdigitally on the feet. The purpose of these glands is uncertain,[17] but those on the face may be used in breeding behaviors.[7] The foot glands might also be related to reproduction,[7] but alternative reasons, such as secretion of a waste product or a scent marker to help lost sheep find their flock, have also been proposed.[17]

Sheep compared to goats[edit]

Sheep and goats are closely related as both are in the subfamily Caprinae. However, they are separate species, so hybrids rarely occur, and are always infertile. A hybrid of a ewe and a buck (a male goat) is called a sheep-goat hybrid (only a single such animal has been confirmed), and is not to be confused with the sheep-goat chimera, though both are known as "geep". Visual differences between sheep and goats include the beard of goats and divided upper lip of sheep. Sheep tails also hang down, even when short or docked, while the short tails of goats are held upwards. Sheep breeds are also often naturally polled (either in both sexes or just in the female), while naturally polled goats are rare (though many are polled artificially). Males of the two species differ in that buck goats acquire a unique and strong odor during the rut, whereas rams do not.[12]

Breeds[edit]

Sheep being judged for adherence to their breed standard, and being held by the most common method of restraint

The domestic sheep is a multi-purpose animal, and the more than 200 breeds now in existence were created to serve these diverse purposes.[3][18] Some sources give a count of a thousand or more breeds,[19][20] but these numbers cannot be verified, according to some sources.[6][12] However, several hundred breeds of sheep have been identified by the FAO (Food and Agriculture Organization of the UN), with the estimated number varying somewhat from time to time: e.g. 863 breeds as of 1993,[21] 1314 breeds as of 1995[22] and 1229 breeds as of 2006.[23] (These numbers exclude extinct breeds, which are also tallied by the FAO.) For purposes of such tallies, the FAO definition of a breed is "either a subspecific group of domestic livestock with definable and identifiable external characteristics that enable it to be separated by visual appraisal from other similarly defined groups within the same species or a group for which geographical and/or cultural separation from phenotypically similar groups has led to acceptance of its separate identity."[23] Almost all sheep are classified as being best suited to furnishing a certain product: wool, meat, milk, hides, or a combination in a dual-purpose breed. Other features used when classifying sheep include face color (generally white or black), tail length, presence or lack of horns, and the topography for which the breed has been developed. This last point is especially stressed in the UK, where breeds are described as either upland (hill or mountain) or lowland breeds.[16] A sheep may also be of a fat-tailed type, which is a dual-purpose sheep common in Africa and Asia with larger deposits of fat within and around its tail.

The Barbados Blackbelly is a hair sheep breed of Caribbean origin.

Breeds are often categorized by the type of their wool. Fine wool breeds are those that have wool of great crimp and density, which are preferred for textiles. Most of these were derived from Merino sheep, and the breed continues to dominate the world sheep industry. Downs breeds have wool between the extremes, and are typically fast-growing meat and ram breeds with dark faces.[24] Some major medium wool breeds, such as the Corriedale, are dual-purpose crosses of long and fine-wooled breeds and were created for high-production commercial flocks. Long wool breeds are the largest of sheep, with long wool and a slow rate of growth. Long wool sheep are most valued for crossbreeding to improve the attributes of other sheep types. For example: the American Columbia breed was developed by crossing Lincoln rams (a long wool breed) with fine-wooled Rambouillet ewes.

Coarse or carpet wool sheep are those with a medium to long length wool of characteristic coarseness. Breeds traditionally used for carpet wool show great variability, but the chief requirement is a wool that will not break down under heavy use (as would that of the finer breeds). As the demand for carpet-quality wool declines, some breeders of this type of sheep are attempting to use a few of these traditional breeds for alternative purposes. Others have always been primarily meat-class sheep.[25]

A minor class of sheep are the dairy breeds. Dual-purpose breeds that may primarily be meat or wool sheep are often used secondarily as milking animals, but there are a few breeds that are predominantly used for milking. These sheep do produce a higher quantity of milk and have slightly longer lactation curves.[26] In the quality of their milk, fat and protein content percentages of dairy sheep vary from non-dairy breeds but lactose content does not.[27]

A last group of sheep breeds is that of fur or hair sheep, which do not grow wool at all. Hair sheep are similar to the early domesticated sheep kept before woolly breeds were developed, and are raised for meat and pelts. Some modern breeds of hair sheep, such as the Dorper, result from crosses between wool and hair breeds. For meat and hide producers, hair sheep are cheaper to keep, as they do not need shearing.[25] Hair sheep are also more resistant to parasites and hot weather.[12]

With the modern rise of corporate agribusiness and the decline of localized family farms, many breeds of sheep are in danger of extinction. The Rare Breeds Survival Trust of the UK lists 22 native breeds as having only 3,000 registered animals (each), and The Livestock Conservancy lists 14 as either "critical" or "threatened".[28][29][30] Preferences for breeds with uniform characteristics and fast growth have pushed heritage (or heirloom) breeds to the margins of the sheep industry.[25] Those that remain are maintained through the efforts of conservation organizations, breed registries, and individual farmers dedicated to their preservation.

Diet[edit]

A ewe grazing

Sheep are exclusively herbivorous mammals. Most breeds prefer to graze on grass and other short roughage, avoiding the taller woody parts of plants that goats readily consume.[31] Both sheep and goats use their lips and tongues to select parts of the plant that are easier to digest or higher in nutrition.[31] Sheep, however, graze well in monoculture pastures where most goats fare poorly.[31] Like all ruminants, sheep have a complex digestive system composed of four chambers, allowing them to break down cellulose from stems, leaves, and seed hulls into simpler carbohydrates. When sheep graze, vegetation is chewed into a mass called a bolus, which is then passed into the rumen, via the reticulum. The rumen is a 19- to 38-liter (5 to 10 gal) organ in which feed is fermented.[32] The fermenting organisms include bacteria, fungi, and protozoa.[33] (Other important rumen organisms include some archaea, which produce methane from carbon dioxide.[34]) The bolus is periodically regurgitated back to the mouth as cud for additional chewing and salivation.[32] Cud chewing is an adaptation allowing ruminants to graze more quickly in the morning, and then fully chew and digest feed later in the day.[35] This is safer than grazing, which requires lowering the head thus leaving the animal vulnerable to predators, while cud chewing does not.[12]

Other than forage, the other staple feed for sheep is hay, often during the winter months. The ability to thrive solely on pasture (even without hay) varies with breed, but all sheep can survive on this diet.[25] Also included in some sheep's diets are minerals, either in a trace mix or in licks.

Grazing behavior[edit]

Sheep follow a diurnal pattern of activity, feeding from dawn to dusk, stopping sporadically to rest and chew their cud. Ideal pasture for sheep is not lawnlike grass, but an array of grasses, legumes and forbs.[36] Types of land where sheep are raised vary widely, from pastures that are seeded and improved intentionally to rough, native lands. Common plants toxic to sheep are present in most of the world, and include (but are not limited to) cherry, some oaks and acorns, tomato, yew, rhubarb, potato, and rhododendron.[37]

Sheep graze on public land in Snake Valley, Utah.

Effects on pasture[edit]

Sheep are largely grazing herbivores, unlike browsing animals such as goats and deer that prefer taller foliage. With a much narrower face, sheep crop plants very close to the ground and can overgraze a pasture much faster than cattle.[12] For this reason, many shepherds use managed intensive rotational grazing, where a flock is rotated through multiple pastures, giving plants time to recover.[12][16] Paradoxically, sheep can both cause and solve the spread of invasive plant species. By disturbing the natural state of pasture, sheep and other livestock can pave the way for invasive plants. However, sheep also prefer to eat invasives such as cheatgrass, leafy spurge, kudzu and spotted knapweed over native species such as sagebrush, making grazing sheep effective for conservation grazing.[38] Research conducted in Imperial County, California compared lamb grazing with herbicides for weed control in seedling alfalfa fields. Three trials demonstrated that grazing lambs were just as effective as herbicides in controlling winter weeds. Entomologists also compared grazing lambs to insecticides for insect control in winter alfalfa. In this trial, lambs provided insect control as effectively as insecticides.[39]

Rumination[edit]

A sheep's ruminant system

During fermentation, the rumen produces gas that must be expelled; disturbances of the organ, such as sudden changes in a sheep's diet, can cause the potentially fatal condition of bloat, when gas becomes trapped in the rumen, due to reflex closure of the caudal esophageal sphincter when in contact with foam or liquid.[40] After fermentation in the rumen, feed passes into the reticulum and the omasum; special feeds such as grains may bypass the rumen altogether. After the first three chambers, food moves into the abomasum for final digestion before processing by the intestines. The abomasum is the only one of the four chambers analogous to the human stomach, and is sometimes called the "true stomach".[41]

Concentrated diets[edit]

Sheep are one of the few livestock animals raised for meat today that have rarely been raised in an intensive, confined animal feeding operation (CAFO).[6] Although there is a growing movement advocating alternative farming styles, a large percentage of beef cattle, pigs, and poultry are still produced under such conditions.[7] In contrast, only some sheep are regularly given high-concentration grain feed, much less kept in confinement. Especially in industrialized countries, sheep producers may fatten market lambs before slaughter (called "finishing") in feedlots.[12] Many sheep breeders flush ewes and rams with a daily ration of grain during breeding to increase fertility.[42] Ewes may be flushed during pregnancy to increase birth weights, as 70% of a lamb's growth occurs in the last five to six weeks of gestation.[6] [However, overfeeding of ewe hoggets (i.e. adolescent ewes) in early pregnancy can result in restricted placental development, restricting growth of fetal lambs in late pregnancy.[43][44]] Otherwise, only lactating ewes and especially old or infirm sheep are commonly provided with grain.[6][25] Feed provided to sheep must be specially formulated, as most cattle, poultry, pig, and even some goat feeds contain levels of copper that are lethal to sheep.[6] The same danger applies to mineral supplements such as salt licks.[45]

Water[edit]

Naturally, a constant source of potable water is also a fundamental requirement for sheep. The amount of water needed by sheep fluctuates with the season and the type and quality of the food they consume.[46] When sheep feed on large amounts of new growth and there is precipitation (including dew, as sheep are dawn feeders), sheep need less water. When sheep are confined or are eating large amounts of cured hay, more water is typically needed. Sheep also require clean water, and may refuse to drink water that is covered in scum or algae.[46]

Behavior[edit]

A flock of sheep following a leader
Sheep showing flocking behavior during a sheepdog trial

Flock behavior[edit]

Sheep are flock animals and strongly gregarious; much sheep behavior can be understood on the basis of these tendencies. The dominance hierarchy of sheep and their natural inclination to follow a leader to new pastures were the pivotal factors in sheep being one of the first domesticated livestock species.[47] Furthermore, in contrast to the red deer and gazelle (two other ungulates of primary importance to meat production in prehistoric times), sheep do not defend territories although they do form home ranges.[48] All sheep have a tendency to congregate close to other members of a flock, although this behavior varies with breed,[13] and sheep can become stressed when separated from their flock members.[7] During flocking, sheep have a strong tendency to follow and a leader may simply be the first individual to move. Relationships in flocks tend to be closest among related sheep: in mixed-breed flocks, subgroups of the same breed tend to form, and a ewe and her direct descendants often move as a unit within large flocks.[6] Sheep can become hefted to one particular local pasture (heft) so they do not roam freely in unfenced landscapes. Lambs learn the heft from ewes and if whole flocks are culled it must be retaught to the replacement animals.[7][49]

Flock behaviour in sheep is generally only exhibited in groups of four or more sheep; fewer sheep may not react as expected when alone or with few other sheep.[6] Being a prey species, the primary defense mechanism of sheep is to flee from danger when their flight zone is entered. Cornered sheep may charge and butt, or threaten by hoof stamping and adopting an aggressive posture. This is particularly true for ewes with newborn lambs.[6]

In regions where sheep have no natural predators, none of the native breeds of sheep exhibit a strong flocking behavior.[12]

Herding[edit]

Escaped sheep being led back to pasture with the enticement of food. This method of moving sheep works best with smaller flocks.

Farmers exploit flocking behavior to keep sheep together on unfenced pastures such as hill farming, and to move them more easily. Shepherds may also use herding dogs in this effort, whose highly bred herding ability can assist in moving flocks. Sheep are food-oriented and association of humans with regular feeding often results in sheep soliciting people for food.[50] Those who are moving sheep may exploit this behavior by leading sheep with buckets of feed, rather than forcing their movements with herding.[51][52]

Dominance hierarchy[edit]

Sheep establish a dominance hiererachy through fighting, threats and competitiveness. Dominant animals are inclined to be more aggressive with other sheep, and usually feed first at troughs.[53] Primarily among rams, horn size is a factor in the flock hierarchy.[54] Rams with different size horns may be less inclined to fight to establish the dominance order, while rams with similarly sized horns are more so.[54] Merinos have an almost linear hierarchy whereas there is a less rigid structure in Border Leicesters when a competitive feeding situation arises.[55]

In sheep, position in a moving flock is highly correlated with social dominance, but there is no definitive study to show consistent voluntary leadership by an individual sheep.[55]

Intelligence and learning ability[edit]

Sheep are frequently thought of as unintelligent animals.[56] Their flocking behavior and quickness to flee and panic can make shepherding a difficult endeavor for the uninitiated. Despite these perceptions, a University of Illinois monograph on sheep reported them to be just below pigs and on par with cattle in IQ.[6] Sheep can recognize individual human and ovine faces, and remember them for years.[57][58] In addition to long-term facial recognition of individuals, sheep can also differentiate emotional states through facial characteristics.[57][58] If worked with patiently, sheep may learn their names and many sheep are trained to be led by halter for showing and other purposes.[6] Sheep have also responded well to clicker training.[6] Sheep have been used as pack animals; Tibetan nomads distribute baggage equally throughout a flock as it is herded between living sites.[6]

It has been reported that some sheep have apparently shown problem-solving abilities; a flock in West Yorkshire, England allegedly found a way to get over cattle grids by rolling on their backs, although documentation of this has relied on anecdotal accounts.[59]

Vocalisations[edit]

A sheep bleat

Problems playing this file? See media help.

Sounds made by domestic sheep include bleats, grunts, rumbles and snorts. Bleating ("baaing") is used mostly for contact communication, especially between dam and lambs, but also at times between other flock members.[60] The bleats of individual sheep are distinctive, enabling the ewe and her lambs to recognize each other's vocalizations.[61] Vocal communication between lambs and their dam declines to a very low level within several weeks after parturition.[60] A variety of bleats may be heard, depending on sheep age and circumstances. Apart from contact communication, bleating may signal distress, frustration or impatience; however, sheep are usually silent when in pain. Isolation commonly prompts bleating by sheep.[62] Pregnant ewes may grunt when in labor.[63] Rumbling sounds are made by the ram during courting; somewhat similar rumbling sounds may be made by the ewe,[60] especially when with her neonate lambs. A snort (explosive exhalation through the nostrils) may signal aggression or a warning,[60][64] or it may be an alarm or startle response.[65][better source needed]

Senses[edit]

Sheep have panoramic vision of 330° to 360° and binocular vision of 25° to 50°. They are thought to have colour vision and are able to distinguish between a variety of colours: black, red, brown, green, yellow and white [66] They have no accommodation, so must lift their head to see distant objects. This also means that they are unable to judge depth as accurately as some other animals. Sheep eyes possess very low hyperopia with little astigmatism. Such visual characteristics are likely to produce a well-focused retinal image of objects in both the middle and long distance.[67] Sight is a vital part of sheep communication and when grazing, they maintain visual contact with each other.[68] Each sheep lifts its head upwards to check the position of other sheep in the flock. This constant monitoring is probably what keeps the sheep in a flock as they move along grazing. Sheep become stressed when isolated; this stress is reduced if they are provided with a mirror, indicating that the sight of other sheep has stress-reducing properties.[69]

Taste is the most important sense in sheep establishing forage preferences, with sweet and sour plants being preferred and bitter plants being more commonly rejected. Touch and sight are also important in relation to specific plant characteristics, such as succulence and growth form.[70]

The ram uses his vomeronasal organ (sometimes called the Jacobson's organ) for sensing the pheromones of ewes and detecting when they are in estrus.[71] The ewe uses her vomeronasal organ for early recognition of her neonate lamb.[72]

Reproduction[edit]

The second of twins being born on a New Zealand pasture

Sheep follow a similar reproductive strategy to other herd animals. A group of ewes is generally mated by a single ram, who has either been chosen by a breeder or has established dominance through physical contest with other rams (in feral populations).[25] Most sheep are seasonal breeders, although some are able to breed year-round.[25] Ewes generally reach sexual maturity at six to eight months of age, and rams generally at four to six months.[25] However, there are exceptions. For example, Finnsheep ewe lambs may reach puberty as early as 3 to 4 months, and Merino ewes sometimes reach puberty at 18 to 20 months.[73] Ewes have estrus cycles about every 17 days,[74] during which they emit a scent and indicate readiness through physical displays towards rams. A minority of rams display a preference for homosexuality (8% on average)[75] and a small number of the females that were accompanied by a male fetus in utero are freemartins (female animals that are behaviorally masculine and lack functioning ovaries).[76][77][78][79]

In feral sheep, rams may fight during the rut to determine which individuals may mate with ewes. Rams, especially unfamiliar ones, will also fight outside the breeding period to establish dominance; rams can kill one another if allowed to mix freely.[25] During the rut, even normally friendly rams may become aggressive towards humans due to increases in their hormone levels.[7]

After mating, sheep have a gestation period of about five months,[80] and normal labor takes one to three hours.[81] Although some breeds regularly throw larger litters of lambs, most produce single or twin lambs.[7][82] During or soon after labor, ewes and lambs may be confined to small lambing jugs,[83] small pens designed to aid both careful observation of ewes and to cement the bond between them and their lambs.[16][25]

A lamb's first steps

Ovine obstetrics can be problematic. By selectively breeding ewes that produce multiple offspring with higher birth weights for generations, sheep producers have inadvertently caused some domestic sheep to have difficulty lambing; balancing ease of lambing with high productivity is one of the dilemmas of sheep breeding.[84] In the case of any such problems, those present at lambing may assist the ewe by extracting or repositioning lambs.[25] After the birth, ewes ideally break the amniotic sac (if it is not broken during labor), and begin licking clean the lamb.[25] Most lambs will begin standing within an hour of birth.[25] In normal situations, lambs nurse after standing, receiving vital colostrum milk. Lambs that either fail to nurse or that are rejected by the ewe require aid to live, such as bottle-feeding or fostering by another ewe.[85]

After lambs are several weeks old, lamb marking (the process of ear tagging, docking, and castrating) is carried out.[25] Vaccinations are usually carried out at this point as well. Ear tags with numbers are attached, or ear marks are applied for ease of later identification of sheep. Castration is performed on ram lambs not intended for breeding, although some shepherds choose to avoid the procedure for ethical, economic or practical reasons.[25] However, many would disagree with regard to timing. Docking and castration are commonly done after 24 hours (to avoid interference with maternal bonding and consumption of colostrum) and are often done not later than one week after birth, to minimize pain, stress, recovery time and complications[86][87] The first course of vaccinations (commonly anti-clostridial) is commonly given at an age of about 10 to 12 weeks; i.e. when the concentration of maternal antibodies passively acquired via colostrum is expected to have fallen low enough to permit development of active immunity.[88][89][90] Ewes are often revaccinated annually about 3 weeks before lambing, to provide high antibody concentrations in colostrum during the first several hours after lambing.[40] Ram lambs that will either be slaughtered or separated from ewes before sexual maturity are not usually castrated.[16] Tail docking is commonly done for welfare, having been shown to reduce risk of fly strike.[91] Objections to all these procedures have been raised by animal rights groups, but farmers defend them by saying they solve many practical and veterinary problems, and inflict only temporary pain.[7][25]

Health[edit]

A veterinarian draws blood to test for resistance to scrapie

Sheep may fall victim to poisons, infectious diseases, and physical injuries. As a prey species, a sheep's system is adapted to hide the obvious signs of illness, to prevent being targeted by predators.[7] However, some signs of ill health are obvious, with sick sheep eating little, vocalizing excessively, and being generally listless.[92] Throughout history, much of the money and labor of sheep husbandry has aimed to prevent sheep ailments. Historically, shepherds often created remedies by experimentation on the farm. In some developed countries, including the United States, sheep lack the economic importance for drug companies to perform expensive clinical trials required to approve more than a relatively limited number of drugs for ovine use.[93] However, extra-label drug use in sheep production is permitted in many jurisdictions, subject to certain restrictions. In the US, for example, regulations governing extra-label drug use in animals are found in 21 CFR (Code of Federal Regulations) Part 530.[94] In the 20th and 21st centuries, a minority of sheep owners have turned to alternative treatments such as homeopathy, herbalism and even traditional Chinese medicine to treat sheep veterinary problems.[6][7] Despite some favorable anecdotal evidence, the effectiveness of alternative veterinary medicine has been met with skepticism in scientific journals.[6][7][95] The need for traditional anti-parasite drugs and antibiotics is widespread, and is the main impediment to certified organic farming with sheep.[25]

Many breeders take a variety of preventive measures to ward off problems. The first is to ensure all sheep are healthy when purchased. Many buyers avoid outlets known to be clearing houses for animals culled from healthy flocks as either sick or simply inferior.[7] This can also mean maintaining a closed flock, and quarantining new sheep for a month. Two fundamental preventive programs are maintaining good nutrition and reducing stress in the sheep. Restraint, isolation, loud noises, novel situations, pain, heat, extreme cold, fatigue and other stressors can lead to secretion of cortisol, a stress hormone, in amounts that may indicate welfare problems.[96][97][98][99] Excessive stress can compromise the immune system.[99] "Shipping fever" (pneumonic mannheimiosis, formerly called pasteurellosis) is a disease of particular concern, that can occur as a result of stress, notably during transport and (or) handling.[100][101] Pain, fear and several other stressors can cause secretion of epinephrine (adrenaline). Considerable epinephrine secretion in the final days before slaughter can adversely affect meat quality (by causing glycogenolysis, removing the substrate for normal post-slaughter acidification of meat) and result in meat becoming more susceptible to colonization by spoilage bacteria.[97] Because of such issues, low-stress handling is essential in sheep management. Avoiding poisoning is also important; common poisons are pesticide sprays, inorganic fertilizer, motor oil, as well as radiator coolant containing ethylene glycol.[102]

A sheep infected with orf, a disease transmittable to humans through skin contact

Common forms of preventive medication for sheep are vaccinations and treatments for parasites. Both external and internal parasites are the most prevalent malady in sheep, and are either fatal, or reduce the productivity of flocks.[7] Worms are the most common internal parasites. They are ingested during grazing, incubate within the sheep, and are expelled through the digestive system (beginning the cycle again). Oral anti-parasitic medicines, known as drenches, are given to a flock to treat worms, sometimes after worm eggs in the feces has been counted to assess infestation levels. Diatomaceaus Earth has been shown to be an effective, non chemical treatment for worm control in sheep.[103] Afterwards, sheep may be moved to a new pasture to avoid ingesting the same parasites.[16] External sheep parasites include: lice (for different parts of the body), sheep keds, nose bots, sheep itch mites, and maggots. Keds are blood-sucking parasites that cause general malnutrition and decreased productivity, but are not fatal. Maggots are those of the bot fly and the blow-fly. Fly maggots cause the extremely destructive condition of flystrike. Flies lay their eggs in wounds or wet, manure-soiled wool; when the maggots hatch they burrow into a sheep's flesh, eventually causing death if untreated. In addition to other treatments, crutching (shearing wool from a sheep's rump) is a common preventive method. Some countries allow mulesing, a practice that involves stripping away the skin on the rump to prevent fly-strike, normally performed when the sheep is a lamb.[104][105] Nose bots are fly larvae that inhabit a sheep's sinuses, causing breathing difficulties and discomfort. Common signs are a discharge from the nasal passage, sneezing, and frantic movement such as head shaking. External parasites may be controlled through the use of backliners, sprays or immersive sheep dips.[7]

A wide array of bacterial and viral diseases affect sheep. Diseases of the hoof, such as foot rot and foot scald may occur, and are treated with footbaths and other remedies. These painful conditions cause lameness and hinder feeding. Ovine Johne's disease is a wasting disease that affects young sheep. Bluetongue disease is an insect-borne illness causing fever and inflammation of the mucous membranes. Ovine rinderpest (or peste des petits ruminants) is a highly contagious and often fatal viral disease affecting sheep and goats.

A few sheep conditions are transmissible to humans. Orf (also known as scabby mouth, contagious ecthyma or soremouth) is a skin disease leaving lesions that is transmitted through skin-to-skin contact. Cutaneous anthrax is also called woolsorter's disease, as the spores can be transmitted in unwashed wool. More seriously, the organisms that can cause spontaneous enzootic abortion in sheep are easily transmitted to pregnant women. Also of concern are the prion disease scrapie and the virus that causes foot-and-mouth disease (FMD), as both can devastate flocks. The latter poses a slight risk to humans. During the 2001 FMD pandemic in the UK, hundreds of sheep were culled and some rare British breeds were at risk of extinction due to this.[7]

Predation[edit]

A lamb being attacked by coyotes with the most typical method, a bite to the throat

Other than parasites and disease, predation is a threat to sheep and the profitability of sheep raising. Sheep have little ability to defend themselves, compared with other species kept as livestock. Even if sheep survive an attack, they may die from their injuries, or simply from panic.[7] However, the impact of predation varies dramatically with region. In Africa, Australia, the Americas, and parts of Europe and Asia predators are a serious problem. In the United States, for instance, over one third of sheep deaths in 2004 were caused by predation.[106] In contrast, other nations are virtually devoid of sheep predators, particularly islands known for extensive sheep husbandry.[7] Worldwide, canids—including the domestic dog—are responsible for most sheep deaths.[107][108][109] Other animals that occasionally prey on sheep include: felines, bears, birds of prey, ravens and feral hogs.[106][110]

Sheep producers have used a wide variety of measures to combat predation. Pre-modern shepherds used their own presence, livestock guardian dogs, and protective structures such as barns and fencing. Fencing (both regular and electric), penning sheep at night and lambing indoors all continue to be widely used.[25] More modern shepherds used guns, traps, and poisons to kill predators,[111] causing significant decreases in predator populations. In the wake of the environmental and conservation movements, the use of these methods now usually falls under the purview of specially designated government agencies in most developed countries .[112]

The 1970s saw a resurgence in the use of livestock guardian dogs and the development of new methods of predator control by sheep producers, many of them non-lethal.[16] Donkeys and guard llamas have been used since the 1980s in sheep operations, using the same basic principle as livestock guardian dogs.[7] Interspecific pasturing, usually with larger livestock such as cattle or horses, may help to deter predators, even if such species do not actively guard sheep.[25] In addition to animal guardians, contemporary sheep operations may use non-lethal predator deterrents such as motion-activated lights and noisy alarms.[7]

Economic importance[edit]

Global sheep stocks
in 2008
(million)
 China136.4
 Australia79.0
 India65.0
 Iran53.8
 Sudan51.1
 New Zealand34.1
 Nigeria33.9
 United Kingdom33.1
World Total1,078.2
Source:
UN Food & Agriculture Organisation
(FAO)

Sheep are an important part of the global agricultural economy. However, their once vital status has been largely replaced by other livestock species, especially the pig, chicken, and cow.[16] China, Australia, India, and Iran have the largest modern flocks, and serve both local and exportation needs for wool and mutton.[113] Other countries such as New Zealand have smaller flocks but retain a large international economic impact due to their export of sheep products. Sheep also play a major role in many local economies, which may be niche markets focused on organic or sustainable agriculture and local food customers.[6][114] Especially in developing countries, such flocks may be a part of subsistence agriculture rather than a system of trade. Sheep themselves may be a medium of trade in barter economies.[6]

Wool supplied by Australian farmers to dealers (tonnes/quarter) has been in decline since 1990

Domestic sheep provide a wide array of raw materials. Wool was one of the first textiles, although in the late 20th century wool prices began to fall dramatically as the result of the popularity and cheap prices for synthetic fabrics.[6] For many sheep owners, the cost of shearing is greater than the possible profit from the fleece, making subsisting on wool production alone practically impossible without farm subsidies.[6] Fleeces are used as material in making alternative products such as wool insulation.[115] In the 21st century, the sale of meat is the most profitable enterprise in the sheep industry, even though far less sheep meat is consumed than chicken, pork or beef.[16]

Sheepskin is likewise used for making clothes, footwear, rugs, and other products. Byproducts from the slaughter of sheep are also of value: sheep tallow can be used in candle and soap making, sheep bone and cartilage has been used to furnish carved items such as dice and buttons as well as rendered glue and gelatin.[116] Sheep intestine can be formed into sausage casings, and lamb intestine has been formed into surgical sutures, as well as strings for musical instruments and tennis rackets.[3] Sheep droppings, which are high in cellulose, have even been sterilized and mixed with traditional pulp materials to make paper.[117] Of all sheep byproducts, perhaps the most valuable is lanolin: the waterproof, fatty substance found naturally in sheep's wool and used as a base for innumerable cosmetics and other products.[3]

Some farmers who keep sheep also make a profit from live sheep. Providing lambs for youth programs such as 4-H and competition at agricultural shows is often a dependable avenue for the sale of sheep.[118] Farmers may also choose to focus on a particular breed of sheep in order to sell registered purebred animals, as well as provide a ram rental service for breeding.[119] The most valuable sheep ever sold to date was a purebred Texel ram that fetched £231,000 at auction.[120] The previous record holder was a Merino ram sold for £205,000 in 1989.[120] A new option for deriving profit from live sheep is the rental of flocks for grazing; these "mowing services" are hired in order to keep unwanted vegetation down in public spaces and to lessen fire hazard.[121]

Despite the falling demand and price for sheep products in many markets, sheep have distinct economic advantages when compared with other livestock. They do not require the expensive housing,[122] such as that used in the intensive farming of chickens or pigs. They are an efficient use of land; roughly six sheep can be kept on the amount that would suffice for a single cow or horse.[7][123] Sheep can also consume plants, such as noxious weeds, that most other animals will not touch, and produce more young at a faster rate.[124] Also, in contrast to most livestock species, the cost of raising sheep is not necessarily tied to the price of feed crops such as grain, soybeans and corn.[125] Combined with the lower cost of quality sheep, all these factors combine to equal a lower overhead for sheep producers, thus entailing a higher profitability potential for the small farmer.[125] Sheep are especially beneficial for independent producers, including family farms with limited resources, as the sheep industry is one of the few types of animal agriculture that has not been vertically integrated by agribusiness.[126]

Food[edit]

Shoulder of lamb
Main articles: Lamb and mutton and Sheep milk

Sheep meat and milk were one of the earliest staple proteins consumed by human civilization after the transition from hunting and gathering to agriculture.[7] Sheep meat prepared for food is known as either mutton or lamb. "Mutton" is derived from the Old French moton, which was the word for sheep used by the Anglo-Norman rulers of much of the British Isles in the Middle Ages. This became the name for sheep meat in English, while the Old English word sceap was kept for the live animal.[127] Throughout modern history, "mutton" has been limited to the meat of mature sheep usually at least two years of age; "lamb" is used for that of immature sheep less than a year.[128][129][130]

In the 21st century, the nations with the highest consumption of sheep meat are the Arab States of the Persian Gulf, New Zealand, Australia, Greece, Uruguay, the United Kingdom and Ireland.[6] These countries eat 14–40 lbs (3–18 kg) of sheep meat per capita, per annum.[6][130] Sheep meat is also popular in France, Africa (especially the Maghreb), the Caribbean, the rest of the Middle East, India, and parts of China.[130] This often reflects a history of sheep production. In these countries in particular, dishes comprising alternative cuts and offal may be popular or traditional. Sheep testicles—called animelles or lamb fries—are considered a delicacy in many parts of the world. Perhaps the most unusual dish of sheep meat is the Scottish haggis, composed of various sheep innards cooked along with oatmeal and chopped onions inside its stomach.[131] In comparison, countries such as the U.S. consume only a pound or less (under 0.5 kg), with Americans eating 50 pounds (22 kg) of pork and 65 pounds (29 kg) of beef.[130] In addition, such countries rarely eat mutton, and may favor the more expensive cuts of lamb: mostly lamb chops and leg of lamb.[6]

Though sheep's milk may be drunk rarely in fresh form,[132] today it is used predominantly in cheese and yogurt making. Sheep have only two teats, and produce a far smaller volume of milk than cows.[7] However, as sheep's milk contains far more fat, solids, and minerals than cow's milk, it is ideal for the cheese-making process.[27] It also resists contamination during cooling better because of its much higher calcium content.[27] Well-known cheeses made from sheep milk include the Feta of Bulgaria and Greece, Roquefort of France, Manchego from Spain, the Pecorino Romano (the Italian word for sheep is pecore) and Ricotta of Italy. Yogurts, especially some forms of strained yogurt, may also be made from sheep milk.[133] Many of these products are now often made with cow's milk, especially when produced outside their country of origin.[6] Sheep milk contains 4.8% lactose, which may affect those who are intolerant.[6]

As with other domestic animals, the meat of uncastrated males is inferior in quality, especially as they grow. A "bucky" lamb is a lamb which was not castrated early enough, or which was castrated improperly (resulting in one testicle being retained). These lambs are worth less at market. [134][135][136]

Science[edit]

A cloned ewe named Dolly was a scientific landmark.

Sheep are generally too large and reproduce too slowly to make ideal research subjects, and thus are not a common model organism.[137] They have, however, played an influential role in some fields of science. In particular, the Roslin Institute of Edinburgh, Scotland used sheep for genetics research that produced groundbreaking results. In 1995, two ewes named Megan and Morag were the first mammals cloned from differentiated cells. A year later, a Finnish Dorset sheep named Dolly, dubbed "the world's most famous sheep" in Scientific American,[138] was the first mammal to be cloned from an adult somatic cell. Following this, Polly and Molly were the first mammals to be simultaneously cloned and transgenic.

As of 2008, the sheep genome has not been fully sequenced, although a detailed genetic map has been published,[139] and a draft version of the complete genome produced by assembling sheep DNA sequences using information given by the genomes of other mammals.[140] In 2012, a transgenic sheep named "Peng Peng" was cloned by Chinese scientists, who spliced his genes with that of a roundworm (C. elegans) in order to increase production of fats healthier for human consumption.[141]

In the study of natural selection, the population of Soay sheep that remain on the island of Hirta have been used to explore the relation of body size and coloration to reproductive success.[142] Soay sheep come in several colors, and researchers investigated why the larger, darker sheep were in decline; this occurrence contradicted the rule of thumb that larger members of a population tend to be more successful reproductively.[143] The feral Soays on Hirta are especially useful subjects because they are isolated.[144]

Sheep are one of the few animals where the molecular basis of the diversity of male sexual preferences has been examined.[145] However, this research has been controversial, and much publicity has been produced by a study at the Oregon Health and Science University that investigated the mechanisms that produce homosexuality in rams. Organizations such as PETA campaigned against the study, accusing scientists of trying to cure homosexuality in the sheep.[75] OHSU and the involved scientists vehemently denied such accusations.[75]

A 1979 Faroese stamp by Czesław Słania. Sheep are the heraldic animal of the Faroes ("Sheep Islands").

Domestic sheep are sometimes used in medical research, particularly for researching cardiovascular physiology, in areas such as hypertension and heart failure.[146][147] Pregnant sheep are also a useful model for human pregnancy,[148] and have been used to investigate the effects on fetal development of malnutrition and hypoxia.[149] In behavioral sciences, sheep have been used in isolated cases for the study of facial recognition, as their mental process of recognition is qualitatively similar to humans.[150]

Cultural impact[edit]

The proverbial black sheep

Sheep have had a strong presence in many cultures, especially in areas where they form the most common type of livestock. In the English language, to call someone a sheep or ovine may allude that they are timid and easily led, if not outright stupid.[151] In contradiction to this image, male sheep are often used as symbols of virility and power; although the logos of the St. Louis Rams and the Dodge Ram allude specifically to males of the species bighorn sheep, ovis canadensis. Sheep are key symbols in fables and nursery rhymes like The Wolf in Sheep's Clothing, Little Bo Peep, Baa, Baa, Black Sheep, and Mary Had a Little Lamb. Novels such as George Orwell's Animal Farm, Haruki Murakami's A Wild Sheep Chase, Thomas Hardy's Far from the Madding Crowd, Neil Astley's The Sheep Who Changed the World (which features a cloned sheep) and Leonie Swann's Three Bags Full: A Sheep Detective Story utilize sheep as characters or plot devices. Poems like William Blake's "The Lamb", songs such as Pink Floyd's Sheep and Bach's aria Sheep may safely graze (Schafe können sicher weiden) use sheep for metaphorical purposes. In more recent popular culture, the 2007 film Black Sheep exploits sheep for horror and comedic effect, ironically turning them into blood-thirsty killers.

Counting sheep is popularly said to be an aid to sleep, and some ancient systems of counting sheep persist today. Sheep also enter in colloquial sayings and idiom frequently with such phrases as "black sheep". To call an individual a black sheep implies that they are an odd or disreputable member of a group.[152] This usage derives from the recessive trait that causes an occasional black lamb to be born into an entirely white flock. These black sheep were considered undesirable by shepherds, as black wool is not as commercially viable as white wool.[152] Citizens who accept overbearing governments have been referred to by the Portmanteau neologism of sheeple. Somewhat differently, the adjective "sheepish" is also used to describe embarrassment.[153]

Religion and folklore[edit]

In antiquity, symbolism involving sheep cropped up in religions in the ancient Near East, the Mideast, and the Mediterranean area: Çatalhöyük, ancient Egyptian religion, the Cana'anite and Phoenician tradition, Judaism, Greek religion, and others. Religious symbolism and ritual involving sheep began with some of the first known faiths: skulls of rams (along with bulls) occupied central placement in shrines at the Çatalhöyük settlement in 8,000 BCE.[154] In Ancient Egyptian religion, the ram was the symbol of several gods: Khnum, Heryshaf and Amun (in his incarnation as a god of fertility).[6] Other deities occasionally shown with ram features include: the goddess Ishtar, the Phoenician god Baal-Hamon, and the Babylonian god Ea-Oannes.[6] In Madagascar, sheep were not eaten as they were believed to be incarnations of the souls of ancestors.[155]

Jesus is depicted as being "The Good Shepherd", with the sheep being Christians

There are also many ancient Greek references to sheep: that of Chrysomallos, the golden-fleeced ram, continuing to be told through into the modern era. Astrologically, Aries, the ram, is the first sign of the classical Greek zodiac and the sheep is also the eighth of the twelve animals associated with the 12-year cycle of in the Chinese zodiac, related to the Chinese calendar.[155] In Mongolia, shagai are an ancient form of dice made from the cuboid bones of sheep that are often used for fortunetelling purposes.

Sheep play an important role in all the Abrahamic faiths; Abraham, Isaac, Jacob, Moses, King David and the Islamic prophet Muhammad were all shepherds. According to the Biblical story of the Binding of Isaac, a ram is sacrificed as a substitute for Isaac after an angel stays Abraham's hand (in the Islamic tradition, Abraham was about to sacrifice Ishmael). Eid al-Adha is a major annual festival in Islam in which sheep (or other animals) are sacrificed in remembrance of this act.[156][157] Sheep are also occasionally sacrificed to commemorate important secular events in Islamic cultures.[158] Greeks and Romans also sacrificed sheep regularly in religious practice, and Judaism also once sacrificed sheep as a Korban (sacrifice), such as the Passover lamb .[155] Ovine symbols—such as the ceremonial blowing of a shofar—still find a presence in modern Judaic traditions. Followers of Christianity are collectively often referred to as a flock, with Christ as the Good Shepherd, and sheep are an element in the Christian iconography of the birth of Jesus. Some Christian saints are considered patrons of shepherds, and even of sheep themselves. Christ is also portrayed as the Sacrificial lamb of God (Agnus Dei) and Easter celebrations in Greece and Romania traditionally feature a meal of Paschal lamb. In many Christian traditions, a church leader is called the pastor, which is derived from the Latin word for shepherd.

See also[edit]

Footnotes[edit]

  1. ^ Budiansky, pp. 97–98.
  2. ^ Budianksy, pp. 100–01.
  3. ^ a b c d e Ensminger
  4. ^ a b "Natural Colored Sheep". Rare Breeds Watchlist. Rocky Mountain Natural Colored Sheep Breeders Association. January 2007. Retrieved 2008-01-05. 
  5. ^ a b "An introduction to coloured sheep". British Coloured Sheep Breeders Association. Retrieved 2008-01-05. 
  6. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa Weaver
  7. ^ a b c d e f g h i j k l m n o p q r s t u v w x Simmons & Ekarius
  8. ^ Melinda J. Burrill Ph.D. Professor Coordinator of Graduate Studies, Department of Animal and Veterinary Sciences, California State Polytechnic University (2004). "Sheep". World Book. Mackiev. 
  9. ^ Frandson, R. D. and T. L. Spurgeon. 1992. Anatomy and physiology of farm animals. 5th ed. Lippincott, Williams and Wilkins. 572 pp
  10. ^ "Dental Anatomy of Ruminants from Colorado State University". Vivo.colostate.edu. 2001-11-07. Retrieved 2014-04-14. 
  11. ^ Schoenian, Susan. "Sheep Basics". Sheep101.info. Retrieved 2007-11-27. 
  12. ^ a b c d e f g h i Smith et al.
  13. ^ a b Smith et al., p. 5.
  14. ^ Shulaw, Dr. William P. (2006). Sheep Care Guide. American Sheep Industry Association. Retrieved 2008-09-08. 
  15. ^ Terrill, C. E. and L. N. Hazel. 1946. Heritability of neck folds and face covering in range Rambouillet lambs as evaluated by scoring. J. Anim. Sci. 5: 170-179.
  16. ^ a b c d e f g h i Brown, Dave; Sam Meadowcroft (1996). The Modern Shepherd. Wharfedale Road, Ipswich 1P1 4LG, United Kingdom: Farming Press. ISBN 0-85236-188-2. 
  17. ^ a b Smith et al., p. 4.
  18. ^ "Sheep (Ovis aries)". Breeds of Livestock. Oklahoma State University Dept. of Animal Science. Retrieved 2007-11-02. 
  19. ^ Cathy M. Dwyer (31 July 2008). The Welfare of Sheep. シュプリンガー・ジャパン株式会社. pp. 56–. ISBN 978-1-4020-8552-9. Retrieved 15 October 2010. 
  20. ^ Per Jensen (2009). The ethology of domestic animals: an introductory text. CABI. pp. 162–. ISBN 978-1-84593-536-8. Retrieved 15 October 2010. 
  21. ^ Maijala, K. 1997, Genetic aspects of domestication, common breeds and their origin. In: Piper, L. and A. Ruvinsky (eds.). The genetics of sheep. CABI
  22. ^ Scherf, B. D. 2000. World watch list for domestic animal diversity. 3rd Edition. FAO, Rome. 726 pp.
  23. ^ a b FAO. 2007. State of the world's animal genetic resources for food and agriculture. 512 pp.
  24. ^ D’Arcy, J.B., Sheep Management & Wool Technology, NSW University Press, 1986, ISBN 0-86840-106-4
  25. ^ a b c d e f g h i j k l m n o p q r s Wooster
  26. ^ Pulina, Giuseppe; Roberta Bencini (2004). Dairy Sheep Nutrition. CABI Publishing. ISBN 0-85199-595-0. 
  27. ^ a b c Pulina et al. p. 2.
  28. ^ Rare Breeds Survival Trust (UK) (January 2008). "Sheep". Rare Breeds Watchlist. Archived from the original on June 22, 2008. Retrieved 2008-09-07. 
  29. ^ Rare Breeds Survival Trust (UK) (2008). "Watchlist". A numerical guide to the 2008 Watchlist categories. Archived from the original on July 31, 2008. Retrieved 2008-09-07. 
  30. ^ "Conservation Priority List", livestockconservancy.org (The Livestock Conservancy), retrieved 2013-09-03 
  31. ^ a b c Pugh, pp. 19.
  32. ^ a b Simmons & Ekarius, p. 146.
  33. ^ Van Soest, P. J. 1994. Nutritional ecology of the ruminant. 2nd ed. Cornell Univ. Press. 476 pp.
  34. ^ Wright, A.-D. G. et al. 2004. Molecular diversity of rumen methanogens from sheep in Western Australia. Appl. Environ. Microbiol. 70: 1263-1270
  35. ^ Smith et al., p. 56.
  36. ^ Simmons & Ekarius, p. 82.
  37. ^ Simmons & Ekarius, p. 160.
  38. ^ Simmons & Ekarius, p. 143.
  39. ^ "Sheep grazing reduces pesticide use in alfalfa". ucanr.org. University of California Agriculture and Natural Resources. 
  40. ^ a b Kimberling, C. V. 1988. Jensen and Swift's diseases of sheep. 3rd ed. Lea & Fibiger, Philadelphia. 394 pp.
  41. ^ Simmons & Ekarius, p. 171.
  42. ^ Smith et al., p. 101.
  43. ^ Wallace, J. M. 2000. Nutrient partitioning during pregnancy: adverse gestational outcome in overnourished adolescent dams. Proc. Nutr. Soc. 59: 107-117.
  44. ^ Redmer, D. A., J. M. Wallace and L. P. Reynolds. 2004. Effect of nutrient intake during pregnancy on fetal and placental growth and vascular development. Domestic Anim. Endocrinol. 27: 199-217.
  45. ^ Simmons & Ekarius, p. 159.
  46. ^ a b Wooster, p. 64.
  47. ^ Budiansky
  48. ^ Clutton-Brock, J., (1987). A Natural History of Domesticated Mammals. Cambridge University Press, Cambridge pp.55
  49. ^ "Sheep taught to stay put". BBC News. 2001-11-03. Retrieved 2006-04-29. 
  50. ^ Budiasnky p. 100 et al.
  51. ^ Budiansky p. 10.
  52. ^ Wooster pp. 73, 75.
  53. ^ Simmons & Ekarius, p. 8.
  54. ^ a b Budiansky p. 78.
  55. ^ a b Squires, V.R. and Daws, G.T. (1975). Leadership and dominance relationships in Merino and Border Leicester sheep. Applied Animal Ethology, 1:263-274
  56. ^ Smith et al., p. 3.
  57. ^ a b Kendrick, Keith; da Costa AP; Leigh AE; Hinton MR; Peirce JW (November 2001). "Sheep don't forget a face". Nature 414 (6860): 165. doi:10.1038/35102669. PMID 11700543. 11700543. 
  58. ^ a b Morell, Virginia (March 2008). "Animal Minds". National Geographic Magazine (The National Geographic Society) 213 (3).  pg. 47
  59. ^ Wainwright, Martin (2004-07-30). "Pennine spot where sheep won't be fenced in". The Guardian. Retrieved 2008-06-17. 
  60. ^ a b c d Lynch, J.J., G. N Hinch and D. B. Adams. (1992). The Behaviour Of Sheep: Biological Principles And Implications For Production. CABI, Wallingford. 237 pp.
  61. ^ Fraser, A. F. and D. M. Broom. (1997). Farm Animal Behaviour And Welfare. 3rd Ed. CABI, Wallingford, UK. 437 pp.
  62. ^ Dwyer, C.M. (ed.) (2008). The Welfare Of Sheep. CABI, Wallingford, UK. 366 pp.
  63. ^ Vince, M. A., A. E. Billing, B. A. Baldwin, J. N. Toner and C. Weller. (1985). Maternal vocalizations and other sounds in the fetal lamb's sound environment. Early Human Development, 11: 179-190.
  64. ^ Houpt, K. A. (2005). Domestic Animal Behavior For Veterinarians And Animal Scientists. Blackwell Publishers, Ames, Iowa. 506 pp.
  65. ^ http://www.ansc.purdue.edu/USDA/viddic/viddics.htm
  66. ^ Alexander, G. and Shillito, E.E. (1978). Maternal responses in Merino ewes to artificially coloured lambs. Applied Animal Ethology, 4: 141-152
  67. ^ Piggins, D. and Phillips, C.J.C., (1996). The eye of the domesticated sheep and its implications for vision. Journal of Animal Science. 62(2): 301–308
  68. ^ Kilgour, R., (1977). Design sheep yards to suit the whims of sheep. N.Z. Farmer, 98(6): 29-31
  69. ^ Parrott, R.F., (1990). Physiological responses to isolation in sheep. Social Stress in Domestic Animals, Kluwer Academic Publishers, Dordrecht, Netherlands: 1990. 212 -226
  70. ^ Krueger, W.C., Laycock, W.A. and Price, D.A., (1974). Relationships of taste, smell, sight and touch on forage selection. Journal of Range Management, 27(4): 258–262
  71. ^ Ungerfeld, R., M. A. Ramos and R. Möller. 2006. Role of the vomeronasal organ on ram's courtship and mating behaviour and on mate choice among oestrous ewes. Appl. Anim. Behav. Sci. 99: 248-252.
  72. ^ Booth, K. K. and L. S. Katz. 2000. Role of the vomeronasal organ in neonatal offspring recognitions in sheep. Biol. Reprod. 63: 353-358.
  73. ^ Jainudeen, M. R. et al. 2000, Sheep and goats. In: Hafez, E. S. E. and B. Hafez (eds.) Reproduction in farm animals. 7th ed. Lippincott, Williams and Wilkins. pp. 172-181.
  74. ^ Wooster, p. 111.
  75. ^ a b c Schwartz, John (2007-01-25). "Of Gay Sheep, Modern Science and Bad Publicity". The New York Times. Retrieved 2007-12-07. 
  76. ^ Padula, A.M. (2005). "The freemartin syndrome: an update.". Animal Reproduction Science 87 (1/2): 93–109. doi:10.1016/j.anireprosci.2004.09.008. PMID 15885443. 
  77. ^ Parkinson, T. J. et al. 2001. Inter-relationships among gonadotrophins, reproductive steroids and inhibin in freemartin ewes. Reproduction 122: 397-409.
  78. ^ Szatkowska, I. and M. Switonski. 1996. Evidence on hereditary occurrence of placental anastomoses in heterosexual twins in sheep. Hereditas 124: 107-110
  79. ^ Smith, K. C. et al. 2003. Morphological, histological and histochemical studies of the gonads of ovine freemartin. Vet Rec. 152: 164-169.
  80. ^ Wooster, p. 71.
  81. ^ Wooster, p. 124.
  82. ^ "Quintuplet birth takes sheep breeder by surprise". Prague Daily Monitor (Czech News Agency). 2008-01-24. Archived from the original on January 29, 2008. Retrieved 2008-01-25. 
  83. ^ Smith, et al., p. 32.
  84. ^ Budiansky, pp. 122–23.
  85. ^ Smith et al., p. 110.
  86. ^ MAFF (UK) 2000. Sheep: codes of recommendations for the welfare of livestock. Ministry of Agriculture, Fisheries and Food, London. 25 pp.
  87. ^ Canadian Veterinary Medical Association. Position Statement, March 1996.
  88. ^ "Covexin 8 (Canada) for Animal Use". Drugs.com. Retrieved 2014-04-14. 
  89. ^ Tizard, I. R. 2000. Veterinary Immunology: An Introduction. 6th ed. Saunders. 482 pp.
  90. ^ de la Rosa , C. et al. 1997. Vaccination schedules to raise antibody concentrations against epsilon-toxin of Clostridium perfringens in ewes and their triplet lambs. J. Anim. Sci. 75: 2328-2334.
  91. ^ French, N. P. et al. 1994. Lamb tail docking: a controlled field study of the effects of tail amputation on health and productivity. Vet. Rec. 134: 463-467.
  92. ^ Wooster, p. 187.
  93. ^ Smith et al., p. 95.
  94. ^ "CFR - Code of Federal Regulations Title 21". Accessdata.fda.gov. 1996-11-07. Retrieved 2014-04-14. 
  95. ^ Paolo Bellavite, Riccardo Ortolani, and Anita Conforti (June 2006). "Immunology and Homeopathy. Experimental Studies on Animal Models". Evidence Based Complementary Alternative Medicine 3 (2): pp. 171–86. doi:10.1093/ecam/nel016. PMC 1475939. PMID 16786046. Retrieved 2008-02-12. 
  96. ^ Grandin, T. (ed.). 2007. Livestock handling and transport. 3rd Ed. CABI, Wallingford, UK. 386 pp.
  97. ^ a b Gregory, N. G. 1998. Animal welfare and meat science. CABI, Wallingford, UK. 298 pp.
  98. ^ Houpt, K. A. 2004. Behavioral physiology. In: Reece, W. O . (ed.). Dukes’ physiology of domestic animals. 12th Ed. Cornell Univ. Press, Ithaca, New York. pp. 952-961.
  99. ^ a b Moberg, G. P. and J. A. Mench. 2000. The biology of animal stress: basic principles and implications for welfare. CABI, Wallingford, UK. pp. 1-21.
  100. ^ Brogden, K. A., H. D. Lehmjuhl, R. C. Cutlip. 1998. Pasteurella haemolytica complicated respiratory infections in sheep and goats. Vet. Res. 29: 233-254.
  101. ^ Kimberling, C. V. 1988. Jensen and Swift’s diseases of sheep. 3rd Ed. Lea & Fibiger, Philadelphia. 394 pp.
  102. ^ Simmons & Ekarius, p. 161.
  103. ^ [1][dead link]
  104. ^ "Standard Operating Procedures - sheep Mulesing". New South Wales Department of Primary Industries. Retrieved 2008-03-01. 
  105. ^ Primary Industries Ministerial Council (2006). "The Sheep" (PDF). Model Code of Practice for the Welfare of Animals. Primary Industries Report Series (2nd ed.) (CSIRO Publishing). pp. 17–23. ISBN 0-643-09357-5. Retrieved 2008-03-01. 
  106. ^ a b "Sheep and Goats Death Loss". National Agricultural Statistics Service. 2005-05-06. Retrieved 2007-12-27. 
  107. ^ "Sheep mauled by wild dogs". Tweed Daily News. 2008-01-18. Retrieved 2008-01-21. 
  108. ^ Lewis, Gareth (2008-01-21). "Sheep worrying leads to warning from farmers". The Daily Echo. Retrieved 2008-01-21. 
  109. ^ Macdonald, David Whyte; Claudio Sillero-Zubiri (2004). The Biology and Conservation of Wild Canids. Oxford University Press. ISBN 0-19-851555-3. 
  110. ^ Simmons & Ekarius, p. 124.
  111. ^ Simmons & Ekarius, p. 131.
  112. ^ "Effects of Wildlife Services on Predator Populations". Wildlife Services. October 2001. Retrieved 2008-01-24. 
  113. ^ Cuming, Marius (2008-01-24). "Live sheep ship-shape". North Queensland Register. Retrieved 2008-01-24. 
  114. ^ Severson, Kim (2005-09-14). "Iceland Woos America With Lamb and Skyr". The New York Times. Retrieved 2008-01-27. 
  115. ^ Wooster, p.ix.
  116. ^ Simmons & Ekarus p. 325–329
  117. ^ "Sheep Poo paper". Creative Paper Wales. Archived from the original on October 12, 2007. Retrieved 2007-12-01. 
  118. ^ Simmons & Ekarius p. 322
  119. ^ Simmons & Ekarius p. 333
  120. ^ a b "Why counting sheep can be very expensive: Ram sold for world record £231,000". The Daily Mail. August 29, 2009. 
  121. ^ Simmons & Ekarius p. 332–334
  122. ^ Smith et al., p. 31.
  123. ^ Small, Joanna (2008-01-18). "Sheep Compete With Beef". KSBR News (ABC). Archived from the original on March 16, 2008. Retrieved 2008-01-27. 
  124. ^ Simmons & Ekarius, p. 1.
  125. ^ a b Wilde, Matthew (2008-01-20). "Profit opportunities raising sheep". Waterloo-Cedar Falls Courier. Retrieved 2008-01-27. 
  126. ^ Simmons & Ekarius, p. 3.
  127. ^ Oxford English Dictionary, 1933: Mutton, Sheep, Beef.
  128. ^ "Mutton". Merriam-Webster's Online Dictionary. Retrieved 2008-01-23. 
  129. ^ "What Is Mutton? Understanding The History". Mutton Renaissance Campaign. Retrieved 2008-01-23. 
  130. ^ a b c d Apple Jr., R.W. (2006-03-29). "Much Ado About Mutton, but Not in These Parts". The New York Times. Retrieved 2008-01-23. 
  131. ^ Smith et al., p. 147.
  132. ^ "Sheep Trade in Syria". napcsyr.org. National Agricultural Policy Center, Ministry of Agriculture and Agrarian Reform, Syrian Arab Republic. 
  133. ^ Kurmann, Joeseph A.; Jeremija Lj. Rašić Manfred Kroger (1992). Encyclopedia of Fermented Fresh Milk Products: An International Inventory. 233 Spring Street New York, NY: Springer. ISBN 0-442-00869-4.  p. 343
  134. ^ "Docking, castrating, and disbudding". 
  135. ^ "Marketing Live Stock". 
  136. ^ "Kansas State Board of Agriculture report". 
  137. ^ "Fifth Report on the Statistics on the Number of Animals used for Experimental and other Scientific Purposes in the Member States of the European Union" (PDF). Commission of the European Communities. November 2007. Retrieved 2008-02-10. 
  138. ^ Lehrman, Sally (July 2008). "No More Cloning Around". Scientific American. Retrieved 2008-09-21. 
  139. ^ de Gortari MJ, Freking BA, Cuthbertson RP, et al. (1998). "A second-generation linkage map of the sheep genome". Mamm. Genome 9 (3): pp. 204–09. doi:10.1007/s003359900726. PMID 9501303. 
  140. ^ Dalrymple BP, Kirkness EF, Nefedov M, et al. (2007). "Using comparative genomics to reorder the human genome sequence into a virtual sheep genome". Genome Biol 8 (7): R152. doi:10.1186/gb-2007-8-7-r152. PMC 2323240. PMID 17663790. 
  141. ^ Tan Ee Lyn (April 24, 2012). "Worm turns sheep clone to "good" fat: China scientists". Reuters. 
  142. ^ Fountain, Henry (2008-01-22). "In a Sheep Population, Researchers Find a Fitness Gene". The New York Times. Retrieved 2008-02-05. 
  143. ^ Sample, Ian (2008-01-18). "Soays' natural selection on the hoof". The Guardian. Retrieved 2008-02-05. 
  144. ^ Fleming, Nic (2008-01-18). "Darker black sheep's decline is in the genes". The Daily Telegraph. Archived from the original on 2008-03-17. Retrieved 2008-02-05. 
  145. ^ Roselli CE, Larkin K, Resko JA, Stellflug JN, Stormshak F (2004). "The volume of a sexually dimorphic nucleus in the ovine medial preoptic area/anterior hypothalamus varies with sexual partner preference". Endocrinology 145 (2): pp. 478–83. doi:10.1210/en.2003-1098. PMID 14525915. 
  146. ^ Recchia FA, Lionetti V (2007). "Animal models of dilated cardiomyopathy for translational research". Vet. Res. Commun. 31 Suppl 1: pp. 35–41. doi:10.1007/s11259-007-0005-8. PMID 17682844. 
  147. ^ Hasenfuss G (1998). "Animal models of human cardiovascular disease, heart failure and hypertrophy". Cardiovasc. Res. 39 (1): 60. doi:10.1016/S0008-6363(98)00110-2. PMID 9764190. 
  148. ^ Barry JS, Anthony RV (2008). "The pregnant sheep as a model for human pregnancy". Theriogenology 69 (1): pp. 55–67. doi:10.1016/j.theriogenology.2007.09.021. PMC 2262949. PMID 17976713. 
  149. ^ Vuguin PM (2007). "Animal models for small for gestational age and fetal programming of adult disease". Horm. Res. 68 (3): 113. doi:10.1159/000100545. PMID 17351325. 
  150. ^ Peirce JW, Leigh AE, daCosta AP, Kendrick KM. (June 2001). "Human face recognition in sheep: lack of configurational coding and right hemisphere advantage.". Behavioural processes 55 (1): 13. doi:10.1016/S0376-6357(01)00158-9. PMID 11390088. 
  151. ^ "Sheep". Merriam-Webster's Online Dictionary. Retrieved 2007-12-01. 
  152. ^ a b Ammer, Christine (1997). American Heritage Dictionary of Idioms. Google Books. ISBN 978-0-395-72774-4. Retrieved 2007-11-13. 
  153. ^ "Sheepish". Merriam-Webster's Online Dictionary. Retrieved 2007-12-01. 
  154. ^ Budiansky, p. 159.
  155. ^ a b c Cooper, JC (1992). Symbolic and Mythological Animals. London: Aquarian Press. p. 219. ISBN 1-85538-118-4. 
  156. ^ "Eid ul Adha (10 Dhul-Hijja) - the festival of sacrifice". BBC. Retrieved 2008-01-08. 
  157. ^ "Eid Festival Around The World - Graphic photos". Sweetness & Light. Retrieved 2008-01-08. 
  158. ^ Robertson, Cambpell (August 13, 200). "Bloody Blessing Goes Unnoticed". The New York Times. Retrieved 2008-09-10. 

References[edit]

  • Budiansky, Stephen (1999). The Covenant of the Wild: Why animals chose domestication. Yale University Press. ISBN 0-300-07993-1. 
  • Ensminger, Dr. M.E.; Dr. R.O. Parker (1986). Sheep and Goat Science, Fifth Edition. Danville, Illinois: The Interstate Printers and Publishers Inc. ISBN 0-8134-2464-X. 
  • Pugh, David G. (2001). Sheep & Goat Medicine. Elsevier Health Sciences. ISBN 0-7216-9052-1. 
  • Simmons, Paula; Carol Ekarius (2001). Storey's Guide to Raising Sheep. North Adams, MA: Storey Publishing LLC. ISBN 978-1-58017-262-2. 
  • Smith M.S., Barbara; Mark Aseltine PhD; Gerald Kennedy DVM (1997). Beginning Shepherd's Manual, Second Edition. Ames, Iowa: Iowa State University Press. ISBN 0-8138-2799-X. 
  • Weaver, Sue (2005). Sheep: small-scale sheep keeping for pleasure and profit. 3 Burroughs Irvine, CA 92618: Hobby Farm Press, an imprint of BowTie Press, a division of BowTie Inc. ISBN 1-931993-49-1. 
  • Wooster, Chuck; Geoff Hansen (Photography) (2005). Living with Sheep: Everything You Need to Know to Raise Your Own Flock. Guilford, Connecticut: The Lyons Press. ISBN 1-59228-531-7. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Jacob (sheep)

The Jacob sheep is a rare breed of small, piebald (black and white spotted), polycerate (multi-horned) sheep. Jacobs may have as many as six horns, although four horns is most common. Jacobs are usually raised for their wool, meat, and hides. They are kept as pets and ornamental animals, and have been used as guard animals to protect farm property from theft or vandalism and to defend other livestock against predators.

Generally referred to as an unimproved or heirloom breed (one that has survived with little human selection), the Jacob is descended from an ancient Old World breed of sheep, although its exact origins remain unclear. Spotted polycerate sheep were documented in England by the mid–17th century, and were widespread a century later. Unlike most other old world breeds, the Jacobs of North America have not undergone extensive cross-breeding and selective breeding; their body habitus resembles that of a goat. Relative to their American counterparts, British Jacobs tend to be larger and heavier, and have lost many of their original characteristics through artificial selection.

Contents

History

Jacob is shaking hands with Esau. In the foreground are two long-tailed white sheep, two cows and a goat. In the background are two camels and a horse.
Peter Paul Rubens, The Reconciliation of Jacob and Esau, 1624. Two long-tailed sheep are visible in the foreground of this painting.

The origins of the Jacob are obscure, but it is certainly a very old breed. Piebald sheep have been described throughout history, appearing in works of art from the Far East, Middle East, and Mediterranean regions.[1] A piebald breed of sheep probably existed in the Levant, specifically in the area that is now known as Syria, about three thousand years ago.[2]

Among the many accounts of ancient breeds of piebald sheep is the story of Jacob from the first book of the Hebrew Bible and the Christian Old Testament. According to the Book of Genesis (Genesis 30:31–43), in what may be the earliest recorded attempt at selective breeding,[3] Jacob took every speckled and spotted sheep from his father-in-law's (Laban's) flock and bred them. The Jacob is indeed named for the Biblical figure of Jacob.[1][4] The resulting breed may have accompanied the westward expansion of human civilization through Northern Africa, Sicily, Spain and eventually England.[2] However, it was not until the 20th century when the breed acquired the name "Jacob sheep".[5]

A limited amount of circumstantial evidence from the historical record lends support to a related theory that the Jacob is a descendant of the fat-tailed sheep, another ancient breed from Mesopotamia.[6] The earliest records of the fat-tailed sheep are found in the Sumerian cities of ancient Uruk (3000 BC) and Ur (2400 BC) on stone vessels and mosaics. Another early reference to this breed is found in the Book of Leviticus (Leviticus 3:9), where an animal sacrifice is described which includes the tail fat of sheep. Despite the scant evidence from the historical record, a recent genetic analysis has provided compelling evidence supporting a direct link between the Jacob and certain unimproved breeds in Southwest Asia and Africa rather than other British breeds.[6] Using retroviruses as genetic markers, the authors found that sheep dispersed across Eurasia and Africa via at least two separate migratory episodes. Descendants of the first migrations include the Mouflon, as well as other unimproved breeds, such as the North Ronaldsay sheep, Soay sheep, and the northern European short-tailed sheep. A later migratory episode shaped the great majority of present-day breeds.

Some people believe that the Jacob is a descendant of a subarctic breed of sheep introduced by Vikings to the British Isles during the Middle Ages.[7] Norsemen are indeed believed to have introduced certain robust types of sheep to Northern Europe and the British Isles between the late eighth century to the middle of the eleventh century.[8] However, the sheep introduced by the Norse were of a short-tailed variety native to an area stretching from the British Isles to the Baltic, known as the northern European short-tailed sheep. In fact, all Scandinavian breeds belong to the Northern European short-tailed group of sheep.[8] The northern European short-tailed sheep are a group of sheep breeds and landraces which includes the Finnsheep, Icelandic, Romanov, Shetland, Spaelsau, and several other breeds. The Jacob bears little resemblance to these.[8] The Jacob is a long-tailed breed, and is therefore unlikely to be related to any breeds introduced by the Vikings.[9]

One persistent legend holds that the Jacob washed ashore from shipwrecks in England after the destruction of the Spanish Armada in 1588.[2] Despite the fact that there is little if any reliable evidence to support this claim, the Jacob was referred to as the "Spanish sheep" for much of its early recorded history. It has been bred in England for at least 350 years,[3][4][10] and spotted sheep were widespread in England by the mid–18th century. By that time, Jacobs were often kept as ornamental animals grazed in parks, which probably kept the breed extant.[1] In recent years, Jacobs have been used as guard sheep in Gloucestershire, in the manner of guard dogs, to protect farm property from vandalism.[11][12][13]

Jacobs were first imported into parks and zoos of North America in the early 20th century.[10] Some individuals acquired them from zoos in the 1960s and 1970s, but the breed remained rare in America until the 1980s. Most of today’s population of American Jacobs is descended from those imported at that time. The Jacob Sheep Breeders Association (JSBA), organized in 1989, was the first breed association to be established in North America.[14] Jacobs have become popular among small flock holders as well as handspinners and weavers.[1]

Conservation status

Conservation charities such as the American Livestock Breeds Conservancy (ALBC) of North America and the Rare Breeds Survival Trust (RBST) of the United Kingdom are responsible for the documentation and preservation of rare breeds of domesticated animals, including the Jacob. There are also several breed registries whose only focus is the Jacob, such as the American Jacob Sheep Registry and the Jacob Sheep Breeders Association. In the United States, identification of Jacobs as endangered and ensuing registration of sheep began in 1985. As of 2009, the ALBC has listed the American population of the Jacob as a "threatened breed" and a conservation priority.[1] The breed is estimated to have fewer than 1,000 annual registrations in the United States and a global population of less than 5,000. Identifying purebreds is a continual challenge for American breeders, and the marketing of crossbreeds (such as the Jacob-Dorset) as purebred Jacobs to unsuspecting buyers has presented a significant obstacle to the conservation of the American population.[1] However, the RBST in the United Kingdom do not view the Jacob as being at risk as there are in excess of 3,000 registered breeding females.[15]

Physical characteristics

Photograph of a multi-horned Jacob ram with fully grown horns at Wildpark Schloss Tambach, Weitramsdorf, Germany
A multi-horned Jacob ram with fully grown horns at Wildpark Schloss Tambach, Weitramsdorf-Tambach, Germany

General

The Jacob is a small, multi-horned, piebald sheep that resembles a goat in its conformation. However, it is not the only breed that can produce polycerate or piebald offspring. Other polycerate breeds include the Hebridean, Icelandic, Manx Loaghtan, and the Navajo-Churro, and other piebald breeds include the Finnsheep and the West African Dwarf.

Mature rams (males) weigh about 120 to 180 pounds (54 to 82 kg), while ewes (females) weigh about 80 to 120 pounds (36 to 54 kg).[16] The body frame is long, with a straight back and a rump that slopes toward the base of the tail. The rams have short scrotums free of wool which hold the testicles closer to the body than those of modern breeds, while the ewes have small udders free of wool that are also held closer to the body than those of modern breeds.[16] The head is slender and triangular, and clear of wool forward of the horns and on the cheeks.[16] The tail is long and woolly, extending almost to the hock if it has not been docked. Jacob owners do not usually dock the tail completely, even for market sheep, but instead leave several inches to cover the anus and vulva. The legs are medium-length, slender, free of wool below the knees, and preferably white with or without colored patches. The hooves are black or striped.[16] It is not unusual for Jacobs to be cow-hocked. They provide a lean carcass with little external fat, with a high yield of meat compared to more improved breeds.[2]

Horns

Photograph of a Jacob sheep skull on display at the Muséum d'Histoire Naturelle, Bordeaux, France
Jacob sheep skull on display at the Muséum d'Histoire Naturelle, Bordeaux, France

The most distinguishing features of the Jacob are their four horns, although they may have as few as two or as many as six horns.[1][5][10][17] Both sexes are always horned, and the rams tend to have larger and more impressive horns.[1] Two-horned rams typically have horizontal double curled horns. Four-horned rams have two vertical center horns which may be up to two feet or more in length, and two smaller side horns, which grow down along the sides of the head. The horns on the ewe are smaller in diameter, shorter in length and appear more delicate than those of the ram.[17] American Jacobs may have two horns, but are more often polycerate. British Jacobs most often have two horns. Polled (hornless) sheep are not registerable, as this trait is considered to indicate past cross-breeding. There is no such thing as a polled purebred Jacob).[18]

The horns are normally black, but may be black and white striped; white horns are undesirable. Ideally, horns should be smooth and balanced, strongly attached to the skull, and should grow in a way that will not impede the animal's sight or grazing abilities. Rams have larger horns than ewes. The horns in two-horned sheep, and the lower horns in four-horned animals, grow in a spiral shape. The rostral set of horns usually extend upwards and outwards, while the caudal set of horns curls downwards along the side of the head and neck. On polycerate animals it is preferred that there is a fleshy gap between the two pairs of horns. Partial or deformed horns that are not firmly attached to the skull, often referred to as "scurs", are not unusual but are considered undesirable.[16]

The multihorned trait is genetically linked to a condition known as split eyelid. In mild cases the eyelid shows a "peak" but does not impair vision or cause discomfort. Extreme cases (Grade 3 or higher) result in a complete separation of the upper eyelid in the middle, and these sheep should not be used for breeding.[16]

Markings

Each Jacob has distinctive markings which enables the shepherd to identify specific sheep at a distance. Desirable color traits include an animal which is approximately 60% white, with the remaining 40% consisting of a random pattern of black or "lilac" (brownish-gray)[1] spots or patches.[16] The skin beneath the white fleece is pink, while skin beneath colored spots is darkly pigmented. Both rams and ewes exhibit black markings, some of which are breed specific and some of which are random.[16]

Breed specific markings include large, symmetrical dark patches incorporating the ears, eyes and cheeks, and a dark cape over the dorsal part of the neck and shoulders. The face should have a white blaze extending from the poll to the muzzle. The muzzle itself should be dark. The classic Jacob face is often referred to as "badger-faced", consisting of black cheeks and muzzle with a white blaze running down the front of the face.[17] In addition to these markings, random spots may occur on the rest of the body and legs (including the carpi, hocks, and pasterns). Certain markings are common in particular lines: large muzzle markings, lack of leg markings, lack of muzzle marking, etc.[17]

Wool and hides

Photograph of a Jacob ewe in full fleece
A Jacob ewe in full fleece

While other British and Northern European multi-horned sheep have a fine inner coat and a coarse, longer outer coat,[8] Jacobs have a medium grade[17] fleece and no outer coat.[2] The grade of Jacob wool is of a spinning count (S number or Bradford count) of 46–54,[17] which corresponds to an average fiber diameter of about 32.7–27.9 micrometers, or Low 1/4 Blood–1/4 Blood on the American or Blood grading system.[19] Lambs of the more primitive lines are born with a coat of guard hair that is protective against rain and cold; this hairy birth coat is shed at 3–6 months.[17]

In general, the fleece is of a light, soft, springy and open character, with little lanolin (grease). The fleece generally weighs 3 to 6 pounds (1.4 to 2.7 kg) and varies in crimp and fineness. Staple length is generally 3 to 5 inches (7.6 to 13 cm) and may be up to 7 inches (18 cm).[17] Similar to other unimproved breeds, most Jacobs have some white, kinky, kemp (coarse wool) in their fleece, though excessive kemp is undesirable. In some sheep (particularly British Jacobs, which have denser fleeces), the black wool will grow longer or shorter than the white wool. This is called "quilted fleece" and is an undesirable trait.[20]

Jacobs are shorn once a year, most often in the springtime. Some individual sheep may develop a natural "break" in the fleece in springtime, which can lead to a natural shedding of the fleece, particularly around the neck and shoulders. The medium-fine grade wool has a high luster, and is highly sought after by handspinners if it is free of kemp.[3] The colors may be separated or blended after shearing and before spinning to produce various shades of yarn from a single fleece, from nearly white to nearly black.[17] The tanned pelts also command high market prices.[10]

Husbandry

Photograph of a Jacob ewe nursing her lamb
A horned Jacob ewe nursing her lamb
Jacob sheep in field

The Jacob is generally considered to be an "unimproved" or "heirloom" breed (one that has survived with little human selection).[21] Such breeds have been left to breed amongst themselves, often for centuries. As a result, they retain much of their original wildness, as well as their physical characteristics. American breeders have not subjected Jacobs to extensive cross-breeding or selective breeding, other than for fleece characteristics.[1] Like other unimproved breeds, significant variability is present among individuals within a flock. In contrast, the British Jacob has been selected for greater productivity of meat, and therefore tends to be larger, heavier and have a more uniform appearance. While the American Jacob has retained nearly all of the original phenotypic characteristics of its Old World ancestors, its British counterpart has lost many of its unimproved physical characteristics through cross-breeding and selective breeding. The British Jacob has thus diverged from the American Jacob as a result of artificial selection.[1]

Jacobs are typically hardy, low-maintenance animals with a naturally high resistance to parasites and hoof problems.[2] Jacobs do not show much flocking behavior. They can be skittish if not used to people, although with daily handling they will become tame and make good pets. They require shelter from extreme temperatures, but the shelter can be open and simple. They tend to thrive in extremes of heat and cold and have good or excellent foraging capabilities. They can secure adequate nutrition with minimal to no supplementation, even in the presence of suboptimal soil conditions.[21][22]

Due to their low tail dock and generally unimproved anatomy, Jacob ewes are widely reputed to be easy-lambing.[17] Jacobs are seasonal breeders, with the ewes generally cycling in the cooler months of the fall. Ewes will begin to cycle during the first fall following their birth and most often the ewe's first lamb is a single. Subsequent gestations will typically bear one or two lambs in the spring, and triplets are not unusual. The lambs will exhibit their spotting and horn characteristics at birth, with the horn buds more readily apparent on ram lambs. Lambs may be weaned at two months of age, but many shepherds to not separate lambs and allow the ewe to wean the lamb at about 4 months of age.[17] Jacob ewes are instinctively attentive mothers, and quite protective of their lambs. Jacob ewes are included in commercial flocks in England due to their ease of lambing and strong mothering instincts.[4][2]

Tay–Sachs disease

Tay–Sachs disease is one of several related genetic disorders in humans known as lysosomal storage diseases. It is caused by a deficiency of hexosaminidase A, an enzyme involved in the hydrolysis of GM2 ganglioside. The enzyme deficiency in turn is caused by a mutation on the HEXA gene on chromosome 15. This autosomal recessive disease is characterized by progressive deterioration of mental and physical abilities, usually resulting in death by the age of four years.[23]

Recent research has revealed that this disease exists in some flocks of Jacob sheep. Four Jacob lambs from St. Jude's Farm in Lucas, Texas were examined for an unusual, progressive and ultimately fatal neurologic disease.[24] Clinical findings included ataxia in all 4 limbs, proprioceptive deficits, and cortical blindness. the diagnosis of GM2 gangliosidosis was confirmed by biochemical and molecular genetic studies.[25] Furthermore, the biochemical mechanism for this disease in the Jacob (diminished activity of hexosaminidase A resulting in increased concentrations of GM2 ganglioside) is virtually identical to that observed in humans.[25] Sequencing of the cDNA of the HEXA gene of affected Jacobs reveals an identical number of nucleotides and exons as in the human HEXA gene, and 86% identity in nucleotide sequence. A missense mutation (now referred to as the G444R mutation)[26] was found in the HEXA cDNA of the affected sheep caused by a single nucleotide change at the end of exon 11 resulting in skipping of exon 11. This model of Tay–Sachs disease provided by the Jacob sheep is the first to offer promise as a means for trials of gene therapy which may eventually prove to be useful in the treatment of the disease in humans.[24]

Bai Zeng and Paola Torres of the Department of Neurology at New York University School of Medicine examined DNA samples of 443 Jacobs from various flocks within the United States. 51 of these specimens were identified as carriers of the G444R mutation (a carrier incidence of 11%); 90% of the flocks were found to have one or more mutation carriers.[26] Either Jacob parent can carry the mutant autosomal recessive gene. Carriers appear normal and live a normal life.[26] Turner 183K, a bloodline foundation ram and the apparent source of the mutation in North America, was born of imported Jacobs and the primary suspect is Turner’s mother.[26] The identification of this type of genetic defect in a foundation ram is particularly concerning because the North American population of Jacobs is considered to be a bottleneck breed representing a very small gene pool.[27]

References

  1. ^ a b c d e f g h i j k l American Livestock Breeds Conservancy (2009). "Jacob Sheep". Pittsboro, North Carolina: American Livestock Breeds Conservancy. http://www.albc-usa.org/cpl/jacob.html. Retrieved 2011-05-05. 
  2. ^ a b c d e f g Jacob Sheep Breeders Association (2009). "About Jacob Sheep". Dexter, Oregon: Jacob Sheep Breeders Association. http://www.jsba.org/history.htm. Retrieved 2011-05-05. 
  3. ^ a b c Schoenian S (2010). "Sheep Breeds J-L: Jacob". Clear Spring, Maryland: Sheep 101. http://www.sheep101.info/breedsJ-L.html#Jacob. Retrieved 2011-05-05. 
  4. ^ a b c American Jacob Sheep Registry (2006). "About the Jacob Sheep...". McKean, Pennsylvania: American Jacob Sheep Registry. http://jacob.sheepregistry.com/. Retrieved 2011-05-05. 
  5. ^ a b "Jacob". Breeds of Sheep. Oklahoma State University. http://www.ansi.okstate.edu/breeds/sheep/jacob/index.htm. Retrieved 2011-05-05. 
  6. ^ a b Chessa B, Pereira F, Arnaud F, Amorim A, Goyache F, Mainland I, et al (2009). "Revealing the History of Sheep Domestication Using Retrovirus Integrations". Science 324 (5926): 532–6. doi:10.1126/science.1170587. ISSN 0036-8075. PMID 19390051. http://www.sciencemag.org/cgi/content/short/324/5926/532. Retrieved 2011-05-05. 
  7. ^ Jim & Beth Boyle (2002). "Piebald or Jacob Sheep". Mayville, New York: The Rams Horn Studio. http://www.ramshornstudio.com/jacob_sheep.htm. Retrieved 2011-05-05. 
  8. ^ a b c d Dýrmundsson, ÓR; Niżnikowski, R (2009). "North European Short-tailed Breeds of Sheep: a Review". Animal (The International Journal of Animal Biosciences) 4 (08): 1275–1282. doi:10.1017/S175173110999156X. ISSN 1751-7311. http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=7822053. Retrieved 2011-05-05. 
  9. ^ Ryder, Chapter 9, pp. x–x in Ryder (2007)
  10. ^ a b c d Simmons and Ekarius, Chapter 2: Breeding and Breeds, pp. 30–98 in Simmons and Ekarius (2009)
  11. ^ Perrie, R (23 March 2007). "Do Ewe Want an Attack Sheep?". The Sun (London: News International). http://www.thesun.co.uk/sol/homepage/news/article22408.ece. Retrieved 2011-05-05. 
  12. ^ Haines L (23 March 2007). "Vigilante attack sheep guard British village: Ruthless 'pack' trained and ready to kill". The Register (London). http://www.theregister.co.uk/2007/03/23/sheep_pack/. Retrieved 2011-05-05. 
  13. ^ Off C (28 March 2007). "TB: Attack Sheep". As It Happens (Toronto, Ontario, Canada: Canadian Broadcasting Corporation). 
  14. ^ Dan Bohr (2006). "The Jacob Sheep Breed". St. Johns, Michigan: Sweetgrass Jacob Sheep. http://www.sweetgrass-jacobs.com/jacobs.html. Retrieved 2011-05-05. 
  15. ^ Rare Breeds Survival Trust (2010). "Rare Breeds Watchlist". Stoneleigh Park, Warwickshire, United Kingdom: Rare Breeds Survival Trust. http://www.rbst.org.uk/watch-list/sheep. Retrieved 2011-05-05. 
  16. ^ a b c d e f g h Jacob Sheep Breeders Association (2009). "JSBA Breed Standard". Dexter, Oregon: Jacob Sheep Breeders Association. http://www.jsba.org/standard.htm. Retrieved 2011-05-05. 
  17. ^ a b c d e f g h i j k Horak F and Horak J (2010). "What is a Jacob Sheep?". Lucas, Texas: Jacob Sheep Conservancy. http://www.jacobsheepconservancy.org/jsc_about.htm. Retrieved 2011-05-05. 
  18. ^ American Jacob Sheep Registry (2005). "Description of the Jacob Sheep". McKean, Pennsylvania: American Jacob Sheep Registry. http://jacob.sheepregistry.com/descrip.htm. Retrieved 2011-05-05. 
  19. ^ Kott R (1993). "Wool Grading". Bozeman, Montana: Montana State University. http://msuextension.org/publications/AgandNaturalResources/MT198380AG.pdf. Retrieved 2011-05-05. 
  20. ^ Jacob Sheep Breeders Association (2006). "Jacob sheep in the show ring: information for judges". Dexter, Oregon: Jacob Sheep Breeders Association. http://www.jsba.org/JudgesPacket.pdf. Retrieved 2011-05-05. 
  21. ^ a b Wooster and Hansen, Chapter 2: Choosing a Flock, pp. 11–28 in Wooster and Hansen (2005)
  22. ^ Simmons and Ekarius, Chapter 3: Pasture, Fences, and Facilities, pp. 99–134 in Simmons and Ekarius (2009)
  23. ^ National Institute of Neurological Disorders and Stroke (2007). "Tay-Sachs Disease Information Page". Bethesda, Maryland: National Institute of Neurological Disorders and Stroke. http://www.ninds.nih.gov/disorders/taysachs/taysachs.htm. Retrieved 2011-05-05. 
  24. ^ a b Torres PA, Zeng BJ, Porter BF, Alroy J, Horak F, Horak J, Kolodny EH (2010). "Tay-Sachs disease in Jacob sheep". Molecular Genetics and Metabolism 101 (4): 357–63. doi:10.1016/j.ymgme.2010.08.006. ISSN 1096-7192. PMID 20817517. 
  25. ^ a b Porter BF, Lewis BC, Edwards JF, Alroy J, Zeng BJ, Torres PA, Bretzlaff KN, Kolodny EH (2011). "Pathology of GM2 Gangliosidosis in Jacob Sheep". Veterinary Pathology 48 (3). doi:10.1177/0300985810388522. ISSN 0300-9858. PMID 21123862. 
  26. ^ a b c d Kolodny E, Horak F, Horak J (2011). "Jacob sheep breeders find more Tay-Sachs carriers". ALBC Newsletter. Pittsboro, North Carolina: American Livestock Breeds Conservancy. http://www.albc-usa.org/Newsletter/newsletterJanFeb2011.html. Retrieved 2011-05-05. 
  27. ^ Horak F (2009). "Jacob Sheep Shed Light on Tay Sachs Disease". ALBC Newsletter. Pittsboro, North Carolina: American Livestock Breeds Conservancy. http://www.albc-usa.org/Newsletter/newsletterJanFeb2009.html. Retrieved 2011-05-05. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Grubb (in Wilson and Reeder 1993, 2005) included O. orientalis (Asiatic Mouflon), as well as O. musimon and O. ophion (primitive domestic sheep, now feral), in Ovis aries; this arrangement is adopted in this database. Ovis aries has been included in O. ammon (Argali) by some authors, but O. ammon was regarded as a distinct species by Grubb (in Wilson and Reeder 1993, 2005). Ovis aries (O. orientalis) hybridizes with O. vignei in Iran. See Tomich (1986) for information on Ovis aries-O. musimon hybrids in Hawaii.

Common name (Red Sheep) is from Grubb (in Wilson and Reeder 2005).

Domestic sheep are derived from wild sheep of central and western Eurasia.

The genus Ovis has been included in the genus Capra by some authors.

See Georgiadis et al. (1991) for a phylogeny of the Bovidae based on allozyme divergence among 27 species. See Kraus and Miyamoto (1991) for a phylogenetic analysis of pecoran ruminants (Cervidae, Bovidae, Moschidae, Antilocapridae, and Giraffidae) based on mitochondrial DNA data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!